ID: 1077534929

View in Genome Browser
Species Human (GRCh38)
Location 11:3119489-3119511
Sequence AAGGGGGCCCACTTCAGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 176}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077534918_1077534929 4 Left 1077534918 11:3119462-3119484 CCACCTGTACCTGGGCTACAACC 0: 1
1: 0
2: 0
3: 10
4: 190
Right 1077534929 11:3119489-3119511 AAGGGGGCCCACTTCAGGTGGGG 0: 1
1: 0
2: 0
3: 11
4: 176
1077534919_1077534929 1 Left 1077534919 11:3119465-3119487 CCTGTACCTGGGCTACAACCTCA 0: 1
1: 0
2: 1
3: 14
4: 120
Right 1077534929 11:3119489-3119511 AAGGGGGCCCACTTCAGGTGGGG 0: 1
1: 0
2: 0
3: 11
4: 176
1077534921_1077534929 -5 Left 1077534921 11:3119471-3119493 CCTGGGCTACAACCTCAAAAGGG 0: 1
1: 0
2: 1
3: 12
4: 97
Right 1077534929 11:3119489-3119511 AAGGGGGCCCACTTCAGGTGGGG 0: 1
1: 0
2: 0
3: 11
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077534929 Original CRISPR AAGGGGGCCCACTTCAGGTG GGG Intronic
900034262 1:393834-393856 AAGGTAGCCTACTTCAGGTCTGG + Intergenic
900055097 1:623726-623748 AAGGTAGCCTACTTCAGGTCTGG + Intergenic
900612172 1:3548840-3548862 AAAGGAGCCCACTGCAGCTGGGG + Intronic
903454070 1:23474808-23474830 CAGGGGGACCACTTGAGGTCAGG - Intronic
904852822 1:33472339-33472361 AAGGGGGCCCAGTTCTACTGAGG - Intergenic
905016909 1:34783997-34784019 AGGGGAGACCAGTTCAGGTGGGG - Intronic
905314023 1:37069646-37069668 ATGAGGACCCACTTGAGGTGTGG - Intergenic
905316964 1:37088676-37088698 AAGGGGGTTCTCTTCAGCTGAGG + Intergenic
905790274 1:40785774-40785796 ATGTGGGCCCAGTTCAGATGGGG - Intronic
906622131 1:47291029-47291051 AGGGAGGCCGACTTAAGGTGAGG - Intronic
907237378 1:53061859-53061881 AAGGGGGTCCAGTTCCAGTGCGG + Intergenic
907668729 1:56455780-56455802 CAGGGGGATCACTTGAGGTGAGG + Intergenic
910205276 1:84743305-84743327 AAGGGGGCCAACTCCAGCTCTGG + Intergenic
912501804 1:110127437-110127459 GAGGGGGCCCTCTACAGATGTGG + Intergenic
914358847 1:146912702-146912724 CAGGAGGATCACTTCAGGTGAGG + Intergenic
914902115 1:151716484-151716506 AGGGGGGCCCACTCCTGATGTGG + Exonic
915622054 1:157092006-157092028 ATGGGGGTCCACTGCAGGGGGGG + Intergenic
922256618 1:223898031-223898053 AAGGTAGCCTACTTCAGGTCTGG + Intergenic
923337113 1:232979927-232979949 ATGGGGTCCCACTCCAGCTGGGG - Exonic
923438872 1:233996478-233996500 AAGGGTTGCCAATTCAGGTGAGG + Intronic
923644747 1:235807114-235807136 CAGGGTGTCCACCTCAGGTGTGG - Intronic
923861260 1:237894236-237894258 CAGGAAGCCCACTTCAAGTGTGG + Intergenic
924337822 1:243000884-243000906 AAGGTAGCCTACTTCAGGTCTGG + Intergenic
1062948140 10:1476248-1476270 AGGGGGGCCTGCCTCAGGTGGGG + Intronic
1064322510 10:14319025-14319047 GAGGTGGCCCACATCATGTGGGG + Intronic
1066081064 10:31930366-31930388 AAGGGTGCCCAATTCAGGTTTGG - Intergenic
1067279281 10:44859077-44859099 TAGGGGGCCCTTTTCAGGTTTGG - Intergenic
1067686129 10:48466827-48466849 ACGGGGGCCGACTTCGGGCGTGG - Intronic
1067772724 10:49138949-49138971 GAGGGGCCCCACTTTCGGTGTGG - Intergenic
1069837838 10:71320165-71320187 AAGGGGGCCCTAGCCAGGTGTGG + Intronic
1070828487 10:79404735-79404757 ATGAAGGCCCACTTCAGGTTTGG + Intronic
1072171718 10:92869535-92869557 AAGGAGGATCACTTGAGGTGAGG - Intronic
1073006634 10:100330016-100330038 AAGGGGGACCACTGTAGGCGGGG + Exonic
1075906967 10:126089854-126089876 GAGGGAGCCCACTTTAAGTGGGG - Intronic
1077534929 11:3119489-3119511 AAGGGGGCCCACTTCAGGTGGGG + Intronic
1078691966 11:13590822-13590844 CAGGCGGCTCACTTCAGGTCAGG - Intergenic
1081403077 11:42665338-42665360 AAGGAGGCTCTCTTCAGATGAGG - Intergenic
1083304426 11:61755180-61755202 GAGGGGGACCACGTCAGGTGAGG - Intronic
1084520607 11:69660308-69660330 AAGGGGGATGACTTCAGGAGAGG - Intronic
1088692894 11:112342956-112342978 TAGGGGGATCACTTCAGGTCAGG - Intergenic
1089684333 11:120137409-120137431 AAGGCGGCGCCCTCCAGGTGGGG + Exonic
1090951954 11:131481470-131481492 AAGGGGGAGAACTTCAGATGTGG + Intronic
1092838294 12:12513423-12513445 AAGGGTGCCCATTTCAGATCAGG - Intronic
1093234436 12:16589064-16589086 AAGGGGGTCGACGTCAGGTCTGG + Intronic
1097425045 12:59433928-59433950 CAGGTGGCTCACTTCAGGTCAGG + Intergenic
1097986983 12:65794144-65794166 CAGGGGGACCACTTGAGGTCAGG + Intergenic
1101071484 12:101080539-101080561 AAGGGGTACCACTTCAGGCCAGG + Intronic
1102166378 12:110810050-110810072 AAGGTGGCCTTCTGCAGGTGAGG - Intergenic
1103219521 12:119232110-119232132 AAGGGGGGCTTCGTCAGGTGAGG - Intergenic
1104783923 12:131437807-131437829 AAGGATGACCACTGCAGGTGGGG + Intergenic
1105255816 13:18743565-18743587 AGGGAGTCCCACTTCAGATGTGG - Intergenic
1106339359 13:28814383-28814405 GAGGGGGCTCTCTGCAGGTGAGG - Intergenic
1110169864 13:72487737-72487759 AAGGGGACCCAATTCGTGTGAGG - Intergenic
1116652769 14:47614857-47614879 AATAGTACCCACTTCAGGTGGGG + Intronic
1120194492 14:81467408-81467430 ATGGTGGCCCTCTTCAGATGAGG - Intergenic
1120922667 14:89769105-89769127 CAGGGGGACCACTTGAGGTCAGG - Intergenic
1121150266 14:91626687-91626709 TGGGGGGCCCACATCTGGTGAGG - Intronic
1121775172 14:96585634-96585656 CAGGCTGCCCACTTCAGGTGTGG + Intergenic
1124254513 15:28130061-28130083 AAGGGGGCACAGGCCAGGTGTGG - Intronic
1124566192 15:30816534-30816556 AAGGGGGATTACTTCAGGTTGGG + Intergenic
1133828235 16:9298097-9298119 AAGGGACCCCACTTGAGTTGAGG - Intergenic
1135177132 16:20240294-20240316 CAGGGGCACCACTCCAGGTGTGG + Intergenic
1135754348 16:25083882-25083904 CAAGGGGCCCACATCTGGTGAGG - Intergenic
1136498129 16:30656208-30656230 CAGGGGGCCCACATCAGGGCTGG - Exonic
1136499986 16:30665273-30665295 AAGGGGGACTAGTACAGGTGGGG - Intronic
1138231424 16:55339692-55339714 AAGGAGCCCCACCTCAGTTGAGG - Intergenic
1143825919 17:9607116-9607138 CAGGAGGATCACTTCAGGTGAGG + Intronic
1146229377 17:31094967-31094989 AAAGGATCCCACTTCCGGTGGGG + Exonic
1146794302 17:35770302-35770324 CAGGGCGCCCCCTGCAGGTGGGG + Exonic
1147877177 17:43629891-43629913 ATGAAGTCCCACTTCAGGTGAGG + Intergenic
1148798818 17:50210576-50210598 AAGAGGGTCCACGTCAGGAGAGG - Intergenic
1150007767 17:61480155-61480177 CAGGGGGCCCACGTCCGGTGTGG - Exonic
1154435209 18:14337109-14337131 AGGGAGTCCCACTTCAGGTGTGG + Intergenic
1155377906 18:25181495-25181517 AAGCTGCCCCACTACAGGTGAGG + Intronic
1158630257 18:59107427-59107449 AAGGTGGATCACTTGAGGTGAGG + Intergenic
1160556402 18:79728325-79728347 CAGGTGGATCACTTCAGGTGAGG - Intronic
1161934048 19:7360461-7360483 AAGGCGGATCACTTGAGGTGAGG - Intronic
1163585267 19:18160504-18160526 AGGGGGAGCCACATCAGGTGGGG - Exonic
1164585758 19:29474754-29474776 AAGGTGGCTCACTTCAGGCCAGG + Intergenic
1165998258 19:39860962-39860984 AAGGGGATCCACTTTTGGTGGGG + Intergenic
1167503468 19:49859836-49859858 AAGGGGGCCCACCTCCAGGGTGG + Intronic
1168048630 19:53811944-53811966 AAGGGGGCACAAGCCAGGTGCGG + Intronic
1168427788 19:56252887-56252909 CAGGGGGCCCCATTCACGTGGGG + Intronic
929881020 2:45837482-45837504 CAGGTGGACCACTTGAGGTGAGG - Intronic
930029021 2:47047136-47047158 AAGTGGGCCTCCTTCAGGTCAGG + Intronic
931389014 2:61823591-61823613 AAGGCGGCTCACTTGAGGTCAGG - Intergenic
931442431 2:62299742-62299764 CAGGGGGACCACTTGAGGTCAGG - Intergenic
934490816 2:94761124-94761146 AGGGAGTCCCATTTCAGGTGTGG - Intergenic
939030399 2:137067925-137067947 AAGGGAGCCCAGTTCTAGTGGGG - Intronic
939518963 2:143205032-143205054 GAGGGGGCTCACTTTAGGTTGGG + Intronic
943764308 2:191644351-191644373 CAGGGGGACCACTTGAGGTCAGG - Intergenic
948689877 2:239695262-239695284 AAAGGTGGCCACTTGAGGTGTGG + Intergenic
948910756 2:241001383-241001405 AAAGGGGGCCACTCCATGTGTGG - Intronic
948937026 2:241173042-241173064 AAGGTGGATCACTTCAGGTCAGG + Intronic
1169462621 20:5809450-5809472 CTGGGGACCCACTTCAGGGGAGG - Intronic
1172937204 20:38628960-38628982 AAGGGGGCCCAGCTCAGTTCCGG + Exonic
1174021816 20:47536321-47536343 AAGGAGGATCACTTGAGGTGTGG - Intronic
1174111687 20:48201842-48201864 GAGGGGGCCCACCTGAGCTGGGG - Intergenic
1175369974 20:58481669-58481691 AAGGGGGCCCTCTTGAGCTTTGG + Intronic
1175829503 20:61954377-61954399 AAGGGGTCCCACTGCAGCTGGGG + Intronic
1176841829 21:13848592-13848614 AGGGAGTCCCACTTCAGGTGTGG - Intergenic
1178190690 21:30276523-30276545 AAGGCGGATCACTTCAGGTCAGG + Intergenic
1179710061 21:43208149-43208171 AGGGGGTCCCAGTTCAGCTGTGG + Intergenic
1180150388 21:45944211-45944233 AAGGGAGCCCAGAGCAGGTGAGG + Intergenic
1181804469 22:25366604-25366626 CATGGGGGCCACTTCAGGAGGGG + Intronic
1183417135 22:37688982-37689004 ACTGGGACCCACCTCAGGTGGGG - Exonic
1183591087 22:38779637-38779659 AAGGGGGCGCAGGGCAGGTGGGG + Intronic
949508352 3:4747059-4747081 AAGGGGACCTTCTTTAGGTGTGG + Intronic
950480746 3:13242313-13242335 AAGGTGACCCACATGAGGTGCGG + Intergenic
950948436 3:16975040-16975062 AAGGGTGCTTACTTCAGGTCTGG + Intronic
954673366 3:52302566-52302588 AAGGGGGCCCACATCAAAAGAGG + Intergenic
954823307 3:53349569-53349591 AAGGTGGACCACTTGAGGTCAGG + Intergenic
961627455 3:128273845-128273867 AAGGGGGCCCACCTCAGCAGTGG - Intronic
962317880 3:134370086-134370108 AAGTGGGCCCTTTTCTGGTGAGG - Intronic
962324722 3:134423476-134423498 AAGGGTGCACCCATCAGGTGTGG + Intergenic
967770608 3:193330083-193330105 CAAGGGGCCCACTGCATGTGGGG - Intronic
971637422 4:29079432-29079454 AAGGTGGCCATCTACAGGTGAGG - Intergenic
973122117 4:46534353-46534375 AAAGGGACCCACATCTGGTGAGG + Intergenic
979239316 4:118434448-118434470 AAGGTAGCCTACTTCAGGTCTGG - Intergenic
979331465 4:119424918-119424940 AAGGAGGACCACTTGAGGTCAGG + Intergenic
980452244 4:132989277-132989299 CAGGGGGATCACTTGAGGTGAGG - Intergenic
984333975 4:178363270-178363292 CTGGGGGACCACTTCAGGTCAGG + Intergenic
987154615 5:15076654-15076676 CAAGGGGCCCACGTCTGGTGAGG - Intergenic
988821370 5:34889534-34889556 TGTGGGGCCCACCTCAGGTGTGG - Intronic
989348654 5:40458644-40458666 TCAGGGGCCCACTTCTGGTGAGG - Intergenic
992487150 5:77208766-77208788 AAGGTGGCTCTCTTCAGCTGAGG - Intergenic
996004581 5:118405212-118405234 AAGGAGGCCCCCATCAGGTGAGG + Intergenic
1001003073 5:168025962-168025984 AAGGGGGCTCACTTGCGATGGGG + Intronic
1002522359 5:179798809-179798831 TACGAGGCCCACTTCAGATGCGG + Intronic
1002662864 5:180803112-180803134 CTGCGGGCCCACTTCAGGCGCGG - Intronic
1002739558 5:181425034-181425056 AAGGTAGCCTACTTCAGGTCTGG - Intergenic
1002781448 6:369850-369872 AAGGGAGCGGACTGCAGGTGAGG + Intergenic
1004532458 6:16465871-16465893 GGGGAGGCCCACTACAGGTGAGG + Intronic
1006128797 6:31856130-31856152 AAGGGGGATCACTTGAGGTCAGG - Intergenic
1006889363 6:37412442-37412464 AAGGTGGCTCACCTGAGGTGAGG - Intergenic
1008079842 6:47182311-47182333 AAGGGGACCCAGCTGAGGTGGGG + Intergenic
1009913335 6:69961024-69961046 ACGGGGAGCCACTTCAGGTGGGG + Intronic
1014650339 6:124028378-124028400 AAGTAGGGCCACTTGAGGTGGGG + Intronic
1016856324 6:148674077-148674099 AATGGTGCTCACTTCAGCTGAGG + Intergenic
1017574391 6:155786180-155786202 AAGGGGGTCCACATCTCGTGGGG - Intergenic
1017906182 6:158758819-158758841 AAGGGAGGCCACTTCTGGTAGGG - Intronic
1019244675 6:170700605-170700627 AAGGTAGCCTACTTCAGGTCTGG - Intergenic
1023156593 7:37257636-37257658 CAGGTGGACCACTTCAGGTCAGG + Intronic
1025101949 7:56142880-56142902 AAGGGGGATCACTTGAGGTCAGG + Intergenic
1025194639 7:56923379-56923401 AAGGTGGCTCACTTGAGGTCAGG - Intergenic
1025677313 7:63653564-63653586 AAGGTGGCTCACTTGAGGTCAGG + Intergenic
1026805692 7:73428831-73428853 ATGGGGGCCCACTCCAGGGCAGG + Intergenic
1029687370 7:102158015-102158037 AAGGTGGCCAACTGGAGGTGAGG - Intronic
1029693964 7:102201306-102201328 AGGGCGGCCCCCTTCAGCTGGGG - Intronic
1029905343 7:104087394-104087416 CAGGGGGACCACTTGAGGTCAGG + Intergenic
1029984092 7:104905492-104905514 AAGGTGGCTCACTTCAGCTCAGG + Intronic
1031010672 7:116523439-116523461 ACTGGGGCCCACTTGAGGGGTGG - Intergenic
1031363758 7:120878758-120878780 AATGGGGCCTACTTTAGGTAAGG - Intergenic
1034737896 7:153446118-153446140 AAATGGGCCCAGGTCAGGTGTGG + Intergenic
1035503452 8:107571-107593 AAGGTAGCCTACTTCAGGTCTGG + Intergenic
1035737752 8:1901123-1901145 GAGGGGCCCTACCTCAGGTGTGG + Intronic
1036792802 8:11733782-11733804 GAGGGAGCCCATTTCTGGTGAGG + Intronic
1037046652 8:14313561-14313583 AAGGTGGACCACTTGAGGTCAGG - Intronic
1039521931 8:38178380-38178402 AAGGGGGATCACTTGAGGTCAGG - Intronic
1040450473 8:47541085-47541107 AAGGCGGACCACTTGAGGTCAGG - Intronic
1040858208 8:51972311-51972333 AAGGGGTCACAGCTCAGGTGGGG - Intergenic
1042481391 8:69307567-69307589 TAAGGGGCCCACATCTGGTGAGG - Intergenic
1043727032 8:83623680-83623702 AATGGGGCCTACTTGAGGGGAGG - Intergenic
1045586242 8:103540242-103540264 AAGGGGTCCCTCTTCATGTTGGG - Intronic
1048425478 8:134319383-134319405 AAGGGGACCCACTGAGGGTGAGG - Intergenic
1049482156 8:142830999-142831021 AAGGGGGCCCCATTCTGCTGGGG - Intergenic
1049733497 8:144191382-144191404 GAGGGGGCCCTGTGCAGGTGTGG - Intronic
1049757758 8:144318352-144318374 CAGGGAGCCCACTGCAGGAGAGG + Exonic
1050377471 9:4987506-4987528 AAGGAGGATCACTTGAGGTGAGG + Intronic
1052881305 9:33602387-33602409 AGGGAGTCCCATTTCAGGTGTGG + Intergenic
1053495014 9:38543455-38543477 AGGGAGTCCCATTTCAGGTGTGG - Intronic
1053667183 9:40324570-40324592 AGGGAGTCCCATTTCAGGTGTGG + Intronic
1054378327 9:64464598-64464620 AGGGAGTCCCATTTCAGGTGTGG + Intergenic
1054517427 9:66051713-66051735 AGGGAGTCCCATTTCAGGTGTGG - Intergenic
1056776994 9:89520364-89520386 CAAGGGGCCCACCTCTGGTGAGG + Intergenic
1057236161 9:93362938-93362960 AAGGTGGCTCACTTGAGGTCAGG - Intergenic
1059413097 9:114146077-114146099 AAGGTGGATCACTTGAGGTGAGG - Intergenic
1061814976 9:133189085-133189107 AAGGGGACACAGGTCAGGTGTGG - Intergenic
1062188509 9:135231448-135231470 CAGGGTGCCCACCTCAGGAGTGG + Intergenic
1203604864 Un_KI270748v1:49835-49857 AAGGTAGCCTACTTCAGGTCTGG - Intergenic
1187669673 X:21656527-21656549 GCGCGGGCCCACTTCTGGTGCGG - Exonic
1190336300 X:49264620-49264642 AATGGGGCCCACATCTGGTAGGG + Intronic
1191729366 X:64316881-64316903 AAGGTGGATCACTTGAGGTGAGG + Intronic
1194590319 X:95792391-95792413 CAGGTGGCTCACTTGAGGTGAGG + Intergenic
1197218677 X:123890712-123890734 CAGGGAGATCACTTCAGGTGAGG + Intronic
1199680734 X:150222752-150222774 AAGGGGCTCCCCTTCTGGTGAGG + Intergenic
1202077016 Y:21046341-21046363 CAGGCGGACCACTTGAGGTGAGG - Intergenic
1202115162 Y:21465095-21465117 AAGGGGGTCCACTACAGGTCAGG + Intergenic