ID: 1077532081

View in Genome Browser
Species Human (GRCh38)
Location 11:3102063-3102085
Sequence CCCCGAGGGCCGGCTTCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077532081_1077532089 5 Left 1077532081 11:3102063-3102085 CCCCTGGAAGCCGGCCCTCGGGG 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1077532089 11:3102091-3102113 CTTGCCCCTGCCTGCTGCCAGGG 0: 1
1: 0
2: 5
3: 58
4: 512
1077532081_1077532088 4 Left 1077532081 11:3102063-3102085 CCCCTGGAAGCCGGCCCTCGGGG 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1077532088 11:3102090-3102112 GCTTGCCCCTGCCTGCTGCCAGG 0: 1
1: 0
2: 3
3: 48
4: 458

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077532081 Original CRISPR CCCCGAGGGCCGGCTTCCAG GGG (reversed) Intronic
900126626 1:1071712-1071734 CCTCGGGGACCGACTTCCAGTGG + Exonic
902747519 1:18483363-18483385 CCCAGAGGGACGGCTGGCAGTGG - Exonic
902810189 1:18883618-18883640 CCCAGAGGGCCGGCTACAGGAGG - Intronic
904040292 1:27580314-27580336 CCCCCTGGCCTGGCTTCCAGAGG - Intronic
906694860 1:47817170-47817192 CCTAGAGGGGCGGCCTCCAGAGG + Intronic
907412383 1:54291940-54291962 GCCCGAGAGCAGCCTTCCAGGGG - Intronic
911144020 1:94535337-94535359 CTCCTAGGGCCAGCTTACAGGGG + Intronic
917291602 1:173477229-173477251 CCCCGCGGCCCGGCCCCCAGCGG + Intergenic
919950392 1:202357712-202357734 CCCCCAAGGCTGCCTTCCAGTGG - Intronic
922739033 1:228005492-228005514 CCCCTAGGGCCGGTGTCCACAGG + Intergenic
1062937326 10:1398262-1398284 TCCCGAGTGCAGGCTTCCTGGGG + Intronic
1067659960 10:48227444-48227466 CCCAGAGTGCCAGCTCCCAGGGG + Intronic
1067686855 10:48470901-48470923 CCCCCAGGCCAGGCTGCCAGTGG - Intronic
1071522043 10:86337456-86337478 CCCCGAGTGCTGGCTTTCTGTGG - Intronic
1077170471 11:1163787-1163809 CCCCCAGGGCCGGGTCCCTGGGG - Intronic
1077532081 11:3102063-3102085 CCCCGAGGGCCGGCTTCCAGGGG - Intronic
1081977165 11:47242975-47242997 TCCCGAGGGCCCCCCTCCAGAGG + Intronic
1083146913 11:60766867-60766889 CTCCCAGGGCTGGATTCCAGCGG + Intronic
1083747796 11:64745065-64745087 CCCCGAGGGCGGGCGACCGGAGG + Intronic
1090830233 11:130416111-130416133 CCCCGTGGGCCTCCTTCCACTGG - Intronic
1090922495 11:131218737-131218759 CCCTGAGGGCCTAGTTCCAGAGG + Intergenic
1101434416 12:104652790-104652812 CCCCTTGGGCCAGCTTCCACAGG - Intronic
1101639545 12:106577998-106578020 CCTGGAGGCCTGGCTTCCAGTGG + Intronic
1103348234 12:120265358-120265380 CCCCGAGGTCGGGGGTCCAGAGG + Intronic
1104919443 12:132283011-132283033 CCCCGAGGTTCGTTTTCCAGAGG - Intronic
1105780910 13:23704709-23704731 CCACCAGGGCCGGCAGCCAGAGG - Intergenic
1105805004 13:23947475-23947497 CCCCTGGGGCCGGCTCCCAATGG - Intergenic
1113765199 13:112876827-112876849 ACCCGGGGGCTGGCTCCCAGCGG + Intronic
1121224188 14:92309366-92309388 CCGAGGGGGCGGGCTTCCAGGGG - Intergenic
1122552714 14:102558706-102558728 CCCTGATGGCCTGTTTCCAGAGG - Intergenic
1122711624 14:103662832-103662854 CCTCCAGGGCCTGCTTGCAGAGG - Exonic
1122934634 14:104950251-104950273 CCCGGAGGGCCCCCTTCCCGAGG - Exonic
1123040767 14:105489368-105489390 CCCAGTGGCCCGGCGTCCAGTGG + Intronic
1129891638 15:79075507-79075529 CCCCCAGCCCCAGCTTCCAGAGG - Intronic
1137288890 16:47038131-47038153 CCGCGAGGCCCGACTCCCAGCGG + Intergenic
1139657537 16:68397978-68398000 CCCCAAAGGCAGCCTTCCAGAGG + Intronic
1143181702 17:4987648-4987670 CCCCCAGCGCCGGCTGACAGCGG + Intronic
1144489955 17:15700058-15700080 CCCCCAGGGACAGCTTCAAGCGG + Exonic
1144654887 17:17029134-17029156 TCCCTAGGGCAGGCGTCCAGAGG - Intergenic
1144911006 17:18681901-18681923 CCCCCAGGGACAGCTTCAAGCGG - Intronic
1146519433 17:33514905-33514927 GACCGAGGTCCTGCTTCCAGGGG - Intronic
1148447254 17:47745121-47745143 CCTCCAGGGCCGGGTTCCATGGG - Exonic
1151816416 17:76473585-76473607 CCCCGAGCTGCGGCTTCCTGTGG - Intronic
1152586395 17:81191365-81191387 CCCCGCGGGCCGGCTCCGGGTGG - Intronic
1152931759 17:83113597-83113619 GCCGGAGGGCCGGTGTCCAGGGG + Intergenic
1155910313 18:31498109-31498131 CCCCGAGGGCTGTCTTCCCGTGG - Exonic
1157419335 18:47531973-47531995 CCAGCAGGGCCGCCTTCCAGGGG - Intergenic
1157911006 18:51617288-51617310 CACCGAGGGCCTACATCCAGTGG + Intergenic
1160021506 18:75185257-75185279 CCCTGAGGGCTGGTTTCCAGGGG + Intergenic
1160430056 18:78804776-78804798 CACCAAGGGCCGGCTCTCAGGGG - Intergenic
1161571550 19:5033359-5033381 CACTGAGGGACGCCTTCCAGGGG + Intronic
1162155816 19:8677427-8677449 CCCTGAAGCCCGGCATCCAGAGG - Intergenic
1162958880 19:14114581-14114603 CCCTGTGGGCCAGCTCCCAGGGG + Intronic
1163110975 19:15160917-15160939 CCCCAAAGGCCCGCTTCCTGCGG - Exonic
1163172314 19:15540748-15540770 TCCCGAGGGCTGGCCTCCCGAGG + Intronic
1164595899 19:29530439-29530461 CCCCCAGGGCCTTCTTCCCGCGG + Intronic
1166072779 19:40396638-40396660 GCCAGAGGTGCGGCTTCCAGAGG - Exonic
1166072790 19:40396716-40396738 GCCGGAGGTGCGGCTTCCAGAGG - Exonic
1166072802 19:40396794-40396816 GCCGGAGGTGCGGCTTCCAGAGG - Exonic
1166072815 19:40396872-40396894 GCCGGAGGTGCGGCTTCCAGAGG - Exonic
1167517391 19:49930988-49931010 CCTGGAGGGCGGGCTTCCAGTGG + Exonic
925342864 2:3148968-3148990 CCTCCAGGGCTGGCTGCCAGGGG - Intergenic
928200961 2:29247259-29247281 CCCAGAGGCCCTGCTGCCAGTGG - Intronic
929133560 2:38602374-38602396 CACCGAGGCCCTGCTTCCCGGGG + Intronic
937253816 2:120540966-120540988 CCCCCAGGGCCTGGTCCCAGAGG - Intergenic
945235383 2:207627246-207627268 CCCCGGGAGCCTGCTTCCCGCGG + Intergenic
945268081 2:207910988-207911010 AACTGAGGGCAGGCTTCCAGGGG + Intronic
946409502 2:219509124-219509146 CCCCTAGGCCAGGCTGCCAGGGG + Intergenic
948460410 2:238127539-238127561 CCCCCAGGGCCGGATCCCCGAGG + Intronic
1173951323 20:46995674-46995696 CCCCAGGGGCCGGCTTCTAAGGG - Intronic
1175215905 20:57391607-57391629 CCCCGAGCGCGGGCTTCCCGCGG + Exonic
1175739853 20:61412917-61412939 CCCTGAGGGGCTGTTTCCAGAGG + Intronic
1176121078 20:63454868-63454890 CCCTGAGGGCCAGCTGCCAGAGG + Intronic
1176214826 20:63943059-63943081 CCCCAAGGGCAGGCATGCAGGGG - Intronic
1179797280 21:43792548-43792570 CACAGAGAGTCGGCTTCCAGGGG - Intronic
1184894257 22:47397883-47397905 CCCCGAGGCCCACCGTCCAGTGG - Intergenic
1185131731 22:49043293-49043315 GCCGGAGGGCTGGATTCCAGAGG + Intergenic
1185208573 22:49554062-49554084 CCCAGAAGGCCGGCGTCCATGGG - Intronic
953883057 3:46701405-46701427 CACCGAGCGCCGGCTGGCAGGGG + Exonic
954467760 3:50666568-50666590 TCCCGAGGGCAGTCTTCCATGGG + Intergenic
956793665 3:72699786-72699808 GCCCCAGGGGCTGCTTCCAGAGG - Intergenic
957738106 3:84227719-84227741 CCCTGATGGCTGGCTCCCAGGGG - Intergenic
960855096 3:122094593-122094615 GCCACAGGGCCGGCTTCCAAAGG + Intronic
961442659 3:126962056-126962078 GCCAGAGAGCCAGCTTCCAGGGG + Intergenic
962430177 3:135311859-135311881 CCCCGAGGGCCTGCTGCCTATGG + Intergenic
966891517 3:184410698-184410720 CCCTGAGGACTGGCTTCCAGTGG - Intronic
968952909 4:3703747-3703769 CCCCGCGGCCCGTCTTCCCGTGG - Intergenic
969476870 4:7426950-7426972 CCCTGAGGACAGGCTTCCTGGGG + Intronic
969622508 4:8285801-8285823 CCCCGAGGGCAGGGGTGCAGAGG - Intronic
977932196 4:102761086-102761108 CCGCGACGCCCGGCTTTCAGCGG - Intergenic
979547036 4:121951082-121951104 CCCCGGGGTCCGTCTTCCAAGGG + Intronic
985783898 5:1884199-1884221 CCCCCTGGGCCGGCCTCCCGTGG + Intronic
994560722 5:101367458-101367480 CCCCGAGGCCCAGTTTCCAGAGG + Intergenic
997822083 5:137075367-137075389 CCCCGAGAGCCGCCCTCTAGCGG - Intronic
999247366 5:150162284-150162306 CCTGGAGGGAGGGCTTCCAGGGG + Intergenic
1002478884 5:179486299-179486321 CCCCAAGGGCCGGGTGCCAATGG + Intergenic
1002591219 5:180292438-180292460 GCCCGAGGCCCGGCTCCCCGCGG - Intergenic
1003121230 6:3320368-3320390 CCCCAAGGGGCGGCTTCTTGGGG - Intronic
1003950520 6:11111496-11111518 CCCCGAAGGATGGCTTGCAGGGG - Intronic
1013196406 6:107848454-107848476 CCCCGGAGTCCGGATTCCAGCGG - Intergenic
1018170448 6:161139677-161139699 TCCCGAGGCCCTGCTTCCAAGGG + Intronic
1019428188 7:987115-987137 CCCCGAGGGCCTGTTTGCTGAGG + Exonic
1022050910 7:26670459-26670481 CCCCGAGAGAAGGCTTCCTGAGG - Intronic
1022975625 7:35553395-35553417 CCACGAGGGCCGGATTCTGGTGG - Intergenic
1035422558 7:158741670-158741692 CCCTGAGGGCCGGCCTCAGGGGG + Exonic
1035684109 8:1510348-1510370 CCCAGATGTCAGGCTTCCAGAGG + Intronic
1037879327 8:22565451-22565473 AGCCGAGGTCCGGCCTCCAGCGG + Intronic
1039921398 8:41896603-41896625 CCCCGAGGGCCGGCTGCTGCGGG + Exonic
1047758146 8:127934397-127934419 CCCAGAGGGAAGGCTTCAAGGGG - Intergenic
1049611089 8:143555653-143555675 CCCAGGGCGCTGGCTTCCAGGGG + Intronic
1061010135 9:127949876-127949898 CCCCGGGGGCAGGTTTCCAGTGG - Intronic
1061238598 9:129356454-129356476 CCTCCAGGTCCAGCTTCCAGAGG + Intergenic
1062162743 9:135088771-135088793 GCCCAAGGGCAGGCTCCCAGGGG - Intronic
1062539307 9:137034574-137034596 CCCCGGGGGCCCCCTGCCAGAGG - Intronic
1185623129 X:1465497-1465519 CCACCAGGCCCGGCCTCCAGAGG - Exonic
1186262264 X:7791946-7791968 CCCAGATGGCCTGCCTCCAGTGG - Intergenic
1198233686 X:134716624-134716646 CCCAGAGGGCCTTCTTCCAGAGG + Intronic
1200787778 Y:7274553-7274575 CCCCGGGTGCCCGCTTCCTGGGG + Intergenic