ID: 1077533579

View in Genome Browser
Species Human (GRCh38)
Location 11:3108373-3108395
Sequence AGGTTTCTGCAGGTGGAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 264}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077533564_1077533579 21 Left 1077533564 11:3108329-3108351 CCCAGAACACTCGGAACCAGCCT 0: 1
1: 0
2: 0
3: 9
4: 94
Right 1077533579 11:3108373-3108395 AGGTTTCTGCAGGTGGAGTTAGG 0: 1
1: 0
2: 4
3: 21
4: 264
1077533569_1077533579 -2 Left 1077533569 11:3108352-3108374 CCCACCCTGATGGCCACCCACAG 0: 1
1: 2
2: 2
3: 21
4: 275
Right 1077533579 11:3108373-3108395 AGGTTTCTGCAGGTGGAGTTAGG 0: 1
1: 0
2: 4
3: 21
4: 264
1077533573_1077533579 -7 Left 1077533573 11:3108357-3108379 CCTGATGGCCACCCACAGGTTTC 0: 1
1: 0
2: 2
3: 13
4: 118
Right 1077533579 11:3108373-3108395 AGGTTTCTGCAGGTGGAGTTAGG 0: 1
1: 0
2: 4
3: 21
4: 264
1077533572_1077533579 -6 Left 1077533572 11:3108356-3108378 CCCTGATGGCCACCCACAGGTTT 0: 1
1: 0
2: 0
3: 19
4: 145
Right 1077533579 11:3108373-3108395 AGGTTTCTGCAGGTGGAGTTAGG 0: 1
1: 0
2: 4
3: 21
4: 264
1077533565_1077533579 20 Left 1077533565 11:3108330-3108352 CCAGAACACTCGGAACCAGCCTC 0: 1
1: 0
2: 1
3: 4
4: 103
Right 1077533579 11:3108373-3108395 AGGTTTCTGCAGGTGGAGTTAGG 0: 1
1: 0
2: 4
3: 21
4: 264
1077533570_1077533579 -3 Left 1077533570 11:3108353-3108375 CCACCCTGATGGCCACCCACAGG 0: 1
1: 0
2: 4
3: 25
4: 249
Right 1077533579 11:3108373-3108395 AGGTTTCTGCAGGTGGAGTTAGG 0: 1
1: 0
2: 4
3: 21
4: 264
1077533567_1077533579 5 Left 1077533567 11:3108345-3108367 CCAGCCTCCCACCCTGATGGCCA 0: 1
1: 0
2: 5
3: 44
4: 396
Right 1077533579 11:3108373-3108395 AGGTTTCTGCAGGTGGAGTTAGG 0: 1
1: 0
2: 4
3: 21
4: 264
1077533568_1077533579 1 Left 1077533568 11:3108349-3108371 CCTCCCACCCTGATGGCCACCCA 0: 1
1: 1
2: 7
3: 56
4: 414
Right 1077533579 11:3108373-3108395 AGGTTTCTGCAGGTGGAGTTAGG 0: 1
1: 0
2: 4
3: 21
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077533579 Original CRISPR AGGTTTCTGCAGGTGGAGTT AGG Intronic
900294091 1:1939974-1939996 AGCCTGCTGCAGGTGGAGTGGGG + Intronic
900819730 1:4877311-4877333 AGCCTTCTGCAGGTGGGGTGTGG + Intergenic
901173398 1:7280439-7280461 AGGTTTCTGCAGAAGCAGCTTGG + Intronic
901296144 1:8162197-8162219 AGGGATGTGCAGGTGGAGCTTGG - Intergenic
902077707 1:13800966-13800988 AGGCTGCTGGTGGTGGAGTTAGG + Intronic
904357212 1:29948179-29948201 AGATTCCTGCAGGTGGGATTTGG + Intergenic
905583552 1:39100285-39100307 AGATTTCAGTAGGTGGAGTTGGG + Intronic
905748179 1:40437236-40437258 AGGATTCTGCAAGGGAAGTTGGG + Intergenic
907185686 1:52607452-52607474 AGGCTTCTGCAGCTGGAGAAGGG - Intronic
908625783 1:66040208-66040230 AGGTTTGTGCATTAGGAGTTGGG - Intronic
909974210 1:82026344-82026366 AGGTATCTGCAGGAACAGTTGGG - Intergenic
913609144 1:120493473-120493495 TGGGTTCTGCAGGTGGAGGAAGG - Intergenic
913986301 1:143569191-143569213 TGGGTTCTGCAGGTGGAGAAAGG + Intergenic
914204685 1:145516976-145516998 TGGGTTCTGCAGGTGGAGGAAGG + Intergenic
914370875 1:147023250-147023272 TGGGTTCTGCAGGTGGAGGAAGG - Intergenic
914483808 1:148090163-148090185 TGGGTTCTGCAGGTGGAGGAAGG + Intergenic
914582048 1:149028366-149028388 TGGGTTCTGCAGGTGGAGGAAGG + Intronic
915314176 1:155018600-155018622 AGGGTTCTGAAGCTGGAGTGGGG + Exonic
916480665 1:165211729-165211751 GGGTTTCAGCAGGTGGAGGTGGG - Intronic
916814422 1:168337699-168337721 AGTTTGCTGCAGGTGGAGGGGGG - Intergenic
919815629 1:201436838-201436860 AGGTGGCTGCACCTGGAGTTGGG - Intergenic
920675820 1:208038152-208038174 CTGTTTCTGAGGGTGGAGTTTGG + Intronic
921355125 1:214278857-214278879 AGGATTTTGCAAGTGGAGGTGGG - Intergenic
921902128 1:220462635-220462657 AGGTTTCAACATGTGAAGTTTGG - Intergenic
922074518 1:222230147-222230169 AGGATGCTGCAGCTGGGGTTGGG + Intergenic
1063170975 10:3509763-3509785 TGTTTTCTGCCTGTGGAGTTTGG - Intergenic
1063842655 10:10089511-10089533 AGGCTTCTGCTGGTAGATTTCGG + Intergenic
1064712642 10:18141687-18141709 AGGCTTCAGCAGGTACAGTTTGG + Intronic
1067337817 10:45378967-45378989 AGGTGCCTGCAGGTGTAGGTAGG + Intronic
1067716343 10:48693618-48693640 AGGTGTCTGCCAGTGAAGTTCGG - Intronic
1068059615 10:52050952-52050974 TGATTTCTGCAGCTGGGGTTAGG + Intronic
1068268781 10:54691517-54691539 AGCTTTCTGCAGCAGGAGCTAGG + Intronic
1068503422 10:57868786-57868808 AGTTTTCTGGGGCTGGAGTTTGG + Intergenic
1069799669 10:71074260-71074282 GGGTCTCTGCAGGTGGGGTTGGG + Intergenic
1070433331 10:76363095-76363117 AGGTTTCAGCCTGTGGAGTAAGG + Intronic
1070648378 10:78217573-78217595 AGGTGCCAGCAGGTGGAATTGGG - Intergenic
1070835359 10:79444435-79444457 AGGTTTCTGCAGAAGGCGCTGGG + Intronic
1071790817 10:88952277-88952299 AGGTGTCTGGAAGTGGATTTTGG - Intronic
1072532550 10:96332804-96332826 AGGTTGCTGCTGCTGGTGTTGGG - Intronic
1073367711 10:102957337-102957359 AGATTTCAGCTGGTGGAGATAGG + Intronic
1074870644 10:117573318-117573340 ATGTCACTGGAGGTGGAGTTGGG + Intergenic
1074990333 10:118700339-118700361 ATACTTCTCCAGGTGGAGTTAGG - Intronic
1075928720 10:126274706-126274728 AGGTTGCTGCCGGTGGCCTTAGG - Intronic
1077533579 11:3108373-3108395 AGGTTTCTGCAGGTGGAGTTAGG + Intronic
1078057663 11:8020215-8020237 AGAATTCTGCAGATGGACTTGGG - Intronic
1078501379 11:11881885-11881907 AGGTTTCAGCATGTGAATTTTGG + Intronic
1078587546 11:12606361-12606383 TGGTTTCTGCCTCTGGAGTTTGG - Intergenic
1079217858 11:18530515-18530537 AGGTTAATCCAGATGGAGTTAGG - Exonic
1081334922 11:41853310-41853332 AGGCTTATGCAGTTGAAGTTTGG - Intergenic
1083147180 11:60768276-60768298 GGGTTTCTGCGGGAGGGGTTTGG - Intronic
1083262203 11:61529245-61529267 AGGTTTCTACAGGGGAAGTTGGG - Intronic
1084080444 11:66820211-66820233 AGGATTCTGGAGCTGGAGTCAGG - Intronic
1087437258 11:98136889-98136911 GGTTTTCTGCAGGTGATGTTAGG + Intergenic
1088572000 11:111231408-111231430 AGGTTTCTAGAGGTGGAGTGAGG - Intergenic
1090299851 11:125626042-125626064 AGGTTTCTAAAGAAGGAGTTCGG + Intronic
1090320812 11:125841976-125841998 AGGTTTCTGCATATGAATTTTGG - Intergenic
1091393700 12:141107-141129 GGGTTTCTGGAGGTGGGGGTGGG - Exonic
1091697569 12:2638329-2638351 AGGATTCTCCATGTGGAGATCGG + Intronic
1092901973 12:13068338-13068360 AGGTTGCTGCAGTTGGAATCTGG - Exonic
1096010956 12:48213923-48213945 GGGTTTCTGCAGAAGCAGTTGGG + Intergenic
1096400501 12:51302184-51302206 AGGTTTTTGCAGGGAGAATTTGG - Intronic
1096588787 12:52643716-52643738 AGCTTTCTGTATGTGGCGTTTGG - Intergenic
1100628570 12:96362858-96362880 ATCATTCTGCTGGTGGAGTTAGG + Intronic
1102708056 12:114899670-114899692 AGGTCATTCCAGGTGGAGTTGGG + Intergenic
1104139230 12:125971697-125971719 TGGTCTCTCCAGGTGGAGTACGG - Intergenic
1104456155 12:128914018-128914040 ACGATTATGCAGGTGGATTTTGG + Intronic
1105449750 13:20488837-20488859 TGGTCCCTGCAGGTGGAGCTGGG - Intronic
1105541894 13:21322959-21322981 AGCTTTGTGCAGATGGACTTGGG + Intergenic
1105577606 13:21668743-21668765 AGCTTCTTGCAGCTGGAGTTAGG + Intergenic
1106577388 13:30988096-30988118 AGGTATCTGCAGGGAGAGATGGG - Intergenic
1106967388 13:35087928-35087950 AGTTTTCTATAGCTGGAGTTTGG + Intronic
1108474345 13:50798893-50798915 CCTTTTCTGCAGGTGGAGTGAGG - Intronic
1111128995 13:83949956-83949978 TGGTATCTGGAGCTGGAGTTGGG + Intergenic
1111804285 13:93020307-93020329 AAGTTTCTGCAGGAGAAGCTGGG + Intergenic
1112243032 13:97701393-97701415 AGGTTTCTTCAGATTGAGTAAGG - Intergenic
1112346723 13:98596313-98596335 AGGTGTCTGCAGGCAGAGTTAGG - Intergenic
1112591768 13:100769891-100769913 AGGTTTCTGCTTGTGGAATTTGG - Intergenic
1117201275 14:53392513-53392535 AATTTTCTGCAGGTGGATATTGG + Intergenic
1118855261 14:69616188-69616210 AGGATTCTGCAGTTGGAGATTGG + Intronic
1119343266 14:73899535-73899557 AGGTTTCAGCATCTGGAGATTGG - Intronic
1119576388 14:75726746-75726768 AGGGTTATGGAGGTGGATTTGGG + Intronic
1120462731 14:84817884-84817906 AGGTTTCAGCATATGGATTTTGG - Intergenic
1120779712 14:88476085-88476107 AGGTTGCTGGAGGTGGAGATGGG + Intronic
1121109255 14:91301377-91301399 AGGTTTTGGCAGGTGGAGTCTGG - Intronic
1121241129 14:92430776-92430798 ATGTATCTGCAGGTGGAGCTGGG - Intronic
1121372321 14:93371002-93371024 AGCTTCCTGGATGTGGAGTTTGG - Intronic
1122834186 14:104423138-104423160 AGGTTTCTGCAGGTCCAGCCGGG - Intergenic
1125316757 15:38440726-38440748 AGGTCTCTGCAGGTGGTGAGGGG + Intergenic
1129174990 15:73833411-73833433 GAGTTTCTACAGGTGGAGATGGG - Intergenic
1131350204 15:91692722-91692744 AGATTTCTGCAGGGAGAGCTAGG - Intergenic
1132014877 15:98306667-98306689 AAGTTTATGCAGATGCAGTTGGG - Intergenic
1133143636 16:3767263-3767285 AGGTTTCTGCAGGTGCAGTGAGG - Intronic
1134011565 16:10857386-10857408 ATATTGCTGCACGTGGAGTTGGG - Intergenic
1134480508 16:14614897-14614919 AGGTGTCTGAAGGTGGTGTGGGG + Intronic
1134601614 16:15538113-15538135 AGGCTTCCCCACGTGGAGTTTGG + Intronic
1137018452 16:35398557-35398579 AGGTCTTTGGGGGTGGAGTTGGG + Intergenic
1137795434 16:51213750-51213772 AGGTTTGGGCAGCTGGAGTGTGG - Intergenic
1138177310 16:54912476-54912498 AGGTTTCTGCAAGTGGTTGTTGG - Intergenic
1138341555 16:56292867-56292889 TGGTTACAGCAGGTGGAGTTGGG - Intronic
1138420671 16:56897187-56897209 AGATGTCGGCAGGTGGAATTGGG + Intronic
1140919044 16:79519971-79519993 CTGTCTGTGCAGGTGGAGTTGGG + Intergenic
1141243772 16:82287650-82287672 AGGCTTCTGCAGCTGCAGGTGGG - Intergenic
1142663431 17:1447324-1447346 TGGATTCTGAACGTGGAGTTAGG + Intronic
1144795003 17:17885194-17885216 AAGCTTCTACTGGTGGAGTTGGG + Intronic
1145013644 17:19383423-19383445 AGGATTGTTCAGGGGGAGTTGGG - Exonic
1145818385 17:27811953-27811975 AGGTTGCTGCAGGAGGAGCAGGG + Intronic
1147724043 17:42555432-42555454 GGGCATCTGCAGGAGGAGTTAGG + Intergenic
1148053165 17:44779205-44779227 ATGTTTCTGCAGGGGGAGGATGG - Exonic
1148335341 17:46837302-46837324 TTGTCACTGCAGGTGGAGTTTGG - Intronic
1151452318 17:74205656-74205678 AGTTACCTGCAGGTAGAGTTGGG - Intronic
1152319133 17:79598103-79598125 AGATTTCTGCAGCAGGATTTTGG - Intergenic
1152499414 17:80697988-80698010 AGGTTTCTGCTGGCAGAGTTTGG + Intronic
1152779107 17:82218582-82218604 GGGTGTGTGCAGGTGGAGCTTGG + Intergenic
1157167085 18:45367647-45367669 AGGTTACTGAAATTGGAGTTGGG - Intronic
1161874471 19:6897187-6897209 AGGTTTTTGCAGGATGAGTTAGG - Exonic
1162131178 19:8527004-8527026 AGGTGGCTGAAGGTGGATTTAGG + Intronic
1165443988 19:35846535-35846557 AGTTTCCTGCAGGTGGTGTTGGG - Intronic
1166366085 19:42279245-42279267 TGGCTTCTGCTGGTGGAGATAGG - Intronic
1166644255 19:44519500-44519522 AGGTTTCTGCAGGGAGAGAAAGG - Intronic
1166951559 19:46431837-46431859 AGCTTTCTGCAGGTGGCTGTTGG + Intergenic
1167710430 19:51107181-51107203 AGGTTTATTCAGGAGGAGATGGG + Intronic
1168596541 19:57682271-57682293 AGGCTTCTGCTGGGGGAGGTAGG - Intronic
926349899 2:11984929-11984951 AGGTATCTGCAGCTGGAGTCTGG + Intergenic
926703253 2:15818314-15818336 GGGTTTCTGCACTTGGAGGTTGG - Intergenic
926765231 2:16318230-16318252 AGGCCTCTGCAGCTGGAGTGGGG + Intergenic
926848765 2:17171629-17171651 AGGGCTCTGCTGGTGGAGTGGGG - Intergenic
929742093 2:44613344-44613366 AGGTTTCTGGAGGAGGATCTAGG - Intronic
929754454 2:44752526-44752548 AGGATTCTGTGGGTGGGGTTAGG - Intronic
931061335 2:58532850-58532872 TGGTCTCTGCAGCTGGAGTCTGG + Intergenic
931178016 2:59872853-59872875 AGCTTTGTGGAGGTAGAGTTTGG + Intergenic
933819931 2:86101730-86101752 AGGGTTCTGCAGATGGAGAGTGG - Intronic
934985993 2:98884901-98884923 AGGTGCCTGCAGGTGGGGATAGG - Intronic
935278044 2:101492636-101492658 AGCTCTCAGCAGTTGGAGTTGGG - Intergenic
935436804 2:103044458-103044480 AGGTTTATGGAGATGGAATTAGG - Intergenic
935717667 2:105953145-105953167 AGGTTTCAGCATATGGATTTAGG - Intergenic
935918645 2:107986261-107986283 AGTTTTCTGGAGGAGGAGATGGG + Intergenic
935966435 2:108481304-108481326 AGAATTCTTCAGGTGGAGTTAGG + Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
938777180 2:134552272-134552294 AAGTTGTTGCAGGTGGAGTCTGG - Intronic
939031958 2:137087403-137087425 AGCTTTCTGCAGGAGGCTTTAGG - Intronic
941026744 2:160464133-160464155 ATGTGTCTGCAAGTGGAGTGGGG - Intronic
942149425 2:173060134-173060156 AGTTTTCTGAATGTGGACTTTGG + Intergenic
944448045 2:199811627-199811649 AAGTTCCTGCATGTGGACTTGGG + Intronic
946093243 2:217249267-217249289 AGGTCACTGAATGTGGAGTTGGG - Intergenic
947736348 2:232457413-232457435 CAGGTTCTGGAGGTGGAGTTGGG + Intronic
947928330 2:233940922-233940944 TGGTTTTTGCAGGTGTAGTCAGG + Intronic
948367539 2:237467196-237467218 AGTTGTCTGCAGCTGGAGGTGGG - Intergenic
949048568 2:241884358-241884380 GGGTGTCTGTAGATGGAGTTGGG + Intergenic
1168905469 20:1399906-1399928 AGGTTTCTGTAGCTGTAGCTGGG - Intergenic
1171184138 20:23112743-23112765 TGGTTCCTGCAGGTGGAGTTTGG + Intergenic
1173871289 20:46343729-46343751 AGCCTTCTGCAGGGGGAGGTGGG - Intergenic
1174769304 20:53283487-53283509 AGCTTTCAGCTGGTGGAGCTTGG + Intronic
1175084723 20:56448624-56448646 GGGTTTCTGTAGAGGGAGTTGGG - Intronic
1175213272 20:57375159-57375181 TGGTTTGGGCAGGGGGAGTTAGG + Intronic
1176089220 20:63311613-63311635 ATGTCTCTGCAGGTGCAGGTCGG + Exonic
1176513294 21:7764617-7764639 AGGTTTCTTCTGGTGGGGGTGGG - Intronic
1177009941 21:15719817-15719839 AGGTTTCTGCATTTGGAGAATGG + Intergenic
1177198863 21:17931080-17931102 AGGTTGCTGCAGTTGGAGAGGGG - Intronic
1178484280 21:33007467-33007489 AAGTTGCTGAATGTGGAGTTGGG + Intergenic
1178647407 21:34395141-34395163 AGGTTTCTTCTGGTGGGGGTGGG - Intronic
1179000800 21:37456291-37456313 AGGAGGCTGCAGGTGGAGGTGGG + Intronic
1181393257 22:22599344-22599366 AGTTTTCTGCCTGTGGTGTTGGG + Intergenic
1184291639 22:43500636-43500658 GGGTTTCTGGAGGTGGCGGTGGG - Intronic
950155983 3:10722053-10722075 ATGTTTATGCAGGTGAAGCTAGG + Intergenic
950336461 3:12197856-12197878 AGGCTTCTGAAACTGGAGTTTGG + Intergenic
952065818 3:29568776-29568798 AGAATTGTCCAGGTGGAGTTTGG + Intronic
952899049 3:38097635-38097657 AAGGTGCTGCAGGTGGAGCTGGG + Exonic
953690186 3:45111146-45111168 AGGTGACTGAATGTGGAGTTGGG + Intronic
955004965 3:54959874-54959896 AGGTTTCTTCAGATGAAGTCTGG + Intronic
956141294 3:66149239-66149261 AGCTTTCAGGAGCTGGAGTTAGG + Intronic
959060524 3:101612360-101612382 AGGATTCTGGAGGTGGAGGTGGG + Intergenic
961734939 3:128995416-128995438 AGGCTGCTGCAGGTGGGGTGTGG - Intronic
962756391 3:138468250-138468272 AGGTGTGTGCAGGTGGAGGAAGG + Intronic
962962764 3:140326299-140326321 AGACTTCTGGATGTGGAGTTGGG + Intronic
963019493 3:140859179-140859201 AGGTTTCAACAGGTGAATTTTGG - Intergenic
963317294 3:143773270-143773292 AGGTCTCTGGACATGGAGTTGGG + Intronic
964612884 3:158632487-158632509 AGGTTCCTGCATGTGTAGCTAGG + Intergenic
964628466 3:158782392-158782414 TGGTTTCTGGAGTTGGAGATTGG - Intronic
966407485 3:179612884-179612906 ACATTTCTGCAGGTGTAGTCAGG + Intronic
969230885 4:5829874-5829896 ATGTTTCTAGATGTGGAGTTGGG + Intronic
970155482 4:13137444-13137466 AGGTTGAAGCAGATGGAGTTAGG + Intergenic
970376838 4:15467346-15467368 AGTTTTGTGCAGGTAGAGGTAGG + Intergenic
971884428 4:32424387-32424409 AGGTATCCTCAGTTGGAGTTTGG + Intergenic
972711220 4:41597022-41597044 AGATTGTTGCAGGTGGGGTTGGG - Intronic
977181045 4:93874604-93874626 AGGTTTCTGGTGGTGGGGGTGGG - Intergenic
978072930 4:104493484-104493506 AAGTTTTTGCACTTGGAGTTTGG - Intronic
978076083 4:104531553-104531575 AAGTTTCAGCAGGAAGAGTTTGG + Intergenic
979230033 4:118338244-118338266 AAGTATATGCAAGTGGAGTTTGG - Exonic
980482121 4:133400561-133400583 AGGTTTCTATAGGTGAATTTTGG + Intergenic
980662878 4:135888094-135888116 AGATTTCTGCATGTGGACGTAGG - Intergenic
982014597 4:151140922-151140944 TTGTTTCTGCAGGTGCATTTTGG - Intronic
982079797 4:151778240-151778262 AGGTTTCAACACGTGGATTTGGG + Intergenic
985902158 5:2805107-2805129 GGGTTTCTACATGTGGATTTTGG - Intergenic
986247068 5:6018621-6018643 AGAAGTCAGCAGGTGGAGTTTGG + Intergenic
986430859 5:7679666-7679688 AGGTTTCTGCATGGGCAGCTGGG + Intronic
986998068 5:13629824-13629846 AGGTTTCAGCATTTGGATTTGGG + Intergenic
989635733 5:43530950-43530972 AGGTTTGTGCAGGTGAGGTTGGG - Intronic
991453520 5:66778230-66778252 TGGTCTCTGCAACTGGAGTTTGG + Intronic
992883468 5:81133455-81133477 GGGAATCTGCAGGTGCAGTTTGG + Intronic
995440354 5:112184953-112184975 AAATTTCTGCAGGTTGAGTGTGG - Intronic
997808818 5:136946986-136947008 AGGTTTCTGCTGCTTTAGTTTGG + Intergenic
997933560 5:138091347-138091369 AGCTTTCTACAGGGAGAGTTTGG + Exonic
998003989 5:138645164-138645186 AGGTTTCTGGAGCTGTAGTCAGG - Intronic
998156140 5:139788224-139788246 AGGTTCCCGCAGGGGGAGCTCGG - Intergenic
998161576 5:139815546-139815568 AGGTTTCTGAAGTTGGTGTGGGG - Intronic
1001781855 5:174375663-174375685 TTATTTCTGCAGGAGGAGTTGGG + Intergenic
1001920247 5:175594194-175594216 AGGTATCTGGAGGTGGGGTGGGG - Intergenic
1001988289 5:176094571-176094593 AGGAGCCTGCAGGTGGGGTTGGG + Intronic
1002228579 5:177743563-177743585 AGGAGCCTGCAGGTGGGGTTGGG - Intronic
1003210739 6:4063532-4063554 AGGTTTCTACAGGGTAAGTTGGG - Intronic
1005296259 6:24430318-24430340 AAGTCTCTGCTGGTGGAGTCAGG - Intronic
1005335881 6:24795815-24795837 GGGCTGCTGCAGGTGGAGGTAGG + Intergenic
1005662916 6:28018548-28018570 AATTTGCTGCAGCTGGAGTTAGG + Intergenic
1006717732 6:36130878-36130900 AGGTCTCTGGGGGTTGAGTTGGG + Intronic
1007282135 6:40720526-40720548 AGGATGCTGTGGGTGGAGTTGGG - Intergenic
1010131909 6:72504109-72504131 ATGTCTCTGTAGGTGGAGGTAGG - Intergenic
1010232834 6:73550729-73550751 AGGAGTCTGGCGGTGGAGTTAGG + Intergenic
1011501966 6:88000615-88000637 AGGTTCCAGCAGGAGGTGTTAGG - Intergenic
1012185523 6:96210439-96210461 AGCTCTCTGGAGGTGGGGTTTGG - Exonic
1015991128 6:138944563-138944585 AGTTTTCTTGAGGTGGAGGTGGG + Exonic
1016791787 6:148074123-148074145 AGGTCTCTGGGGGTAGAGTTTGG + Intergenic
1017020521 6:150136427-150136449 AGGTTTCTACAGATGAATTTTGG + Intergenic
1018236396 6:161728189-161728211 AGTTCTCAGCAGGTGGAGCTAGG + Intronic
1019841627 7:3451861-3451883 AAGTGTATGCAGGTGGTGTTGGG + Intronic
1021004251 7:15373353-15373375 AGGGTTCTGCAGGCGTAATTGGG - Intronic
1021270478 7:18578358-18578380 AGCTTTCCCCAGGTGGATTTTGG + Intronic
1021685364 7:23180746-23180768 AGGTTTGTGCTGGTGGTTTTAGG - Intergenic
1023361766 7:39424216-39424238 AGGTTTCAACATGTGAAGTTTGG + Intronic
1023522869 7:41066274-41066296 TCTTTTCTGCAGGTGGAGCTTGG - Intergenic
1023802958 7:43850832-43850854 ATGTTCCTGAAAGTGGAGTTGGG - Intergenic
1023833906 7:44057468-44057490 AGGAGTCTGCAGGTGGGGTATGG + Intronic
1024673307 7:51616117-51616139 CAGTCTCTGCAGGTGGATTTGGG + Intergenic
1026509952 7:71019464-71019486 TGGTTTCTGCAGGCAGAGATAGG - Intergenic
1027263151 7:76479241-76479263 AGGTCTCGGGAGGTGGAGCTCGG + Intronic
1027314535 7:76977346-76977368 AGGTCTCGGGAGGTGGAGCTCGG + Intergenic
1030638467 7:111977111-111977133 AGGTACCTGCACGTGGAGATAGG - Exonic
1032464404 7:132134809-132134831 AGGGTTCTGAAGGTGGAGGAGGG - Intronic
1033138521 7:138804393-138804415 TTGATTCTGGAGGTGGAGTTGGG - Exonic
1033862334 7:145643769-145643791 AGGTCTCTGCAGGAGGAGTGAGG + Intergenic
1035017887 7:155782334-155782356 AGGGTGCTGCAGGTGGAGAGTGG - Intergenic
1036597869 8:10230350-10230372 GGGTTTCCTCAGGTGGAGATGGG + Intronic
1037735543 8:21562839-21562861 AGGTTTCTTCTGGGGGAGGTTGG + Intergenic
1037842434 8:22254850-22254872 AGAGTTCTACAGGTGGAGTGTGG + Intergenic
1037890790 8:22622832-22622854 AGCCTTCTGCAGGAGGAGGTAGG - Intronic
1039147362 8:34463924-34463946 ATGTTACTGCAAATGGAGTTTGG - Intergenic
1039677616 8:39686558-39686580 AGGTTTCAACAGGTGAATTTTGG + Intronic
1039834204 8:41243526-41243548 GGGTTTTTGCAGATGTAGTTAGG + Intergenic
1040617010 8:49047228-49047250 AGGCTTCTGTGGGTGGAGATGGG + Intergenic
1041256114 8:55980866-55980888 AGAGTTCTGCAGGTGGATGTTGG - Intronic
1041730119 8:61054235-61054257 AGGCTGCTGCAGGAGGAGATAGG - Intergenic
1042516351 8:69663114-69663136 AGATTTCTCCAGGTTGAGGTGGG - Intergenic
1046738797 8:117806719-117806741 AGGGTGCTGAAGGTGGAGATGGG - Intronic
1048589387 8:135807036-135807058 AGATCTCTGCAAGTAGAGTTTGG + Intergenic
1049252151 8:141595016-141595038 AGGTTTCTGCGTGTGTAGCTTGG + Intergenic
1049522901 8:143103483-143103505 AGTTATCTGCAGGAGGAATTGGG + Intergenic
1050709772 9:8448145-8448167 ATTTTTGTGGAGGTGGAGTTTGG - Intronic
1051448724 9:17171485-17171507 AGGTGTCTGCAGGGGGAGCGAGG + Intronic
1051511704 9:17885910-17885932 AGGTGCCTGCAGCTGGAGATGGG + Intergenic
1051519987 9:17975558-17975580 AGGTTTCATCATGTGGATTTGGG + Intergenic
1052900501 9:33790500-33790522 AGCCATCTGCAGGTAGAGTTAGG - Intronic
1053312502 9:37028386-37028408 AGGGCCCTGCAGGTGGAGTGAGG - Intronic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055114169 9:72589079-72589101 AGACTTCTTTAGGTGGAGTTTGG + Intronic
1055294614 9:74821395-74821417 AGGTGTTTGCAGGGGGAGTGAGG - Intronic
1055746663 9:79454313-79454335 AAATTACTGCAGGTGGAGTGTGG - Intergenic
1057177125 9:93008636-93008658 AGGACTCTTCAGGTGAAGTTGGG + Intronic
1058263046 9:102860454-102860476 AATTTTCTCCAGGTGGAGATAGG + Intergenic
1059456322 9:114402446-114402468 TGGTTTCTCCAGGTTGGGTTGGG - Exonic
1060338382 9:122749906-122749928 AGGTTTCTGCAGCTGAGGGTTGG - Exonic
1060799801 9:126536648-126536670 ATGTTACTGCACGTGGAGTTAGG - Intergenic
1186980014 X:14948672-14948694 TGCTTTCTGCATTTGGAGTTTGG - Intergenic
1188051222 X:25489185-25489207 TGGGTTCTGAAGGTGGATTTTGG + Intergenic
1188933081 X:36139359-36139381 AGGTTTCCCCAGTTGAAGTTTGG + Intronic
1190250711 X:48722954-48722976 AGGTTTCTGCAGGTAGTCTCAGG - Intergenic
1190663756 X:52678973-52678995 AGGATTCTGCAGCAGGTGTTTGG + Intronic
1190675667 X:52779449-52779471 AGGATTCTGCAGCAGGTGTTTGG - Intronic
1190984371 X:55488374-55488396 TGGTTGCTGGAGGTCGAGTTTGG - Exonic
1192532982 X:71905324-71905346 AGGTTTCAACATGTGGATTTTGG - Intergenic
1194484353 X:94469695-94469717 AGGTTTATTCAGGTGTTGTTTGG - Intergenic
1196031900 X:111100797-111100819 AGGTGGCTGGGGGTGGAGTTGGG + Intronic
1197727040 X:129783253-129783275 GGATTTCTCCAGGTGGAGCTCGG - Intronic
1198070915 X:133147746-133147768 AGGTTTCTTCATGTGGATTGCGG + Intergenic
1198700359 X:139391033-139391055 ATGATTCTGCAGGTGAAGATTGG - Intergenic
1200928388 Y:8675040-8675062 AGATTTTTGCAGGTGAAGGTGGG - Intergenic
1202073995 Y:21020385-21020407 AGGTTTCTGCAGGTGTAGCTGGG + Intergenic
1202078695 Y:21062240-21062262 AGGTTTCTGCAGGTGTAGCTGGG + Intergenic