ID: 1077535423

View in Genome Browser
Species Human (GRCh38)
Location 11:3121836-3121858
Sequence AAGGAAAGGCCTCATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 455
Summary {0: 1, 1: 0, 2: 5, 3: 49, 4: 400}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077535411_1077535423 21 Left 1077535411 11:3121792-3121814 CCTACCACTGGTGTCCTTATAAA 0: 1
1: 0
2: 27
3: 190
4: 515
Right 1077535423 11:3121836-3121858 AAGGAAAGGCCTCATGAGGAAGG 0: 1
1: 0
2: 5
3: 49
4: 400
1077535417_1077535423 7 Left 1077535417 11:3121806-3121828 CCTTATAAAAAGGGGGAGAGACA 0: 1
1: 3
2: 25
3: 201
4: 728
Right 1077535423 11:3121836-3121858 AAGGAAAGGCCTCATGAGGAAGG 0: 1
1: 0
2: 5
3: 49
4: 400
1077535409_1077535423 29 Left 1077535409 11:3121784-3121806 CCCTAATTCCTACCACTGGTGTC 0: 1
1: 1
2: 1
3: 28
4: 239
Right 1077535423 11:3121836-3121858 AAGGAAAGGCCTCATGAGGAAGG 0: 1
1: 0
2: 5
3: 49
4: 400
1077535410_1077535423 28 Left 1077535410 11:3121785-3121807 CCTAATTCCTACCACTGGTGTCC 0: 1
1: 1
2: 2
3: 31
4: 256
Right 1077535423 11:3121836-3121858 AAGGAAAGGCCTCATGAGGAAGG 0: 1
1: 0
2: 5
3: 49
4: 400
1077535412_1077535423 17 Left 1077535412 11:3121796-3121818 CCACTGGTGTCCTTATAAAAAGG 0: 1
1: 3
2: 8
3: 28
4: 169
Right 1077535423 11:3121836-3121858 AAGGAAAGGCCTCATGAGGAAGG 0: 1
1: 0
2: 5
3: 49
4: 400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077535423 Original CRISPR AAGGAAAGGCCTCATGAGGA AGG Intronic
900941445 1:5801267-5801289 GAGGAAATGCCACATGAAGATGG + Intergenic
901779845 1:11586613-11586635 AAGGAAAGGACTCCTGAGAGGGG + Intergenic
902362195 1:15948016-15948038 CAGGAAAGGCCTCATTGGGAGGG - Intronic
902690970 1:18109934-18109956 AAGGAGAGGACTGATGAGAAGGG + Intronic
902814197 1:18906830-18906852 AAGGAAAAAACTCATGACGAAGG + Exonic
903055674 1:20634288-20634310 AAGGAAAGTCCTCAGGTGAAGGG + Intronic
903171764 1:21558746-21558768 AAGGGGAGGCCTCTTGGGGAGGG + Intronic
904828838 1:33293904-33293926 AGATAAGGGCCTCATGAGGAAGG - Intronic
908841242 1:68282078-68282100 AAATAAAGGCCTCAGAAGGAAGG - Intergenic
909218566 1:72924889-72924911 AAGTAAAGGGCACATGAGAATGG + Intergenic
909421781 1:75475305-75475327 AAGGAAAGGAATGATGAGGAAGG + Intronic
911512550 1:98825673-98825695 ATGGAAATGCATCATGAGTAAGG + Intergenic
911563489 1:99434557-99434579 AAGGAAAAGTTTCTTGAGGAAGG - Intergenic
911643220 1:100311256-100311278 AAGGAAGTCCCTCATGTGGAAGG + Intergenic
911665135 1:100543365-100543387 AAGGACAGGCCTCAAAAGTAAGG - Intergenic
912192455 1:107355710-107355732 AGGTTAAGGCCTCATGAGAAAGG - Intronic
912634447 1:111278858-111278880 AGGGAATGGCCTCAGCAGGAGGG + Intergenic
912813206 1:112809444-112809466 AAGAAAAGGCCTTCTGGGGAGGG + Intergenic
912953096 1:114134107-114134129 AAGGAAAGGCACCGTGAGAAAGG - Intronic
913253881 1:116937039-116937061 CAGGAAAGGCCTCATTGAGAAGG + Intronic
913587295 1:120288116-120288138 AGGGAAAGGAATCAAGAGGAAGG + Intergenic
913620890 1:120610253-120610275 AGGGAAAGGAATCAAGAGGAAGG - Intergenic
914569311 1:148899999-148900021 AGGGAAAGGAATCAAGAGGAAGG + Intronic
914603516 1:149230257-149230279 AGGGAAAGGAATCAAGAGGAAGG - Intergenic
916169287 1:161988567-161988589 AAGGAAATGCCTTCTGAGGTGGG - Intronic
916296410 1:163225335-163225357 AAGTAACGGATTCATGAGGATGG - Intronic
916541357 1:165758134-165758156 GAGGAAGGGCCTGATGATGATGG - Intronic
918966884 1:191362414-191362436 ATGGGATGGCCTTATGAGGAAGG + Intergenic
919362599 1:196613143-196613165 AAGGAAAGGCTCTATGAGGTAGG - Intergenic
919784303 1:201249447-201249469 CAGAAAAGGCCTCATGGAGAAGG - Intergenic
920720509 1:208382499-208382521 CAGAAAAGGCCTCAAGAGGCTGG + Intergenic
921066182 1:211623627-211623649 AATGGAAAGCCCCATGAGGACGG + Intergenic
921554606 1:216582981-216583003 CAGGAAAGACTTCATGAGAAAGG + Intronic
922913249 1:229234798-229234820 AAGGAAATGCCTTGTGAGGGAGG - Intergenic
923701883 1:236307518-236307540 AGGGAAAGGCCCCAAGAGGCAGG - Intergenic
923901473 1:238330414-238330436 ACGGATAGGGCTCAAGAGGAAGG - Intergenic
924135232 1:240958813-240958835 CAGAAAAGGTCTCATGAGGGAGG - Intronic
924807695 1:247374104-247374126 AAGTAAAGGCCACCTGAGGAGGG - Intergenic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1063715326 10:8521039-8521061 AAGGACAGGCATCATAGGGATGG + Intergenic
1064109389 10:12524866-12524888 AAGGAAATGCTTCAGGTGGAAGG - Intronic
1065513895 10:26506139-26506161 TAGGAAAGGCCTCGCTAGGAAGG - Intronic
1065840024 10:29694911-29694933 AAGGAAAGGCAGCTAGAGGAAGG + Intronic
1066063529 10:31745226-31745248 AAGGAAACACCACAGGAGGAGGG - Intergenic
1067358044 10:45549434-45549456 AAGAAAAGGCCACATGGAGAAGG - Intronic
1068446165 10:57126492-57126514 AAGTAAAGGCTTCATGAAGGAGG - Intergenic
1069592511 10:69650805-69650827 TAGGACAGGCCTGATGAGGCTGG + Intergenic
1069835271 10:71304188-71304210 AAGGGACAGCTTCATGAGGATGG + Intergenic
1070730716 10:78826318-78826340 GAGGGAGGTCCTCATGAGGAAGG - Intergenic
1071712954 10:88067691-88067713 TAGGGAAGGCCTCAGGAAGAAGG + Intergenic
1073676538 10:105653676-105653698 AAGGAAAAACATCATGAGAATGG + Intergenic
1074492047 10:113947088-113947110 AAAGATAGGCCACAAGAGGATGG + Intergenic
1074851008 10:117439694-117439716 CAGGAAAGGCTTCCTGAGGGAGG + Intergenic
1074964996 10:118483006-118483028 AAGGATTTGGCTCATGAGGAAGG + Intergenic
1076782718 10:132733124-132733146 AAGAAAAGGCCACATGAGGATGG - Intronic
1077481469 11:2816780-2816802 CAGGGAAGGCCTCCTGAGCAGGG - Intronic
1077521401 11:3037518-3037540 AGGGAAAGGCCTGAGGAAGAGGG + Intronic
1077535423 11:3121836-3121858 AAGGAAAGGCCTCATGAGGAAGG + Intronic
1077715388 11:4575286-4575308 AAGTAAAGGCATCAAGAGAATGG + Intronic
1078320901 11:10333627-10333649 AGGGAAAGGCCATATGAGGACGG + Intronic
1078470716 11:11584016-11584038 AAGGAATGGCATCATGAGCTGGG + Intronic
1078562349 11:12384087-12384109 AAGAAATGGCCTTATGAGCAAGG - Intronic
1081205741 11:40273555-40273577 AAGAAAAGGCCTCTTTACGATGG + Intronic
1081285064 11:41257997-41258019 AAAGAAAAGCCTCATGAGCTAGG + Intronic
1082609567 11:55281184-55281206 AAGGAAGGGACTGATGAGCATGG + Intergenic
1082796325 11:57380610-57380632 AAGGGAAAGACGCATGAGGAGGG + Intronic
1083706694 11:64521475-64521497 AAGAAAGGTCCTCTTGAGGAAGG - Intergenic
1084160933 11:67349721-67349743 AAGGAGAAGCTTCCTGAGGAAGG - Intronic
1084344829 11:68539850-68539872 CAGGAAAGGCCTAATTAAGATGG + Intronic
1084428668 11:69099598-69099620 CAGGAAAGCCCTCCTGGGGAGGG - Intergenic
1084712815 11:70854598-70854620 AAGGAAGGGCCTTCTGGGGAAGG + Intronic
1084778926 11:71396279-71396301 CAGGACAGACATCATGAGGAAGG - Intergenic
1086832634 11:91584242-91584264 CAGGAAAGGTCTGATCAGGAAGG + Intergenic
1087123527 11:94599661-94599683 AGTGGAAGGCATCATGAGGATGG + Intronic
1087346734 11:96981397-96981419 AAAGAAAGGCCTCAAAAAGATGG - Intergenic
1089371930 11:117967001-117967023 AAGGAAAGATCTCAGGAAGAAGG - Intergenic
1090934151 11:131326931-131326953 GAGGAGAGGCATCAAGAGGATGG - Intergenic
1091146552 11:133285077-133285099 AATGAGAGACCTCATGAGGAAGG + Intronic
1091351416 11:134900133-134900155 GAGAAAAGGCCTCCTGAGGATGG - Intergenic
1091938664 12:4454562-4454584 TTGGAAAGGTCTCAGGAGGAAGG + Intergenic
1094062156 12:26325893-26325915 AAGGAAAGGGCTCAGGGAGAGGG - Intergenic
1094608661 12:31972104-31972126 AAGGCAAGGTCACATGAGAAGGG - Intronic
1095789484 12:46148605-46148627 AATGAAAAACTTCATGAGGAAGG - Intergenic
1097189122 12:57211119-57211141 ATGGAGAGCCCTCATGAGGGTGG + Intronic
1097487333 12:60221610-60221632 AAGGAAAGGAATCATAGGGAAGG - Intergenic
1097543475 12:60969630-60969652 TTGGAAAGGCCTCAGAAGGAAGG - Intergenic
1097849449 12:64397205-64397227 CTGGAAAGACCTCATGAGGGAGG + Intergenic
1097956542 12:65492514-65492536 AAGAAAAGGGGTGATGAGGAAGG - Intergenic
1099007835 12:77256083-77256105 AGGGAAAGGCCTCCTGAAAATGG - Intergenic
1099105300 12:78488588-78488610 CAGGAAAGGCCTTGTTAGGATGG - Intergenic
1100195429 12:92239489-92239511 CAGGGAAGGCCTCATTAAGAAGG - Intergenic
1100219085 12:92484459-92484481 ATGAAAAGTCCTCATGAGGCAGG - Intergenic
1101593951 12:106147262-106147284 CAGGAAAGGCCCCATGGTGAGGG - Intergenic
1102458476 12:113085915-113085937 AAGAAAAGGCCTCATGGAGAAGG + Intronic
1102491525 12:113292256-113292278 AAGGAGAAGCCTCTGGAGGACGG - Intronic
1102528562 12:113529470-113529492 AAGCAAAGGCTTAAAGAGGATGG + Intergenic
1102766276 12:115436083-115436105 CAGGGAAGGCTTCATGAAGATGG + Intergenic
1104634062 12:130426826-130426848 AAGGAAAGGCATCAGGGGGCGGG + Intronic
1104748239 12:131223105-131223127 GAGGAGAGGCCTCATGAGCCGGG - Intergenic
1105641743 13:22272141-22272163 AAAGACAGGCATCATTAGGAAGG + Intergenic
1105834409 13:24196217-24196239 AAGTAAAGCCCTCATAATGATGG + Intronic
1106020085 13:25906042-25906064 AAGGTAAGGCCTCATCATGCAGG - Intronic
1106302913 13:28485837-28485859 GAGGAAAGATCTCATGAAGAGGG + Intronic
1106480658 13:30134804-30134826 AAAGAAAGTCCTAATGTGGAGGG + Intergenic
1106749078 13:32739334-32739356 AAGGAAAGACATCTTGTGGATGG - Intronic
1107405931 13:40113343-40113365 AAGTAAGGGTCTCATGAGGTGGG + Intergenic
1107792822 13:44019193-44019215 AAGGCAAAGCGTCATGAGGAAGG - Intergenic
1109813763 13:67551446-67551468 AAGGAAGAGCCTCCTAAGGAAGG + Intergenic
1110577723 13:77079167-77079189 GTTGAAAGGCTTCATGAGGAAGG - Intronic
1110952108 13:81507819-81507841 AAGGAAAGGAATCATTAGGCTGG + Intergenic
1113782749 13:112986057-112986079 AAGGAAATGCCTTCTGAGGCAGG - Intronic
1113843107 13:113371466-113371488 AGGGAGGGGCCTCAGGAGGAGGG - Intergenic
1113843208 13:113371705-113371727 AGGGAGGGGCCTCAGGAGGAAGG - Intergenic
1113843238 13:113371783-113371805 ATGGAGGGGCCTCAGGAGGAGGG - Intergenic
1113843246 13:113371802-113371824 AGGGAGGGGCCTCAGGAGGATGG - Intergenic
1113843277 13:113371882-113371904 AGGGAGGGGCCTCAGGAGGAGGG - Intergenic
1114190683 14:20437566-20437588 GATGAAAGGGCTCATGTGGAGGG + Intergenic
1117446265 14:55806430-55806452 AAGGAAATTCCTTGTGAGGAAGG + Intergenic
1120495211 14:85226242-85226264 AAGGCAAGACCTCATAAGCAAGG + Intergenic
1120813817 14:88832076-88832098 AATGAGAGGCCTAATGAGTAGGG - Intronic
1121092605 14:91193206-91193228 AGAGAAAGGCCTCGGGAGGAAGG + Intronic
1121338440 14:93091069-93091091 AAGGAAAGGCAGGAAGAGGAAGG + Intronic
1122243130 14:100382312-100382334 CAGTGAAGGCCTCCTGAGGAAGG + Intronic
1122288893 14:100668872-100668894 ACGGAGTGGCCGCATGAGGAGGG + Intergenic
1122391702 14:101393177-101393199 AAGGAAGTGCCTCGTGATGATGG + Intergenic
1125322294 15:38501268-38501290 CAGGGAAGGCCTCATCAGCAGGG - Exonic
1126245929 15:46505695-46505717 AAGGAAAAACCTAATGTGGATGG - Intergenic
1129085707 15:73088755-73088777 AGGGAAAGGACTGAAGAGGATGG + Intronic
1129740889 15:77989073-77989095 CAGGGAAGGCCTTCTGAGGAGGG + Intronic
1130510425 15:84584513-84584535 AAAGTAAGACCTCATAAGGAAGG + Intergenic
1131067160 15:89441904-89441926 CAGGGAAGGCCTCATTAAGAGGG + Intergenic
1132224264 15:100128322-100128344 TTGGAAAGGCTTCATCAGGAAGG + Intronic
1132671630 16:1104292-1104314 AAGGGAAGGCCTGGGGAGGAAGG + Intergenic
1133361147 16:5174753-5174775 AATGAAAGAGCTCAGGAGGAAGG + Intergenic
1134596127 16:15497410-15497432 AAGGAATTCCCTCCTGAGGAAGG + Intronic
1134670936 16:16054577-16054599 AAGGAGAGGCCTCACGTGGTAGG + Intronic
1135004896 16:18811556-18811578 AAGGAAAGTGCTCATAGGGAAGG + Intronic
1135183419 16:20294284-20294306 CAGGGAAGGCTTCATGAGGGTGG + Intergenic
1135356365 16:21772402-21772424 AAGGAAAGGCCACAAGATTAGGG - Intergenic
1135454857 16:22588546-22588568 AAGGAAAGGCCACAAGATTAGGG - Intergenic
1135660433 16:24291924-24291946 AAGGAAAGGGTTAAGGAGGATGG + Intronic
1135875518 16:26196480-26196502 AAGCAGAAGCCTCATGAGGTTGG - Intergenic
1136288827 16:29259608-29259630 AAGGCCAGGCCTAATCAGGATGG - Intergenic
1137065300 16:35835046-35835068 AAAAAAAGGGCTCATGTGGAGGG - Intergenic
1137249008 16:46729539-46729561 AAGGAAAGGAATCCTGAGGCTGG + Intronic
1137623122 16:49889805-49889827 AAGAAAAGGCCACAAGAGGCAGG + Intergenic
1137912815 16:52395358-52395380 AAGTCAAGTCCCCATGAGGAAGG + Intergenic
1138416181 16:56872628-56872650 AAAGCAAGGCCTGATGAGTAAGG - Intronic
1141653097 16:85404012-85404034 GAGGAAAGGCCCCGTAAGGACGG - Intergenic
1142001552 16:87667153-87667175 AAGGAGAGGCCACGTGACGAGGG - Intronic
1142094554 16:88232515-88232537 AAGGGCAGGCCTAATCAGGATGG - Intergenic
1144360489 17:14487267-14487289 CAGCAAAGGCCTCATGTGGGAGG + Intergenic
1145758309 17:27408943-27408965 AAGGCAAGGCCTCTTGCAGAGGG - Intergenic
1145899190 17:28478939-28478961 CAGGGAAGGCCTCCTGAGGAGGG + Intronic
1146446153 17:32934419-32934441 AAGGAAAGGCCTCTTGCGAGAGG - Intronic
1146600071 17:34206316-34206338 ATCTCAAGGCCTCATGAGGAAGG - Intergenic
1147363128 17:39943904-39943926 AAGGAAAGGCCACATAAAGGAGG - Intronic
1147374637 17:40016354-40016376 AAGGATAAGGCTAATGAGGAGGG + Intronic
1148025621 17:44585633-44585655 AAGGAGAGCCCTCATAGGGAAGG - Intergenic
1148673652 17:49432158-49432180 AAGGGAAGGCAGCATCAGGAAGG - Intronic
1149581584 17:57754418-57754440 GGGGAAAGGCCTGAGGAGGAAGG - Intergenic
1151504751 17:74520415-74520437 TGGGAAGGGCCTCATGGGGAAGG + Intergenic
1151638672 17:75372356-75372378 AGGGAAGGGACTCATGAGAACGG + Intronic
1152218958 17:79050306-79050328 AGGGGAAGGCCACATGAAGACGG - Intergenic
1152244949 17:79180570-79180592 AGGTAAAGGCCACAGGAGGAGGG - Intronic
1152340120 17:79719792-79719814 CAGAGAAGGCCTCGTGAGGATGG + Intergenic
1152467559 17:80474669-80474691 AAGGAAGGACCTCAGGAGGGAGG - Intronic
1153034795 18:750744-750766 AAGGAAAGGCATCTTGAGAAAGG + Intronic
1153732955 18:8033998-8034020 AAGTGAAGGCCACATGAAGATGG - Intronic
1155453651 18:25988488-25988510 CAGGAATGGACACATGAGGAGGG - Intergenic
1155878851 18:31119081-31119103 GCCGAAAGTCCTCATGAGGAGGG + Intergenic
1156827221 18:41445598-41445620 AAAGAATGTCCTCTTGAGGAGGG - Intergenic
1157161475 18:45317989-45318011 AAGGAAAGAGCTCTTGAGGTGGG - Intronic
1157463594 18:47924782-47924804 AATGAAAGACGTGATGAGGATGG + Intronic
1157470802 18:47986612-47986634 AAGGAAAGGAGTGATGAGGAAGG + Intergenic
1158361866 18:56683553-56683575 AATGAAAGTCCTCATGGTGATGG - Intronic
1158888740 18:61853632-61853654 GAGGAAAGGGCTCATGAGCTGGG - Intronic
1159055702 18:63461582-63461604 AAGGAAAGGCTTCAAGGTGAGGG - Intergenic
1159599060 18:70411346-70411368 GAGGAAAGGCCCTATGAGGACGG + Intergenic
1159953331 18:74501596-74501618 AAGGAAGGGCCTGATTTGGATGG + Intronic
1160502302 18:79407803-79407825 AAGAAATGCCCTCAAGAGGACGG - Intronic
1161700674 19:5793285-5793307 AAGGGAAGGCTTCCTGGGGAAGG + Intergenic
1161861601 19:6802024-6802046 TAGGAGAGGCATTATGAGGACGG - Intronic
1163829837 19:19542307-19542329 ATGGAAAGCCCTCCTCAGGAGGG + Intronic
1164748883 19:30636392-30636414 AGACAAGGGCCTCATGAGGATGG - Intronic
1164934964 19:32202953-32202975 ATGAAAAGGCCTTATGAGGCAGG - Intergenic
1166621273 19:44303460-44303482 AGGGAAAGGCATCATGAGATAGG + Intronic
1167199291 19:48053170-48053192 AAGAAAAGGCATCATGAGTTTGG + Intronic
1167296282 19:48652081-48652103 AGGGAAAGACATCATGAGCATGG - Intergenic
1167686957 19:50962497-50962519 TAGGAAAGGACCAATGAGGAAGG - Intronic
1168533495 19:57149565-57149587 AAAGAAAGACCTCATGAAGCGGG + Intergenic
1202649644 1_KI270706v1_random:169024-169046 AAATAAAGGCCTCCTGAAGATGG - Intergenic
925301836 2:2821800-2821822 AGGGAAAGGCTTCATGACAATGG + Intergenic
925304962 2:2841715-2841737 AAGCAGAGCCCTCATGAGTAAGG + Intergenic
925384081 2:3449887-3449909 AAGGAAAGGCCGAGTGAGGATGG + Intronic
928387985 2:30885684-30885706 AAGGAATGGCCTCAGGAAGGAGG + Intergenic
928883617 2:36123870-36123892 AAGAAATGGGCTCCTGAGGAAGG + Intergenic
929061575 2:37930437-37930459 AAGGAAAAGCCACTTGGGGAAGG - Intronic
929348652 2:40919760-40919782 GAGGAAAGACCTCATGAAGAGGG - Intergenic
929625965 2:43407041-43407063 AAGGAAAGGCGACATGCTGAGGG - Intronic
929671293 2:43877971-43877993 CAGGAAGGGGCTCCTGAGGAGGG - Exonic
930395392 2:50817027-50817049 AAGAAAAAGGGTCATGAGGAAGG + Intronic
932197788 2:69799041-69799063 GAGGAGGGGCCTCATGAGGAGGG + Intronic
932455252 2:71845413-71845435 CAGGAAGGGCCTTCTGAGGAGGG + Intergenic
932547770 2:72732740-72732762 TAGGAAAGGCCTCATTAAGAAGG + Intronic
933632732 2:84675092-84675114 AAGGAAAGGCCCTGTGAGCAAGG - Intronic
934149429 2:89131156-89131178 CATGAAAGGCCACAGGAGGACGG - Intergenic
934217867 2:90050885-90050907 CATGAAAGGCCACAGGAGGACGG + Intergenic
935138716 2:100332511-100332533 AAGGAAAGGCCCCAGGAAAAGGG - Intergenic
935315286 2:101827444-101827466 GAGGTAAGGTCTCATGAGAAAGG + Intronic
936800125 2:116256423-116256445 AAGGAAAGGCCTTATGAAATAGG - Intergenic
936903214 2:117507458-117507480 AAGGAAGGCCCTCAAGAGCAGGG + Intergenic
938235245 2:129700500-129700522 GAGGAAATGCCTCAAGAAGATGG + Intergenic
938838276 2:135130982-135131004 CAGGGAAGGCTTCATGAAGAGGG + Intronic
938956927 2:136307509-136307531 CAGGAAAGGCCTAGTGAGAAGGG + Intergenic
939122961 2:138140447-138140469 AAGCCAAGGCTGCATGAGGACGG - Intergenic
940187739 2:151005393-151005415 AGGGGAAGGCCACATGATGATGG - Intronic
940681424 2:156790425-156790447 CAGGAAAGGTCTCATTAAGATGG + Intergenic
941474137 2:165927406-165927428 CAGGATAGGCCTCATGAAGAGGG - Intronic
941633908 2:167914856-167914878 AAGAAAAGGCCCAATGAGCAGGG + Intergenic
941708032 2:168680532-168680554 AGGGGAAGGCTCCATGAGGAGGG - Intronic
942102610 2:172600688-172600710 GAGGAGGGGGCTCATGAGGAGGG + Intronic
942114877 2:172718662-172718684 AAGGCAAGGTCTCATGGGGAAGG + Intergenic
942632093 2:177961356-177961378 AAGGAAAGGTCTCAGCAGGCTGG - Intronic
942862900 2:180636772-180636794 CAGGAAAGTCCTCATGATGGTGG + Intergenic
944141130 2:196458369-196458391 AAGGAAAGGTCTCATAATGCTGG + Intronic
944542357 2:200766099-200766121 AATGAGACGACTCATGAGGAGGG - Intergenic
945313609 2:208344939-208344961 AAGTAGAAGCTTCATGAGGAAGG - Intronic
946439455 2:219682585-219682607 AAGGAAAGACTTCATGGGGGAGG + Intergenic
946977670 2:225171216-225171238 AAGGAAGTGCTTCAGGAGGAGGG - Intergenic
947108935 2:226697834-226697856 CAGGGAAGGCCTCAATAGGAGGG + Intergenic
947268436 2:228307024-228307046 CAGGAAATGCCTCACGAGAATGG - Intergenic
947464126 2:230326204-230326226 AAGCAAAGGGCGCATGAGAATGG - Intergenic
947473030 2:230415239-230415261 AAGCAAAGGGCGCATGAGAATGG - Intergenic
947728770 2:232416925-232416947 AAGGAGATGCCTCCTGAGCATGG + Intergenic
948281276 2:236749657-236749679 CAGGAAAGGATTCCTGAGGAAGG + Intergenic
948635302 2:239330688-239330710 AAGGCCAGGCCTCATGACCAGGG - Intronic
1168896591 20:1328062-1328084 GAGGAAAGGCCTAATGGGGTGGG + Intronic
1168949560 20:1787315-1787337 AAGGGAAGGCCTCCTGGGGGCGG - Intergenic
1170341118 20:15328133-15328155 TAGGACAGGCCTCATTAGGAAGG + Intronic
1170516240 20:17133318-17133340 TAGGAAAGGCCTCATTAAGAAGG - Intergenic
1170702284 20:18714119-18714141 AAGGAAAGGCAGGATGAGAAAGG + Intronic
1172025965 20:31948788-31948810 AAGGTAAGGCCTCCTGGGGATGG - Exonic
1173175869 20:40764339-40764361 AAAGAAAAGCCTAATTAGGAAGG - Intergenic
1174121685 20:48270572-48270594 AAGGGAAGGCCACATGAAGAGGG + Intergenic
1174419348 20:50389657-50389679 AAGGGAAGGCCTGGTCAGGAGGG - Intergenic
1175275064 20:57762776-57762798 ACTGAAAGGCCACCTGAGGATGG + Intergenic
1176602179 21:8803523-8803545 AAATAAAGGCCTCCTGAAGATGG + Intergenic
1177169354 21:17638639-17638661 AAGGCAAGGCCACTTGAGCAGGG + Intergenic
1178420890 21:32442427-32442449 CAGGAAAGGCCCCATGACCAAGG - Intronic
1179552000 21:42149451-42149473 AGGGAAAGGCCTCATGCTGTTGG + Intergenic
1179618460 21:42596868-42596890 GAGGAAAGGGCTCTTCAGGATGG - Intergenic
1179894038 21:44351424-44351446 AAGGCAAGGCCCCATGTGGGTGG - Intronic
1180344464 22:11695074-11695096 AAATAAAGGCCTCCTGAAGATGG + Intergenic
1181260460 22:21593554-21593576 AAGGAAAGCCATCGTTAGGAGGG - Intronic
1181304095 22:21904629-21904651 AAGGAGAGGCCACATGATGGTGG - Intergenic
1182393958 22:30021953-30021975 AAGAAAAGGCCTGGTGAAGAAGG - Intronic
1182972763 22:34593296-34593318 GAGGAAAGGCCATATGAGCATGG + Intergenic
1183614727 22:38937048-38937070 AAGTAAAGGCCTCCTGGAGAGGG - Intergenic
1184973915 22:48047503-48047525 AAGGGGAGGCCACATGAAGATGG + Intergenic
1185061779 22:48610751-48610773 TAGCAAGGGCTTCATGAGGATGG + Intronic
949315635 3:2751563-2751585 AAGATAAGGCCTAAAGAGGAGGG + Intronic
949507552 3:4741515-4741537 TAGGAAAGGCCTCATGAACCAGG - Intronic
949538410 3:5013354-5013376 AAGGAGAGGCCTCCTGGGGCTGG + Intergenic
949824225 3:8148083-8148105 AAGGAAAGACCTCAGGAGGAAGG + Intergenic
950186303 3:10947782-10947804 CAGGGAAGGCCTCATGGGGAAGG + Intergenic
951806325 3:26648025-26648047 AAGGACAGAACTGATGAGGAAGG + Intronic
952327252 3:32332534-32332556 GGGTAAAGGCCTCATGGGGAGGG + Intronic
952669280 3:35946924-35946946 GAGGAAGGGACTGATGAGGAGGG + Intergenic
952882052 3:37991367-37991389 AAGGAAAGACCTGGGGAGGAGGG + Intronic
954787258 3:53102976-53102998 GTGGGGAGGCCTCATGAGGAAGG - Intronic
956701193 3:71960307-71960329 CAGGGAAGACCTCATTAGGAAGG + Intergenic
959923254 3:111893323-111893345 ATGGAAGGGCCACATCAGGAAGG - Intronic
960533178 3:118788059-118788081 AGGGAAAGGGGTCATGAGCAAGG + Intergenic
960991337 3:123313549-123313571 AGGGAAAGGCCTGATGGGCAGGG + Intronic
961131011 3:124467467-124467489 TAGGAAAGGCCTCATGGAGAAGG + Intronic
961158862 3:124705051-124705073 AAGGAAAGGGCACTTGAGTATGG + Intronic
961208058 3:125103064-125103086 AAGGAAAGCCCCCTTGAGGAGGG - Intronic
961865269 3:129949214-129949236 AAGGACAGGTCTCAGGAGAAGGG + Intergenic
962580478 3:136793196-136793218 AAGGGAAGCCCTGCTGAGGATGG + Intergenic
963084939 3:141427867-141427889 AAGTAAATGCCTCAGGAAGATGG - Intronic
963617278 3:147557302-147557324 AAGGAAATGTCCCATGTGGAAGG - Intergenic
964099229 3:152968758-152968780 AAGGAAGTGCTTCAGGAGGAAGG - Intergenic
966125171 3:176567953-176567975 AAGTAAAGGCATGATGAAGAAGG - Intergenic
966414763 3:179677181-179677203 GAGGAATGGCCACATAAGGAAGG - Intronic
966689297 3:182726583-182726605 GAGGAGGGGGCTCATGAGGAGGG + Intergenic
966883901 3:184364056-184364078 AATGACAGTCCTCATGAGGTGGG + Intronic
967279301 3:187806629-187806651 AGGGAAGGGCCACATGATGAAGG - Intergenic
968351310 3:198055651-198055673 AAGAAGAGGCCTCAAGAAGAAGG - Intergenic
968489510 4:882489-882511 CAGGAAGGGCCACATGGGGAGGG + Intronic
968718737 4:2182384-2182406 GGGAAAAGGCCACATGAGGATGG + Intronic
968883433 4:3313752-3313774 AGGGGACGGCCACATGAGGAAGG - Intronic
968978217 4:3832963-3832985 AAGGAAATGGCTCAGGAGGAGGG + Intergenic
969063636 4:4460011-4460033 TAGGGAAGGCCTCATTAAGAGGG - Intronic
969283894 4:6190563-6190585 AAGGAGAGGCCTGGGGAGGAAGG + Intronic
970478163 4:16445729-16445751 AAGGATAGGCCATATGAGGATGG - Intergenic
970899175 4:21138825-21138847 ATGGAAAGGAGTCATGAGGCAGG + Intronic
971181537 4:24332745-24332767 AAGGAAAGGCCACAGGCTGAGGG + Intergenic
971255410 4:25009404-25009426 CAGGAGAGGCCTCATCAAGAAGG - Intronic
975101190 4:70514881-70514903 AAAGAAAGGCTTCATGAAGGTGG + Intergenic
975446508 4:74471685-74471707 AAGGAAAGGGATCACTAGGAGGG + Intergenic
975846824 4:78533964-78533986 AAGGAAGGGGCTCAGGAAGAAGG + Intronic
975854442 4:78608356-78608378 ATGGAAAGGCCTCATGGTGGAGG + Intronic
977895493 4:102360522-102360544 GAGGAAAGGGCTAAAGAGGAAGG - Intronic
978555876 4:109979790-109979812 AAGGAAAGCCCACATGAGGAGGG - Intronic
978949765 4:114543932-114543954 AAGGAAAGGCCAAAAGAGGGAGG + Intergenic
979962040 4:127032861-127032883 AAGGGAAGGCCTAATGAGATGGG + Intergenic
981215953 4:142167850-142167872 AAGGAAAGTCTTCAGGAAGAAGG - Intronic
982184410 4:152780910-152780932 AATCAAAGGGCTCAAGAGGAAGG - Intronic
982222567 4:153137554-153137576 AAGGGAAGGTCTCAAGAGGATGG + Intergenic
984468592 4:180134453-180134475 AAGGAAAGGGCTGCTGAGAACGG - Intergenic
985361022 4:189175754-189175776 GTGGAAAGGACACATGAGGAAGG - Intergenic
986174630 5:5341401-5341423 AAGGCAAGGCCTGATGGGAAGGG - Intergenic
986442248 5:7792691-7792713 AAGGAAAGGCAAGATGGGGAAGG + Intronic
988090742 5:26537777-26537799 GAGGAGAGGCCTCAGGAGAAAGG - Intergenic
988454600 5:31375984-31376006 AAGGAAAGGCCTCAAGTAGATGG - Intergenic
988665283 5:33320484-33320506 GAGGGAAGGCCTCATGAAGAAGG - Intergenic
988913274 5:35867758-35867780 AAGGAAAGGACAGATAAGGAAGG - Intronic
988941262 5:36150788-36150810 AAGTAACTGCCTCTTGAGGAAGG - Intronic
990485144 5:56250828-56250850 AAGGAAAAGTTTCTTGAGGAGGG - Intergenic
992086797 5:73284695-73284717 AAGGAAAGGCTGCAACAGGAAGG + Intergenic
992646356 5:78815284-78815306 AAGGAAAGGATTCTTGGGGAAGG - Intronic
992780050 5:80119556-80119578 TAGGAATGGCGTCATGTGGAGGG - Intronic
994136734 5:96296364-96296386 CAGAAAAGGCCTCCTGAAGATGG - Intergenic
994783710 5:104127726-104127748 AAGTAAAGGCATAATGAGAAAGG + Intergenic
996154384 5:120080002-120080024 CAGGAAAGGCACAATGAGGAGGG + Intergenic
996503391 5:124241690-124241712 TAGGACAGGCCTAATGAGGCAGG + Intergenic
997593207 5:135088132-135088154 CAGGCAAGGCTTCATGAGGGAGG + Intronic
997847749 5:137303678-137303700 CAGGCAAGGCTTCAGGAGGAGGG + Intronic
998016099 5:138733638-138733660 CAGGAAAGGCATTTTGAGGAAGG + Intronic
998609763 5:143675122-143675144 AAAGAAAGGCATCATTAGGAAGG + Intergenic
998769369 5:145524401-145524423 ACAGAGAGGCCTCAAGAGGATGG + Intronic
999171800 5:149601709-149601731 GAGGGAAGGCCTCTGGAGGAGGG + Intronic
999278365 5:150347455-150347477 AGGTCAAGGCCTCCTGAGGAGGG + Intergenic
1001549667 5:172593830-172593852 CAGGGAAGGTCTCATGAAGAAGG + Intergenic
1003030317 6:2595700-2595722 AGGGAAAGGTCACATGAAGATGG - Intergenic
1003669517 6:8143493-8143515 AAGGGAAGGACACATGATGAAGG - Intergenic
1004468708 6:15908953-15908975 AAGGAAAGACTTCCTGAGGGAGG + Intergenic
1005125282 6:22439972-22439994 AAGGAAAGGCCTCTTCATGATGG - Intergenic
1005810105 6:29508893-29508915 AGGGGAAGGCCTCATGAGGATGG - Intergenic
1006092360 6:31635554-31635576 AAGGAGAGGCCTCGTGGAGAGGG - Intronic
1006131378 6:31871275-31871297 AAGGCAAGGACACAAGAGGAGGG + Intronic
1006257522 6:32843686-32843708 AAGAAGAGGCCACATGGGGATGG - Intronic
1006515507 6:34543568-34543590 CAGGGAAGGCCTCATGCGGATGG + Intronic
1006753386 6:36393744-36393766 AAGGGAAGGCCTCATTGAGAAGG - Intronic
1006830232 6:36963960-36963982 AAGGCAAGGCCTGGTGAGGGGGG + Exonic
1007582331 6:42966870-42966892 CAGGAAAGGACACATGAGCAGGG + Intronic
1007702996 6:43775195-43775217 AAGGAAAGGGCTCCTGGGGTGGG - Intronic
1007813716 6:44505118-44505140 AAGGAAGGTCCGCATGAGGAGGG - Intergenic
1008636649 6:53417564-53417586 GAGGAAGGGCCTATTGAGGAAGG + Intergenic
1009445065 6:63732979-63733001 CAGGAAAGGCATTATGAAGAAGG + Intronic
1011761782 6:90575299-90575321 AAGGTAAGGGCTAATGATGAAGG + Intronic
1013313253 6:108917395-108917417 AAGGAAAGGACTGATGAGGTGGG - Intronic
1013348579 6:109286149-109286171 AAGGATAGGGGTCATTAGGAAGG + Intergenic
1013593442 6:111640422-111640444 GAGGAAAGGCCACCTGAGGGAGG + Intergenic
1014814168 6:125917341-125917363 AAGGAAAGCAGTGATGAGGAAGG - Intronic
1015333395 6:132007047-132007069 AAGGAGTGGACTAATGAGGACGG - Intergenic
1016548684 6:145252944-145252966 GAGGAATGGTGTCATGAGGAAGG - Intergenic
1016688065 6:146903665-146903687 AGGAAGAGGCCTCAAGAGGAAGG - Intergenic
1017543433 6:155426510-155426532 AAGCAAAGGCCTCACTAGAAGGG + Intronic
1017685163 6:156906131-156906153 AGGGAGTGGCATCATGAGGAGGG + Intronic
1017753785 6:157512313-157512335 AAGGAAGGGGCTTCTGAGGAGGG - Intronic
1018231792 6:161682525-161682547 GGGGAAAGGCCTCCTGTGGAGGG + Intronic
1018837851 6:167498576-167498598 CATCAAAGGCCTCATGAGAAGGG + Intergenic
1018984846 6:168628763-168628785 AAGGAAAGGCCTTCAGAGGCAGG - Intronic
1019436276 7:1023834-1023856 AAGGAAAGGGCTGCTGTGGAAGG - Intronic
1021111712 7:16702221-16702243 AAGGAAAGGTCTGAAAAGGAAGG - Intronic
1021399135 7:20189146-20189168 CAGGAAAGTCCTCATAAGTAAGG - Intronic
1022433548 7:30354346-30354368 AAGCAAAGGCCTCAGCAAGAAGG - Intronic
1022489118 7:30803112-30803134 CAGGAAAGGCTTCTTGAAGAAGG - Intronic
1022498200 7:30866282-30866304 GAGGACAGGCCTCAGAAGGAGGG + Intronic
1023655299 7:42413722-42413744 CAGGGAAGGCCTCATTAAGAAGG - Intergenic
1024547682 7:50536093-50536115 AAGGAAATTCCTTATGAGGGAGG - Intronic
1025251600 7:57354826-57354848 AAGGGAAGGCCTGGTCAGGAGGG + Intergenic
1025256052 7:57384511-57384533 AAAGAAAGGCCAGAAGAGGACGG + Intergenic
1026489073 7:70847127-70847149 AAGGAAAGGACTCAGGATTAAGG + Intergenic
1027824111 7:83088816-83088838 AAGGAGAGGCCTCAGGAGGGAGG - Intronic
1028314876 7:89388397-89388419 AAGTAAAGTCCTCATTGGGAAGG - Intergenic
1028534552 7:91878021-91878043 ATGGATAGGCATCAGGAGGATGG - Intronic
1028956279 7:96696237-96696259 AAGGAACTGGCTCATGAAGAGGG + Intronic
1029895145 7:103975874-103975896 CAGGGAAGGCCTCATGGAGAAGG + Intronic
1031324396 7:120374670-120374692 AAGGCAAAGCCACATGAAGAAGG - Intronic
1031486076 7:122327045-122327067 TAGGAAAGTGCTCATTAGGAAGG - Intronic
1032191295 7:129767393-129767415 GAGGGCAGGCCACATGAGGAAGG + Intergenic
1032530828 7:132618246-132618268 GAGGAAAAGCTTCCTGAGGAAGG - Intronic
1032724705 7:134580127-134580149 CAGGAAAAGACTCAGGAGGAAGG - Intergenic
1033218677 7:139513140-139513162 AGGGAAAGATCTCCTGAGGATGG - Intergenic
1034152150 7:148925475-148925497 GAGGAGAGGCAACATGAGGACGG + Intergenic
1034378069 7:150664336-150664358 AAGAAAAGGCCTCAAGAGTCAGG - Intergenic
1035765936 8:2105479-2105501 AAGGCAAGGCCCCATGGAGAAGG + Intronic
1036654614 8:10670104-10670126 AAGAAAAGGTCACATGAGGCTGG + Intronic
1036728579 8:11242014-11242036 AAGGAAAGGCCATGTGAGGATGG + Intergenic
1036776582 8:11617129-11617151 AAGGACAGGGCACATGGGGAAGG + Intergenic
1037122275 8:15303039-15303061 AAGAGAAGGCCTCATGTGGAAGG + Intergenic
1037906398 8:22718301-22718323 CAGGAAAGGGATCAGGAGGATGG + Intronic
1038491915 8:27977527-27977549 AAGAAAAGTCCTCATGGGAAAGG - Intronic
1038628198 8:29215125-29215147 AAGACAGGGCTTCATGAGGACGG - Intronic
1039409941 8:37344609-37344631 AAGGTGAGGCTTCATGAGGCAGG + Intergenic
1039567962 8:38564704-38564726 CAGGGAAGGCCTCATGAGGGAGG - Intergenic
1040946676 8:52892376-52892398 AAGGCAATGACTCATGAGGTGGG + Intergenic
1041708415 8:60871147-60871169 CAGGAAGGACCTCATGAGAAGGG - Intergenic
1043107587 8:76134555-76134577 TAGGAAAGGGCTTGTGAGGAGGG + Intergenic
1043387213 8:79760136-79760158 AAGGAAAGACCTGGTGGGGAAGG + Intergenic
1043771827 8:84212383-84212405 AAATGAAGGCGTCATGAGGACGG - Intronic
1045043277 8:98247771-98247793 CAGGGAAGGCCTCTTGAGCAAGG + Intronic
1048140261 8:131787325-131787347 AAGTAAAGGCCCCATGATAAAGG + Intergenic
1048261407 8:132948516-132948538 AAGGAAAGCTCTCATAGGGAGGG + Intronic
1049310437 8:141931257-141931279 AAGGAGAGGCCTGGGGAGGAGGG + Intergenic
1049402244 8:142433630-142433652 CAGGACAGGCCTCATGAGTGGGG + Intergenic
1049434708 8:142581151-142581173 AAGGAGGGGCCTCATGAGTGCGG + Intergenic
1049623806 8:143611271-143611293 CAGGAAAGGCCTCCTGGAGAGGG - Intergenic
1049769017 8:144370932-144370954 AGGGAAAGGCCACATGAAGGTGG - Intergenic
1049923982 9:391218-391240 CAGAAAAGGCCTCTTGGGGATGG - Intronic
1050839388 9:10128143-10128165 AAGCAAAGGACTCATGTGGAAGG - Intronic
1051675475 9:19554152-19554174 GAAGAAAGGCCACATGAAGATGG + Intronic
1051814692 9:21091686-21091708 AAGGAAAGGTGTAATGAGGCAGG + Intergenic
1053386616 9:37696206-37696228 CAGGAAAGGCCTCTTAAAGAAGG - Intronic
1054734861 9:68740741-68740763 AAGGAAATACGCCATGAGGAAGG - Intronic
1057727700 9:97579856-97579878 CAGGAAAAGCCTCTTGGGGAGGG + Intronic
1057972468 9:99571063-99571085 AAGGAAAGGCCCCATGAAGAAGG + Intergenic
1058449561 9:105083489-105083511 AAGGAAATTCCTCGTGAGGAAGG + Intergenic
1059882378 9:118705834-118705856 AAGGAATGGCCTCTTCAGAATGG - Intergenic
1061090083 9:128421320-128421342 CAGGGAAGGCCCCAAGAGGAAGG - Intronic
1186897005 X:14013625-14013647 GGGGAAAGGCCACATGAAGATGG + Intronic
1186969044 X:14820032-14820054 AAGGAAAGGCTGCATCATGAAGG - Intergenic
1187084002 X:16022743-16022765 AAGGAAATGACTCATGGGGAAGG - Intergenic
1187472927 X:19585531-19585553 AAGGGAAGGCTTCCAGAGGAGGG + Intronic
1187498251 X:19814661-19814683 CAGGAAAGGCCTCATGAAAAAGG - Intronic
1187981857 X:24765605-24765627 CAGGAAAGGTCTCATCAAGAAGG - Intronic
1188822346 X:34790620-34790642 AATGATAGGGATCATGAGGATGG + Intergenic
1189082296 X:37987613-37987635 AAGGAAAGGCTTTATTAGGAGGG + Intronic
1189091580 X:38089000-38089022 CAGGAAAGGCCTAATGGGGAAGG + Intronic
1189433410 X:40969667-40969689 CAGAAAAGGTCTCATGAGGCAGG - Intergenic
1189612065 X:42747635-42747657 TAGGAAAGGCCTCATGGAGAAGG - Intergenic
1189722383 X:43933386-43933408 CAGGGAAGGCCTCATGGAGAGGG + Intergenic
1190275309 X:48895547-48895569 CAGGAAAGGCCTCTTGAAGGAGG + Intronic
1192433620 X:71128829-71128851 AAGGACTGGCCTTCTGAGGAAGG - Intronic
1192697946 X:73437888-73437910 CAGGAAAGTGCTCAAGAGGAAGG - Intergenic
1193181506 X:78463616-78463638 AAGGAAAAGCCTCATGACATTGG - Intergenic
1193355191 X:80512221-80512243 GAGGAGGGGCCTCATGAGGAAGG + Intergenic
1195737746 X:108031187-108031209 CAGGGAAGGCCTCATGAAGGAGG + Intergenic
1196135171 X:112200914-112200936 AGGGAAAGGAATAATGAGGAAGG + Intergenic
1196756428 X:119161330-119161352 AAAGAGAGGCCAAATGAGGAAGG + Intergenic
1196935618 X:120727740-120727762 AAGAAAAGGGCTTATGTGGAGGG + Intergenic
1197894072 X:131292239-131292261 ACGGCAAGACCTGATGAGGAGGG + Intronic
1198141924 X:133812997-133813019 AAAGAAAAGCCTCCTGAGAAGGG + Intronic
1198161162 X:134010140-134010162 AAGGAAAGGCTTCATAAAGGAGG - Intergenic
1198164227 X:134037871-134037893 TAGGAGAGGCTTCATGAAGAAGG + Intergenic
1198221830 X:134609706-134609728 AAGGAAAGGCCACGTGAGGCAGG - Intronic
1198249251 X:134863757-134863779 AAGCAAAGGACTCATTAGGCTGG - Intergenic
1198340094 X:135705480-135705502 AATAAAAGGCTTCTTGAGGAGGG + Intergenic
1198343566 X:135738216-135738238 AAGACAAGGCCTCTTGAGGAGGG + Intergenic
1198650506 X:138858583-138858605 ATGGAATGGCCTCATTGGGAAGG - Intronic
1200375820 X:155778942-155778964 AAGGAAAGGGTTAATGAGGGAGG + Exonic
1201577527 Y:15477119-15477141 AAAGAAAGAGCTCATGAGGCTGG + Intergenic