ID: 1077530681

View in Genome Browser
Species Human (GRCh38)
Location 11:3093411-3093433
Sequence CCTCCCTGCCAGGGACATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 1, 2: 3, 3: 31, 4: 295}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077530668_1077530681 18 Left 1077530668 11:3093370-3093392 CCAGGACACGTGATCTGCCACCA 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1077530681 11:3093411-3093433 CCTCCCTGCCAGGGACATCCTGG 0: 1
1: 1
2: 3
3: 31
4: 295
1077530673_1077530681 1 Left 1077530673 11:3093387-3093409 CCACCAGGGGTGCACCAGGCCTG 0: 1
1: 0
2: 2
3: 28
4: 264
Right 1077530681 11:3093411-3093433 CCTCCCTGCCAGGGACATCCTGG 0: 1
1: 1
2: 3
3: 31
4: 295
1077530674_1077530681 -2 Left 1077530674 11:3093390-3093412 CCAGGGGTGCACCAGGCCTGCCC 0: 1
1: 0
2: 3
3: 40
4: 329
Right 1077530681 11:3093411-3093433 CCTCCCTGCCAGGGACATCCTGG 0: 1
1: 1
2: 3
3: 31
4: 295
1077530667_1077530681 23 Left 1077530667 11:3093365-3093387 CCTTTCCAGGACACGTGATCTGC 0: 1
1: 0
2: 0
3: 4
4: 119
Right 1077530681 11:3093411-3093433 CCTCCCTGCCAGGGACATCCTGG 0: 1
1: 1
2: 3
3: 31
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077530681 Original CRISPR CCTCCCTGCCAGGGACATCC TGG Intronic