ID: 1077530683

View in Genome Browser
Species Human (GRCh38)
Location 11:3093413-3093435
Sequence TCCCTGCCAGGGACATCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 264}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077530673_1077530683 3 Left 1077530673 11:3093387-3093409 CCACCAGGGGTGCACCAGGCCTG 0: 1
1: 0
2: 2
3: 28
4: 264
Right 1077530683 11:3093413-3093435 TCCCTGCCAGGGACATCCTGGGG 0: 1
1: 0
2: 4
3: 25
4: 264
1077530668_1077530683 20 Left 1077530668 11:3093370-3093392 CCAGGACACGTGATCTGCCACCA 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1077530683 11:3093413-3093435 TCCCTGCCAGGGACATCCTGGGG 0: 1
1: 0
2: 4
3: 25
4: 264
1077530667_1077530683 25 Left 1077530667 11:3093365-3093387 CCTTTCCAGGACACGTGATCTGC 0: 1
1: 0
2: 0
3: 4
4: 119
Right 1077530683 11:3093413-3093435 TCCCTGCCAGGGACATCCTGGGG 0: 1
1: 0
2: 4
3: 25
4: 264
1077530674_1077530683 0 Left 1077530674 11:3093390-3093412 CCAGGGGTGCACCAGGCCTGCCC 0: 1
1: 0
2: 3
3: 40
4: 329
Right 1077530683 11:3093413-3093435 TCCCTGCCAGGGACATCCTGGGG 0: 1
1: 0
2: 4
3: 25
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077530683 Original CRISPR TCCCTGCCAGGGACATCCTG GGG Intronic