ID: 1077537750

View in Genome Browser
Species Human (GRCh38)
Location 11:3132585-3132607
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1027
Summary {0: 5, 1: 20, 2: 86, 3: 200, 4: 716}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077537750 Original CRISPR CAGTGTGGCTGGAGCAGAGT GGG (reversed) Intronic
900163442 1:1235394-1235416 CCGTGTGGCTGAGGAAGAGTTGG - Intergenic
900331550 1:2137276-2137298 CAGTGCGGCTGGGGCAAAGCAGG - Intronic
900615972 1:3565812-3565834 GAGCGTGGCTGGAGCAGAGTTGG - Intronic
901155627 1:7136022-7136044 CAGTGTGGCTGGAGAAAAACAGG + Intronic
901155812 1:7137450-7137472 CAGTGTGGCTGGAGAAAAACAGG + Intronic
901245833 1:7730319-7730341 CCGTGTGGCTGGAGCACAGAGGG - Intronic
901324099 1:8356692-8356714 CAGAGTGGGTGGCGCAGAATGGG + Intronic
901376185 1:8841191-8841213 CAATGAGGCTGGAGAACAGTGGG - Intergenic
901634861 1:10665787-10665809 CAGGGTGCCTGGCACAGAGTAGG + Intronic
901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG + Exonic
902068683 1:13712927-13712949 TGGTGTGGCTGGTGCAGAGTCGG - Intronic
902079673 1:13812526-13812548 CAGTGTGGCTGGAGCCTGGTAGG + Intronic
902097511 1:13958807-13958829 CAATGTGGCTGGAGCCAAGGCGG + Intergenic
902108658 1:14059490-14059512 CAGCGTGGCTAGAACAAAGTAGG - Intergenic
902242595 1:15098977-15098999 CAATGTGACTGGTGCAGAGATGG + Intronic
902490919 1:16779819-16779841 CACAGTGGCTGGCACAGAGTGGG + Intronic
902539711 1:17145540-17145562 CAGCGTGGCTGGAGAGAAGTGGG - Intergenic
902630244 1:17700553-17700575 GAGTGTGGCTGGAGCAGGTGCGG + Intergenic
902706190 1:18206650-18206672 CAATGTAGCTGGAGCAGAGTGGG + Intronic
903293504 1:22329303-22329325 CTGAGTGGCTGGAGTAGAGTGGG - Intergenic
903296044 1:22343670-22343692 ATCTGTGGCTGCAGCAGAGTGGG + Intergenic
903320560 1:22540658-22540680 CAGGGTGGCTGGAGCAGAGTGGG + Intergenic
903456706 1:23492447-23492469 CAATGTGACTGGAGCAGGGGAGG - Intergenic
903478159 1:23634664-23634686 CAGTGTGGCTGGAACCCAGCTGG + Intronic
903568387 1:24285869-24285891 CACGGTGCCTGGAGCACAGTGGG - Intergenic
903757776 1:25674711-25674733 TAGTGTGGCTGTGGCAGAGATGG + Intronic
903948970 1:26983006-26983028 CACAGTGGCTGGTGCATAGTAGG + Intergenic
904013470 1:27403582-27403604 GAGAGGGGCGGGAGCAGAGTTGG - Intergenic
904076443 1:27846307-27846329 CAGTGTTTCTGGAGCACAGAGGG - Intronic
904089667 1:27935926-27935948 CCGCGTGGCTGAAGCAGGGTGGG + Intronic
904347111 1:29879693-29879715 CAGAGGGGCTGGTGCATAGTAGG + Intergenic
904372402 1:30058146-30058168 CAGCGTCGCTGGTGCAGAGCTGG - Intergenic
904424388 1:30414186-30414208 CTGTGTGGTTGGAGCATAGGAGG + Intergenic
904593190 1:31626695-31626717 CAGCTTGGCTGGAGCTGCGTGGG + Intronic
905127254 1:35724358-35724380 CAGTGTGGCTGGAGCTCGGTGGG + Intronic
905504537 1:38466756-38466778 TGGTGTGGTTGGAGCATAGTAGG - Intergenic
905699848 1:40003659-40003681 CACTGTGGCTGGTACATAGTAGG - Intergenic
905728293 1:40274551-40274573 CAGTGTGGCTGCACCATAGCAGG + Intronic
906527436 1:46503089-46503111 CAGGGTGGCTGGAGCACAGATGG - Intergenic
906656513 1:47552284-47552306 CCTTGTGGCTGGAGCACAGTGGG - Intergenic
906865262 1:49411328-49411350 CAGTGTGCCTAGAACAAAGTAGG - Intronic
907281548 1:53350293-53350315 CAGTGTGGCTGGAGCATGGTGGG - Intergenic
907313599 1:53553837-53553859 CTGTGTGGCTGGAGCAGAACGGG + Intronic
907470767 1:54672055-54672077 CAGTGTGACTGGAGCCCAGAGGG + Intronic
907607797 1:55836273-55836295 CACTGTGGCTGTAGCAGCCTGGG + Intergenic
908121687 1:60991808-60991830 TGGTGTGGCTGGAGGAGACTGGG - Intronic
908389924 1:63675197-63675219 CACTGTGCCTGGAGCATAGTGGG + Intergenic
908636219 1:66168556-66168578 CACTGTGGCTTCAGCAGTGTGGG + Intronic
909237133 1:73166992-73167014 CAGTGCGGCTAGAACAGAGCAGG - Intergenic
909502644 1:76353175-76353197 CAGGGTGGCTGGAGAGGAGATGG - Intronic
909531429 1:76686035-76686057 CAGGGTGCCTGGTGCATAGTAGG - Intergenic
909761844 1:79298155-79298177 CAGTGTGTCTAGAGTAGAGGTGG + Intergenic
910002174 1:82354247-82354269 CCATGTGGCTATAGCAGAGTGGG - Intergenic
910092479 1:83481372-83481394 CTGCGTGGCTGGAGCAGAGTAGG - Intergenic
910852065 1:91658160-91658182 CAGTATGGTGGCAGCAGAGTTGG - Intergenic
911463738 1:98224210-98224232 CAGTGTGGCTGAAGCATAAAAGG + Intergenic
911807007 1:102222964-102222986 CAGTGTGGCTAGAGTAAAGCAGG + Intergenic
911869565 1:103078188-103078210 CAGCATGGCAGGAGAAGAGTGGG - Intronic
912207342 1:107523218-107523240 CTGTGTGGCTGGAGCAGAACAGG - Intergenic
912232236 1:107807639-107807661 GAGTGTGTATGAAGCAGAGTGGG - Intronic
912348150 1:108985014-108985036 CAGTGGAGGTGGAGCAAAGTGGG - Intronic
912522462 1:110255152-110255174 CACAGAGCCTGGAGCAGAGTAGG + Intronic
912858593 1:113193147-113193169 CTGTATGGCTGGACCATAGTGGG - Intergenic
912949280 1:114109601-114109623 CACAGTGGCTGGCACAGAGTAGG + Intronic
912987320 1:114447001-114447023 CAGTGTAGCTGTAGCAGAGATGG + Intronic
915030627 1:152877785-152877807 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
915113303 1:153578575-153578597 CAGTGTGGCTGGAGCATGGATGG + Intergenic
915704434 1:157830488-157830510 CAGTGGGACAGGAGGAGAGTGGG - Intergenic
915744994 1:158149186-158149208 CAGTGTGGATGGAGAAAAGTGGG + Intergenic
915978916 1:160408219-160408241 CAGGGTGGGTGGAGCTGGGTGGG + Intronic
916486758 1:165266393-165266415 CAGTGTGGCTGGGGCAAAGATGG + Intronic
916573695 1:166048970-166048992 CAGTGTGGCTGGAGTGGAATAGG - Intergenic
916623162 1:166523986-166524008 CAGTGTGGCTGGTGCAGTGGAGG + Intergenic
916665538 1:166963714-166963736 CAGTATGGCTGGAGCATACTGGG - Intronic
916911663 1:169355534-169355556 CAGTGTAACTGGAGCAGAGAAGG - Intronic
917029326 1:170671758-170671780 CAGGGTGGCAGGAGGGGAGTGGG + Intronic
917112593 1:171565150-171565172 CAGTGAGGCTGAAGCATAGCAGG - Intronic
917218441 1:172702265-172702287 CAGTTTGTCTGGAGTGGAGTGGG + Intergenic
917447797 1:175121368-175121390 CAGTTTTGCTGGAGCATAGAGGG + Intronic
917468610 1:175306896-175306918 CAGAGTGGCTGAAGCACAGATGG - Intergenic
918048500 1:180955142-180955164 AAGTGGGGCTGGAGAAGAGCAGG + Intergenic
919784280 1:201249332-201249354 CAGTGGGGCTGGAACAAAGGTGG - Intergenic
919848429 1:201656104-201656126 AGGTTTGGCTGGAGCTGAGTTGG - Intronic
919885163 1:201928361-201928383 TAGTGAGGCTGGAGCAAAGGAGG - Intronic
920055294 1:203186621-203186643 CATTCTGGCTGCAGCAGAGCAGG + Exonic
920185229 1:204155283-204155305 CAGTGTGGCTAGGGGAGAGATGG - Intronic
920193565 1:204211364-204211386 CAGTGTGGTTGGAGCATGGCAGG - Intronic
920364699 1:205441923-205441945 CAGTCTGGCTGGGGAAGAGAGGG + Intronic
920768693 1:208858952-208858974 CAGTGTGGTTGGAGTAAAGTGGG + Intergenic
920776974 1:208948384-208948406 CAGGATGGCTGGTGCAGAGCAGG + Intergenic
920805024 1:209224872-209224894 CAGTGTGGTTGGAGCACAGAGGG - Intergenic
920834189 1:209492868-209492890 CAGTGTAGCTAGAGCTCAGTGGG + Intergenic
920837338 1:209523517-209523539 TAGTGTGTCTGGAACAGAGTAGG + Intergenic
920850716 1:209626411-209626433 CAGTGAGGCAGGGGCAGAGCTGG + Intronic
921056688 1:211547976-211547998 CAGTGTGGCTGAAACAGAGTGGG - Intergenic
921580087 1:216886170-216886192 CAGGTTGGCTGCAGCAGGGTAGG - Intronic
921959991 1:221024523-221024545 CAGTGAGGCTGGGGCAGCATGGG - Intergenic
922764919 1:228151715-228151737 CAGAGCTGCTGGGGCAGAGTGGG + Intronic
922928874 1:229373425-229373447 AAGTGTAGCTGGGGCAGAGCGGG - Intergenic
923054279 1:230413872-230413894 CATAGTGCCTGGTGCAGAGTAGG + Intronic
923071156 1:230565575-230565597 CAGTGAGAGTGGAGCAGGGTGGG - Intergenic
923333352 1:232946177-232946199 CAGTGTGGCCGGAGCAGAGTAGG - Intergenic
923489237 1:234468744-234468766 CAGCAGGGCTGCAGCAGAGTTGG - Intronic
923891204 1:238216741-238216763 CAGTGGGGAAGGAGTAGAGTAGG + Intergenic
923958639 1:239051776-239051798 CAGTGTGGTTGGGGCAGAGTTGG + Intergenic
924825420 1:247533129-247533151 CAGAGTGGCAGGAGCAGGGGTGG - Intronic
924924112 1:248661707-248661729 CAGGATGGCTGGAGCAGTGAGGG + Intergenic
1062942879 10:1438050-1438072 CAGAGTGGCTGAAGCAGGGTGGG + Intronic
1063785723 10:9380621-9380643 CAGCGTGGCTGGAACAAAGCAGG + Intergenic
1063990999 10:11563070-11563092 CAGTATGGATGTACCAGAGTTGG - Intronic
1064367057 10:14717638-14717660 CAGTGTGGCTAGAACAAAGCAGG - Intronic
1064468916 10:15615190-15615212 CAGAGCTGCTGGAGCAGAATGGG - Intronic
1064980647 10:21163119-21163141 CAGTGTGGCTGGAGAGAAGGAGG + Intronic
1065052283 10:21807351-21807373 CAGTGTGGTTAGAGCACAGTGGG - Intronic
1065204054 10:23341686-23341708 CAGTGTGGCTGGAGCAGAGAGGG - Intronic
1066472380 10:35711738-35711760 CAGGGTTCCTGGAGCAGCGTTGG - Intergenic
1066981682 10:42422463-42422485 CAGTGTAGCTGAAGGAGAGATGG - Intergenic
1067073869 10:43161517-43161539 CAGTGTACCTGGAACACAGTAGG - Intronic
1067224198 10:44364694-44364716 CAGTGTGGCTGGAGCAGAGAGGG + Intergenic
1067281546 10:44877102-44877124 CTGTGCTGCTGGAGCAGGGTGGG - Intergenic
1067687479 10:48475899-48475921 CAGTGTGGCCAGAGCAGAGTGGG - Intronic
1068003882 10:51370088-51370110 CAGAGTGGCTGGAGCATCATAGG + Intronic
1068280704 10:54865212-54865234 CAGTGTGGCTAGAACAAAGCAGG + Intronic
1068984675 10:63096093-63096115 AAGTGTGTCTGGGGCAGAGGAGG + Intergenic
1069377849 10:67812236-67812258 CAGTGTGGCTGGAGGACACAAGG + Intronic
1069507986 10:69018841-69018863 CAGTGTGGCTGGAGCAGATAAGG + Intergenic
1069605022 10:69733396-69733418 CAGTGTGGCTGGGGTGTAGTTGG + Intergenic
1069720630 10:70547469-70547491 AAGGGTGGCTGGGGCAGGGTGGG - Intronic
1069752743 10:70754612-70754634 CAGTGGGGCTGGAGCTGACTGGG + Intronic
1069799419 10:71072885-71072907 CAGAGTGCCTGGAGCAAAGCCGG + Intergenic
1070675821 10:78410565-78410587 CAGTGTCTCAGGAGGAGAGTGGG + Intergenic
1070891420 10:79944547-79944569 CTATGTGGTTGGAGCTGAGTAGG + Intronic
1071187870 10:83064337-83064359 AAGTGTGCCTGAGGCAGAGTGGG + Intergenic
1071450530 10:85788485-85788507 CAATGTGGCTGGCCCACAGTGGG + Intronic
1071573011 10:86708260-86708282 GAGTGGGGCTGGAGCAGAAGGGG + Intronic
1071876155 10:89845457-89845479 CTGTGTGGCTGGAACACAGGTGG + Intergenic
1071958730 10:90787156-90787178 CAGTGTGTCTGGCACATAGTAGG - Intronic
1072210948 10:93246670-93246692 CAGTGTGTCTGGGGCAGAGGTGG + Intergenic
1072945385 10:99805200-99805222 GGGTGCGGCAGGAGCAGAGTGGG + Intronic
1073324924 10:102637095-102637117 CAGTGTAGGTGCAGCAGAGTGGG + Intergenic
1073325709 10:102643233-102643255 CGGGGTGGGTGGAGCAGAGGTGG + Intergenic
1073788449 10:106915558-106915580 CAATGTGACTAGAGTAGAGTGGG - Intronic
1073957442 10:108889661-108889683 CAGTGCGGCTGGAACAAAGCAGG - Intergenic
1074128135 10:110546643-110546665 CAGGATGCCTGGAACAGAGTAGG + Intergenic
1074904540 10:117849865-117849887 TAGTGTGGGTGGAGCAGGGATGG + Intergenic
1075193235 10:120330576-120330598 AGGTTTGGCTGGAGCAGAGTGGG - Intergenic
1075259127 10:120947911-120947933 CCGTGTGGCTGGAGCAAAAAAGG - Intergenic
1075383384 10:122037208-122037230 CGGTGTGGCTGGAGAAAAGTGGG + Intronic
1075680160 10:124325768-124325790 CAGAGTGACGGGAGCAGTGTGGG - Intergenic
1075990529 10:126834774-126834796 CAGAGATGCTGGGGCAGAGTGGG - Intergenic
1076873942 10:133206835-133206857 ACCTGTGGGTGGAGCAGAGTGGG - Exonic
1076940394 10:133602778-133602800 TAGTGTGGCTAGAACAAAGTAGG + Intergenic
1077179548 11:1206146-1206168 CAGGGTGGCTGGACCAAGGTGGG + Intergenic
1077197301 11:1287857-1287879 CAGGGAGGCTGCAGCAGAGAGGG - Intronic
1077497881 11:2895319-2895341 CAGGGTGCCTGGAGCAGGGAAGG + Intronic
1077537750 11:3132585-3132607 CAGTGTGGCTGGAGCAGAGTGGG - Intronic
1077594398 11:3519243-3519265 CAGAGTGGCTGAAATAGAGTAGG - Intergenic
1077603016 11:3586908-3586930 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1077693693 11:4373684-4373706 CAGTGTGCCTGGCACAGGGTAGG + Intergenic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1077883972 11:6372201-6372223 GACAGTGGCTGGAGCAGAGTGGG - Intergenic
1077900833 11:6487104-6487126 CAGTGTGGCCAGAGCACAGAGGG - Intronic
1078251071 11:9617010-9617032 CAGTGTGACAGGAGTGGAGTGGG + Intergenic
1078476901 11:11638181-11638203 CACTGTGCTTGGAGCAGAGTGGG + Intergenic
1079633303 11:22705201-22705223 CAGTGTGGCTGCAACAAAGTCGG - Intronic
1080149905 11:29039522-29039544 CAGTGTAGCTAAAGCACAGTGGG - Intergenic
1080319309 11:30987969-30987991 CTGGGAGGCTGGAGCAGTGTGGG + Intronic
1080319362 11:30988542-30988564 CTGGGAGGCTGGAGAAGAGTGGG - Intronic
1080708134 11:34718780-34718802 CAATGTGGCTGGAGCAGAACAGG + Intergenic
1081427251 11:42938846-42938868 CAATGTGGCTAGAGCAGAGTTGG - Intergenic
1081438940 11:43058857-43058879 AATTGTGCCTGGAGCACAGTGGG + Intergenic
1081455915 11:43222514-43222536 CTGTGTGGCTAAACCAGAGTGGG - Intergenic
1081486202 11:43531481-43531503 CAGTGTGCCTGGTACAGAATAGG + Intergenic
1081721224 11:45290198-45290220 CAGTGGGGATGGAGCAGCGGTGG + Intergenic
1082000141 11:47389708-47389730 CACTGGGGCTGGGGCAGAGTGGG - Intergenic
1082759262 11:57110943-57110965 CTGTGTGGCTGGAGAAGGGAAGG - Intergenic
1083019203 11:59489052-59489074 CAGTGTGGTTGGCACAGAGTGGG - Intergenic
1083213754 11:61205693-61205715 CAGTGTGGCGGGAACAGAGCCGG + Intronic
1083216639 11:61224522-61224544 CAGTGTGGCGGGAACAGAGCCGG + Intronic
1083219521 11:61243348-61243370 CAGTGTGGCGGGAACAGAGCCGG + Intronic
1083763915 11:64833195-64833217 GACCGTGGCTGGAGCATAGTGGG + Intronic
1083829089 11:65219644-65219666 CCCTGTGGCTGAAGCAGAGTTGG + Intergenic
1083855903 11:65392981-65393003 CAAGGTGGCAGGAGCAGAGTGGG + Intronic
1083937290 11:65876564-65876586 CACTGTGGCTGGCACAGAGTGGG - Intergenic
1084177005 11:67428216-67428238 GAGTTTGGATGGAGCAGGGTCGG - Intergenic
1084209635 11:67615046-67615068 GAGTGGGGCTGGAGCACAGGTGG - Intergenic
1084250248 11:67892520-67892542 CAGAGTGGCTGAAATAGAGTAGG - Intergenic
1084258896 11:67961446-67961468 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1084453919 11:69256550-69256572 CAGAGAGGCTTAAGCAGAGTGGG - Intergenic
1084647382 11:70466329-70466351 CCCTGTGGGTGGAGCAGATTCGG + Intergenic
1084794709 11:71497352-71497374 CAGAGAGGCAGGAGCAGAGGTGG - Intronic
1084813851 11:71633732-71633754 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1084822543 11:71702826-71702848 CAGAGTGGCTGAAATAGAGTAGG + Intergenic
1085645595 11:78220300-78220322 CAAGGTGCCTGGAGTAGAGTTGG - Exonic
1086067038 11:82756558-82756580 CTGTGTGGCTGGGGCAGGGTTGG + Intergenic
1086551660 11:88059644-88059666 CACTGTGCCTGGAACACAGTAGG - Intergenic
1087286587 11:96270923-96270945 CAGTGTGGCTAGAGTAAAGCAGG + Intronic
1087552688 11:99672164-99672186 CAGTTTTGATGGGGCAGAGTAGG - Intronic
1087660851 11:100986394-100986416 CATTGTGACTGGAGTAGAGTAGG + Intronic
1087825035 11:102755367-102755389 CAATGTGGCTGGAGCAGAGTGGG + Intergenic
1088212640 11:107473557-107473579 CAGTGAGGCTGGAATAAAGTAGG - Intergenic
1088456074 11:110034307-110034329 CTGTGTGACTGGAGCTGTGTGGG - Intergenic
1088995869 11:114996326-114996348 GAGTGTGGCTGAGGCAGAGTGGG - Intergenic
1089296791 11:117474105-117474127 CAGTGTGCCAGGTGCAGCGTTGG + Intronic
1089371040 11:117957838-117957860 CAGTGTGGCTGGAATAAAGCAGG - Intergenic
1089464793 11:118678100-118678122 CTGTGTGATTGGGGCAGAGTGGG - Intronic
1089466844 11:118691005-118691027 CTGTGTGACTGGGGCAGAGTGGG - Intergenic
1089611658 11:119672725-119672747 GAAAATGGCTGGAGCAGAGTGGG - Intronic
1089676337 11:120092537-120092559 CAGTGTGGCTGGTGCAGAGAGGG + Intergenic
1089778769 11:120858177-120858199 CAGTGTGGCTGGGGCGGGGTTGG + Intronic
1090350610 11:126105534-126105556 CAGTGTGCTTGGAGCAGAGCAGG - Intergenic
1090572491 11:128062643-128062665 CAGGGTGGCAGGAGCAAAGATGG + Intergenic
1091671652 12:2456516-2456538 CAGTGTGGCTGGAGCAGGGCAGG - Intronic
1092209554 12:6637521-6637543 GAGTGTGGCTGGAGCCCAGGAGG + Intergenic
1092420571 12:8328032-8328054 CAGAGTGGCTGAAATAGAGTAGG - Intergenic
1092430222 12:8402454-8402476 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1092560280 12:9605498-9605520 CAGCATGCCTGGTGCAGAGTAGG + Intronic
1092650781 12:10632439-10632461 CAGTGTAGCTGGAGCCAAGTGGG + Intronic
1092912762 12:13162555-13162577 CAATGAGGCTGGAGCTGAGAGGG - Intergenic
1092919963 12:13222379-13222401 GGGTGTGGCTGGAGGAGGGTTGG + Intergenic
1093687691 12:22076012-22076034 CACTGTGGCAGCAGCAGTGTGGG + Intronic
1094042665 12:26133884-26133906 CAGTGGAGCTGGTGCTGAGTTGG + Intronic
1094084385 12:26573761-26573783 CAGTGTGGATGGAGCAGAGTTGG + Intronic
1094436841 12:30430269-30430291 CAGTGTGGCTGGTGCCCAGTGGG - Intergenic
1094472071 12:30812147-30812169 CAGTGTGGCTAGAACAAAGCAGG - Intergenic
1094554288 12:31482996-31483018 CATTGTTGCTGGAGCAGAGTGGG - Intronic
1095559161 12:43545109-43545131 CAGTGGGGAAGGAGAAGAGTGGG - Intronic
1095577439 12:43757015-43757037 CAGAGTAGCTGGAGTATAGTGGG - Intronic
1095939063 12:47713931-47713953 CAGTGAGGCTGGAGCAGGAGGGG + Intronic
1095991704 12:48039233-48039255 CATTGTGGCTGAGGCAGAGTGGG + Intergenic
1096189927 12:49609820-49609842 GAGTGGGGCTGGACCAGAGCAGG - Intronic
1096311394 12:50524451-50524473 CAATGTGGCTGAAGCACAATGGG - Intronic
1096423954 12:51485050-51485072 CTGTGTGTTTGGAGCAGAGTGGG + Intronic
1096480063 12:51934216-51934238 CAGAGTGGCTGGAGGGGTGTGGG - Intergenic
1096874196 12:54614513-54614535 CAGTGGGGCTGGAGAAGAGAAGG + Intergenic
1096876583 12:54634526-54634548 CAGTGTAGCTGAGGCATAGTGGG + Intronic
1096878394 12:54647993-54648015 CAGAGTGGTTGGAGCAGAGTGGG + Intronic
1096977015 12:55705266-55705288 GTGTGTGGCTGGACCAGAGGTGG - Intronic
1097156637 12:57016613-57016635 CAGGGTGGCTGGAGGGGAGGCGG + Intronic
1097259688 12:57711121-57711143 CTGTGGGGCTGGAGCAGGGATGG - Intronic
1097269586 12:57765847-57765869 GAGTGTGGGTGAAGCAGACTGGG + Intronic
1097285622 12:57874942-57874964 CAGTGTGGCTGGAGCAATGTAGG + Intergenic
1098908862 12:76188950-76188972 CAGTGTAGCTGGAGAAAAGTAGG - Intergenic
1099220840 12:79912023-79912045 CAGTGTGACTGGAGCACAGGGGG - Intronic
1099338516 12:81396497-81396519 CAGTGTGGCTGGGGTGGATTTGG + Intronic
1099736457 12:86572729-86572751 CAGTGTTGATGTAACAGAGTGGG - Intronic
1099888564 12:88561743-88561765 CAGTGTGGCTAGAGCATGGTGGG - Intronic
1099993946 12:89756256-89756278 CAGTGTGGCTGGGACAGGGTGGG + Intergenic
1100100243 12:91094739-91094761 CAGTGTGTTTGGAGAGGAGTGGG + Intergenic
1100904515 12:99282300-99282322 CAGTGTGGCTGGAGCAAAGTGGG + Intronic
1101319190 12:103658345-103658367 CAGTGTGGCTCGAACAGGGTAGG - Intronic
1101612647 12:106305055-106305077 CAGTTTGGCTGGAGAAAATTTGG - Intronic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1102222416 12:111203587-111203609 CCATGTGCCTGGAGCAGAGTGGG + Intronic
1102443236 12:112979400-112979422 AAGTGTGGCAGCAGCAGAGAAGG - Intronic
1102459084 12:113089203-113089225 CAGGGTGGCTGGAGTGGAGTGGG + Intronic
1102579777 12:113879030-113879052 CAGTGTGGCTGCAGCTGTGGTGG + Intronic
1102796639 12:115694792-115694814 AGGTGTGGCTGGAACACAGTAGG + Intergenic
1102926244 12:116828601-116828623 CATTGTGTCTGGTGCATAGTAGG + Intronic
1103445083 12:120989179-120989201 CAGAGTGCCTGGCGCAGAATAGG - Intronic
1103542135 12:121673321-121673343 GTGTGTGGCTGGAGCAGAGACGG - Intergenic
1103961062 12:124609632-124609654 CAGTGTGGCTGGACCTGGGTCGG - Intergenic
1104002424 12:124868721-124868743 GGATGTGGCTGGAGCAGAGTGGG - Intronic
1104678090 12:130729367-130729389 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
1104849419 12:131864224-131864246 CCCTGTGCCTGGAACAGAGTAGG - Intergenic
1105277937 13:18947113-18947135 CAGTGGGTGTGGAGCAGAGAGGG + Intergenic
1105665582 13:22552339-22552361 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1106862346 13:33923431-33923453 TAGTGTGGCTGGTGCATAGTTGG + Intronic
1107707641 13:43123164-43123186 TAGGGGGGCTGGAGCAGAGTGGG - Intergenic
1107897998 13:44985259-44985281 GAATGTGGATGGAGCAGATTTGG - Intronic
1108243694 13:48493594-48493616 CGGTGTGGAGGGAGCACAGTGGG - Intronic
1108621378 13:52187711-52187733 CAATTTGGCTGGAACACAGTGGG - Intergenic
1108665262 13:52623834-52623856 CAGTTTGGCTGGAACACAGCGGG + Intergenic
1108782835 13:53857650-53857672 CAGTGTGGCTAGAGCAGATTGGG + Intergenic
1108863683 13:54895513-54895535 CACTGTAGCTGGAGCAGACTTGG - Intergenic
1109123595 13:58489015-58489037 CAGTGTGGCTGAGGCTGAGTGGG + Intergenic
1110425035 13:75357481-75357503 CAGTGTGGCTGGAGTTGGGGAGG - Intronic
1110533672 13:76626706-76626728 CAGTGTGGCTAGAGTACAGAGGG - Intergenic
1111168253 13:84491490-84491512 CAGGATGGGTGGGGCAGAGTGGG - Intergenic
1111947696 13:94682814-94682836 CAGTGTGGCTGGACCATTGTGGG + Intergenic
1112128925 13:96499739-96499761 CAGTGTGGCTGAAGCTGAGTGGG + Intronic
1113056707 13:106275835-106275857 CAGTCAGGGTGGAGCGGAGTTGG + Intergenic
1113181931 13:107638841-107638863 TAGTGAGGCTGGAGAACAGTGGG + Intronic
1113218796 13:108074311-108074333 CAGTGTGGCTGGAACAAAGCAGG - Intergenic
1113351687 13:109535735-109535757 GAGGGTGGCTGAAGCAGAGTGGG + Intergenic
1113745715 13:112742736-112742758 CAGTGTGGCTGGATCTCAGGGGG + Intronic
1113760998 13:112846622-112846644 CACTGTGGCTGGTCCAGAGCTGG - Intronic
1114450322 14:22821283-22821305 CAGTGAAGCTGGAGTGGAGTGGG - Intronic
1116359552 14:43976175-43976197 AAAAGTGGCTGGATCAGAGTTGG - Intergenic
1116783613 14:49264798-49264820 CAGAGTGTCTGAAACAGAGTAGG - Intergenic
1117294992 14:54370937-54370959 CAGTGTGGGAGGAGCTGACTGGG - Intergenic
1117359571 14:54959736-54959758 CACTCAGACTGGAGCAGAGTTGG - Intronic
1117753907 14:58954255-58954277 CAGTGTGGCTGGTGCACAGGTGG - Intergenic
1117830029 14:59741132-59741154 AAGTGTGGCAGGATCAGACTTGG - Intronic
1118026253 14:61772135-61772157 CACCGTGGCTGGAGCGCAGTAGG + Intronic
1118048967 14:62005195-62005217 CTGTTTGGCTGGAGTAGAGCAGG + Intronic
1118097745 14:62557651-62557673 CACTGTGCTTGGAGCAGAGCAGG + Intergenic
1118252089 14:64171677-64171699 CAGTGTGACTGGCGCAGAGCTGG + Intronic
1119004676 14:70912797-70912819 CAGTGTGACTACAGCACAGTGGG - Intronic
1119068077 14:71550970-71550992 CAGTGTGGCTGGAGAGGAAAGGG - Intronic
1119068163 14:71551748-71551770 CAGTGTGGCTGGAGGGGAAAGGG - Intronic
1119477239 14:74937930-74937952 CAGTGTGGCTGGAGCATGATGGG - Intergenic
1119615951 14:76099323-76099345 GAGTGAGGCCGGAGCGGAGTCGG - Intergenic
1119664015 14:76471514-76471536 CAGGGAGGCTGGAGCAGAGTGGG - Intronic
1119827129 14:77666577-77666599 CAGTGTGGCTGAGACAGAGTGGG + Intergenic
1120159641 14:81131550-81131572 CAGTGTTGCTGGTGCTGAGACGG - Intronic
1120515763 14:85468452-85468474 CAGAGTGACTGGAGCAAAGAAGG + Intergenic
1120823618 14:88935452-88935474 CAGAGTGGCTGGAGAGGAGAAGG - Intergenic
1121011401 14:90522279-90522301 CGGTGTGCCTGGTGCACAGTGGG + Intergenic
1121230672 14:92355277-92355299 GAGTGTGGCTGGAGCGGGGTGGG + Intronic
1121240596 14:92427337-92427359 CAGTGTGGCCAGAGTAGAGTGGG + Intronic
1121288456 14:92755097-92755119 CATTGTGGCTGGAGTGGAGCAGG - Intergenic
1121484651 14:94305295-94305317 CAGTGTGTCTTGAGCAGATGAGG + Intronic
1122385391 14:101341828-101341850 CAGTGTGGCTGCAGCAAAGGAGG - Intergenic
1122724126 14:103739454-103739476 CAGTGTTGACGGAGCAGAGAGGG - Intronic
1124014967 15:25866172-25866194 CGGGGTAGCTGGAGCTGAGTGGG + Intergenic
1124045068 15:26141150-26141172 AAGTGTGGCTGGAGCTGATTTGG + Intergenic
1124318274 15:28691857-28691879 CACTGAGGCTGGAGTACAGTGGG - Intergenic
1124401125 15:29348458-29348480 GCGTGTGGCTGGAGCTGAGCTGG + Intronic
1124454352 15:29827009-29827031 CAGTGGCAGTGGAGCAGAGTGGG - Intronic
1124565166 15:30805600-30805622 CACTGAGGCTGGAGTACAGTGGG + Intergenic
1124682050 15:31740246-31740268 CTGAGTGCCTGGAGCAGAGGTGG + Intronic
1124685898 15:31781698-31781720 TTGTGTGGCTCGAGCAGAGATGG - Intronic
1124805538 15:32878226-32878248 CCGTGTGGCTGGAGTTTAGTGGG + Intronic
1124922508 15:34040121-34040143 CACTGTGCCTGATGCAGAGTAGG - Intronic
1125168435 15:36738537-36738559 CAGAATGGCTGTTGCAGAGTGGG - Intronic
1125540158 15:40465650-40465672 TAGAATGGTTGGAGCAGAGTTGG + Intronic
1125863556 15:43020723-43020745 CAGTATGGCTGGAACATAATGGG - Intronic
1126235000 15:46373407-46373429 TAGTCTGGCTGAAGCAGAGGAGG - Intergenic
1126313253 15:47340152-47340174 CTGCGTGGATGGAGCAGAGTAGG + Intronic
1126415824 15:48416502-48416524 AAGTGTGGCTGGAAGAGATTTGG + Intronic
1127016650 15:54696165-54696187 CAGTTTGGCTGCAGCATAGTTGG - Intergenic
1127172907 15:56322194-56322216 CAGTGTGGATAGAGAGGAGTAGG + Intronic
1127862821 15:63008653-63008675 CAGTGTGACAGGAGCTGAGATGG + Intergenic
1127864195 15:63018558-63018580 CATTGTGCCTGGCACAGAGTAGG + Intergenic
1127916063 15:63456330-63456352 CTGTGTAGATGCAGCAGAGTAGG + Intergenic
1128102048 15:65010110-65010132 TGGTGTGGCTGGAGCATAGCTGG - Intronic
1128506489 15:68276814-68276836 CAGTGTGGCTGCAGCAGAGTGGG - Intergenic
1128525004 15:68406356-68406378 CAGTATGGCTGGAGGAGAGGAGG - Intronic
1128831304 15:70771881-70771903 CAGTGTGGCTGGAGCATAGTGGG + Intergenic
1129062422 15:72870886-72870908 AAGTGTGGCTGGTGCAGGGCTGG - Intergenic
1129449459 15:75642338-75642360 TATCTTGGCTGGAGCAGAGTGGG + Intronic
1129503687 15:76063410-76063432 CAGTGTGGATGGAGCAGAATAGG - Intronic
1129993874 15:79988088-79988110 CAGTGTGTCTGGTGCAGATATGG - Intergenic
1130159722 15:81386506-81386528 CAGTGTGGCCAGAGCAGGGTAGG - Intergenic
1130830359 15:87592662-87592684 GAGTGTGGCTTGAGCAGGGCAGG - Intergenic
1130891656 15:88138560-88138582 CAGTGTGGCTGAAGAGGAGGAGG - Intronic
1131371537 15:91885954-91885976 CAGTGTGTCTCTAGCAGAGAGGG + Intronic
1132343101 15:101090322-101090344 GATCGTGGCTGGGGCAGAGTGGG + Intergenic
1132345104 15:101103361-101103383 CAGTGTGGCTGTGGCACAGCTGG - Intergenic
1132670078 16:1098931-1098953 CTGTGGGGCTGGAGCAGACACGG + Intergenic
1132929329 16:2450977-2450999 CAGTGGGGCTGGGGCAGACAGGG - Intronic
1133282648 16:4675992-4676014 CGGTGGGGCCGGAGCATAGTTGG + Intronic
1133359287 16:5161086-5161108 CAGAGTGGCTGAAATAGAGTAGG - Intergenic
1133365965 16:5210419-5210441 CAGTCTGGCTGGAGGACAGTGGG - Intergenic
1133747977 16:8701907-8701929 CAGTGTGGCTGGAGCAGAGCAGG + Intronic
1133772938 16:8878248-8878270 CAATGTGGCTGGAGTAGGGAGGG + Intergenic
1133905874 16:10021764-10021786 CAGTGGGGCTGGAGCAAATGAGG + Intronic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1133996929 16:10755274-10755296 CTTTGTGGCTGGAGCTGATTGGG + Intronic
1134066024 16:11228887-11228909 CAGTGTGCCTGGCGCGGAGCAGG - Intergenic
1134362744 16:13546940-13546962 CAGTGTGGCTGTAGCACAGCAGG - Intergenic
1134665229 16:16013881-16013903 GTGTGTGGCTGGAGCAGAGATGG + Intronic
1135232412 16:20721530-20721552 CTGTAGTGCTGGAGCAGAGTAGG + Intronic
1135315848 16:21443774-21443796 CAGTGCAGCTGGAGCAGGATAGG + Intronic
1135368774 16:21876035-21876057 CAGTGCAGCTGGAGCAGGATAGG + Intronic
1135443043 16:22495107-22495129 CAGTGCAGCTGGAGCAGGATAGG - Intronic
1135486538 16:22870595-22870617 CAGTGTTGCTGGAACAGAACAGG - Intronic
1135780223 16:25293532-25293554 GAGTGTGGCTGAAGCAGAGATGG + Intergenic
1135961924 16:27002132-27002154 CAGTGTGGCTGGAAGAGAATAGG + Intergenic
1136012465 16:27372696-27372718 CACTGTGGCTGGGGGAGAGAAGG - Intergenic
1136092030 16:27927522-27927544 TTGTGTGGCTGGAGCACAGTGGG - Intronic
1136312528 16:29422524-29422546 CAGTGCAGCTGGAGCAGGATAGG + Intergenic
1136325958 16:29524257-29524279 CAGTGCAGCTGGAGCAGGATAGG + Intergenic
1136440647 16:30264241-30264263 CAGTGCAGCTGGAGCAGGATAGG + Intergenic
1136940143 16:34515772-34515794 CAGTGTGGCTGGCCCAGATATGG - Intergenic
1136959675 16:34832794-34832816 CAGTGTGGCTGGCCCAGATATGG + Intergenic
1136967856 16:34937168-34937190 CAGTGTGGCTGGTCCAGATATGG + Intergenic
1137342696 16:47625468-47625490 CAGTGTGTCTGGAGCATAACAGG - Intronic
1137501507 16:49014985-49015007 CAGTGTGGCCGGAGCAGAGTGGG + Intergenic
1137523602 16:49214238-49214260 TGGTGTGGATGGATCAGAGTTGG + Intergenic
1137537964 16:49341883-49341905 CTGTGTGGCTGGAGTTCAGTGGG + Intergenic
1137706626 16:50539925-50539947 CACTGTGGCTGGCACACAGTAGG - Intergenic
1137768632 16:50996812-50996834 CAGTGGGGCTGGGGGAGGGTGGG - Intergenic
1137920070 16:52478266-52478288 CAGTGTTTCTGGAGCTTAGTGGG - Intronic
1138001197 16:53281685-53281707 CACTGTGGCTGGAGCATGGTGGG - Intronic
1138197210 16:55060501-55060523 CCATGTGGCTGGAGCAGAGTGGG - Intergenic
1138206000 16:55125493-55125515 CAGTGTGGCCAGAACAGGGTAGG + Intergenic
1138677687 16:58663917-58663939 GAGTGTGGCTGGAGCGGAGAGGG + Intergenic
1139887162 16:70216574-70216596 CAGTGCAGCTGGAGCAGGATAGG + Intergenic
1140455945 16:75105607-75105629 CAGTGTGGCTGGTGCAGAGGAGG + Intronic
1140901579 16:79372810-79372832 CAGTGGGTCTGGAGCTGAGAGGG - Intergenic
1141525554 16:84608932-84608954 CATTGTTTCTGGAGCAAAGTAGG + Intronic
1141679916 16:85537938-85537960 GAGCGTGGCTGGAGCAGGGGTGG + Intergenic
1141715105 16:85722525-85722547 CAGAGTGGCTGGACCTGAGCTGG - Intronic
1142110355 16:88327793-88327815 CAGTGTGGTCGGAGCTGACTAGG + Intergenic
1142208667 16:88796615-88796637 CACAGTGCCTGGAGCATAGTAGG + Intergenic
1142437532 16:90071415-90071437 CACTGTGCCTGGCCCAGAGTGGG + Intronic
1142797625 17:2320890-2320912 TAGTATGGCTGGCACAGAGTGGG - Intronic
1143580419 17:7822344-7822366 CTGCGTGGCTGGAGTGGAGTGGG - Intronic
1143686172 17:8517823-8517845 CAGTGTGGCTGGAGCAGGATGGG - Intronic
1143828431 17:9631595-9631617 CAGTGTGTCTGGGGCTTAGTGGG + Intronic
1143947113 17:10603197-10603219 CAGTGTGGCAGGAACACAGTGGG + Intergenic
1143987551 17:10928018-10928040 CACTGTGGCTGGCTCATAGTAGG + Intergenic
1143999071 17:11035750-11035772 CAGTGGGGCTGGAGCATGGAGGG - Intergenic
1144126848 17:12210754-12210776 CACTGTGGCTGAATCAGAGGAGG - Intergenic
1144330842 17:14222802-14222824 CACTGTGGCTGGAGCAGTGTGGG - Intergenic
1144520388 17:15948768-15948790 CAATGTGGCAAGAGCAGAGAGGG - Intronic
1144537487 17:16105012-16105034 CAGTGTGGTTGGAGCAGAGGGGG + Intronic
1144539858 17:16130385-16130407 CAGGGTGGCTGGAGCAAAAGAGG + Intronic
1144743575 17:17598171-17598193 CAGTGTGGCTGGAGTACAGAGGG - Intergenic
1144743861 17:17600125-17600147 CACTGTTGCTTGAGTAGAGTTGG + Intergenic
1144806083 17:17968761-17968783 CAGTCTGAATGGAGCAGAGGTGG - Intronic
1144831113 17:18131686-18131708 CACCGTGGCTGGAGGAGGGTCGG - Intronic
1144944701 17:18963942-18963964 CAGTGTGGCTGGAGCGGGTGGGG - Intronic
1145414506 17:22703789-22703811 CAGTGCGGCTGGGGTTGAGTTGG + Intergenic
1146017684 17:29246996-29247018 TAGGGTGGCTGGAGAAGAGTGGG + Intronic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1147448407 17:40488895-40488917 CAGAGGGGCTGGAGCAGTGCTGG + Exonic
1147580527 17:41625000-41625022 CACCGTGGGTGGAGCAGTGTGGG - Intergenic
1147584126 17:41643252-41643274 CTGTGTGGCTGGGGTGGAGTGGG + Intergenic
1147667235 17:42156436-42156458 CAGAGGGGATGGGGCAGAGTGGG + Intergenic
1147906017 17:43823548-43823570 CAGAGTGCCTGGCACAGAGTAGG + Intronic
1148511628 17:48175856-48175878 CTGTGTGGCTGGGGCTCAGTGGG + Intronic
1148648383 17:49232053-49232075 CAGCCTGGCTGGTGCACAGTGGG + Intergenic
1148798276 17:50207963-50207985 CAGTGTGGCTGGAGCACCACAGG + Intergenic
1148856620 17:50582480-50582502 CAATGTGGCTTGAGCAGATGTGG + Intronic
1148865149 17:50624428-50624450 CTGTGGGGCTGGAGCAGATGAGG - Exonic
1149004534 17:51791415-51791437 CAGAGTGCCTGGTGCACAGTGGG + Intronic
1149217774 17:54377843-54377865 CAGTGTGGCTGTTGCTGAGTGGG - Intergenic
1149643862 17:58224822-58224844 CTGTGATGCTGGATCAGAGTTGG + Intronic
1150365597 17:64581336-64581358 GAGTGTGGCTGAAGCAGAGTGGG - Intronic
1151295120 17:73179626-73179648 CAGGGTGGATGGAGCAGAGCCGG + Intergenic
1151487554 17:74410744-74410766 CAGGGTGGCTGGGGTAGAGTGGG + Intergenic
1151764378 17:76124601-76124623 GGGCCTGGCTGGAGCAGAGTTGG - Intergenic
1151853397 17:76705012-76705034 CAGTGTGGTTTGAGCCGAGTGGG + Intronic
1151874161 17:76857067-76857089 CATGGAGGCTGGAGCAGAGATGG + Intergenic
1152277038 17:79363911-79363933 CAGGGTGGCTGGAGTGGAGTGGG - Intronic
1152525945 17:80888484-80888506 CTGTGTTGTTGGAGCGGAGTGGG + Intronic
1153181206 18:2435802-2435824 CACTGTGGCTGGAGCAAGATGGG - Intergenic
1153280708 18:3411738-3411760 CAGCGTGGCTGGGGCGGAGTAGG - Intronic
1153827904 18:8893662-8893684 CTGTGTGGCTGGAGGAGAGGAGG + Intergenic
1154245391 18:12692439-12692461 CTGTGTGGCTAGAGCGTAGTGGG - Intronic
1154935939 18:21056792-21056814 CAGTGTGGCTGGAGAGGATTAGG - Intronic
1155674102 18:28408702-28408724 TGGTGTGGCTGGAGTAGACTAGG - Intergenic
1155996060 18:32332635-32332657 CAGGGAGGCTGAAGGAGAGTGGG - Intronic
1157242631 18:46025390-46025412 CAGTGGAGCTGGAAGAGAGTGGG - Intronic
1157411732 18:47468862-47468884 CAATTTGGCTGGAGAAAAGTGGG - Intergenic
1157625235 18:49045408-49045430 CAGTGTGTCTGGGACATAGTTGG - Intronic
1157673312 18:49549148-49549170 CAGGGTGGTTGGACCAGTGTGGG + Intergenic
1157723658 18:49945714-49945736 GAGAGTGGCAGGAGCAGAATGGG + Intronic
1157845465 18:51000125-51000147 CAGAGTGGCTGGAACAAAGCTGG + Intronic
1158253439 18:55516782-55516804 GAGTGTGGCTGGTGTAGAGTGGG + Intronic
1158550421 18:58431070-58431092 CTGTGTGGTTGGAGCAGATGAGG - Intergenic
1158662451 18:59400917-59400939 CCCAGTGGCTGGAGCAGAGCTGG + Intergenic
1158884766 18:61816335-61816357 CAGTGTGCCTGCAGCAGATGAGG - Exonic
1159065008 18:63559928-63559950 CATTGTGGGTGGAATAGAGTGGG + Intronic
1159293801 18:66454938-66454960 CCCTGTGGCTGGAGGAGATTAGG + Intergenic
1159688919 18:71460668-71460690 TAATGTGGCTGGAGCTTAGTGGG + Intergenic
1159904365 18:74076827-74076849 CAGTGTGGCTGGAGCACAGATGG - Intronic
1159997551 18:74980887-74980909 CAGTGTGTCTGGGGCTGAGAAGG - Intronic
1160916835 19:1500799-1500821 TCCTGTGGCTGGAGCAGAGAAGG + Intergenic
1161205550 19:3039384-3039406 CTGTGTGGCTGGAACAGAGGGGG - Intronic
1161313980 19:3609316-3609338 CAGTCTGGAGGGAGCAGAGCTGG - Intergenic
1161407354 19:4097991-4098013 CAGTCTGGCTGGAGAGGAGGAGG + Intronic
1161606811 19:5219645-5219667 GAGAGTGGCTGGAGCAGAGAAGG - Intronic
1161636620 19:5393318-5393340 CCGTGCAGCTGGAGCAGAGAGGG - Intergenic
1161638813 19:5406803-5406825 CAGTGTGGCTGGAGCAGAATGGG - Intergenic
1161751070 19:6097113-6097135 TAGTGGGGGTGAAGCAGAGTGGG + Intronic
1162087845 19:8259362-8259384 CTGTGTGGCTGGAGCAGAGTGGG + Intronic
1162487634 19:10971232-10971254 CAGTGTGGCTGGAGCAGGGAAGG - Intronic
1162550965 19:11357913-11357935 CAGTGTGGATGGGGCAGAGAGGG - Intronic
1163068353 19:14816406-14816428 CAGTGTGGCTAGAATAGAGCAGG + Intronic
1163429919 19:17261216-17261238 CAGTGTGGCTGGAACACAGGGGG - Intronic
1163663092 19:18589963-18589985 CAGAGTGGGTGGAGCATTGTTGG - Intronic
1164695640 19:30241594-30241616 CAGTGTGGCTGGAGTAAAAAAGG + Intronic
1164759124 19:30715063-30715085 CAGAGTGGCGAGAGGAGAGTTGG + Intergenic
1165054065 19:33162552-33162574 CACTGTGGCTTAAGCAGAGAAGG - Intronic
1165387220 19:35517630-35517652 CATTGTGGCTGGAGCAGTGTTGG + Intergenic
1165462349 19:35951577-35951599 CAGTGTGGCTGGCGCACCATGGG + Intergenic
1165830957 19:38729919-38729941 AAGTGAGTCTGGAGCAGAGAGGG - Exonic
1165891235 19:39113502-39113524 CAGTGTGGCTGCAGCAGAGTGGG - Intergenic
1165899391 19:39161758-39161780 CCACGTGGCTGGAGCAGGGTGGG - Intronic
1165984467 19:39755925-39755947 CACTGTGTCTGGAGTAGAGGGGG - Intergenic
1165995338 19:39839941-39839963 CAGGGTGGCTGGAGGACACTTGG + Intronic
1166211098 19:41306927-41306949 CTGAGGGGCTGGAGCAGGGTTGG - Exonic
1166215664 19:41333056-41333078 CAGTGTGGCTGGAGTGGAGTAGG - Intronic
1166219612 19:41355995-41356017 CAGTATGGCTGGAGCCCAGACGG + Intronic
1166268138 19:41697353-41697375 CAGAGTGGCTGGAGCAGAGAGGG - Intronic
1166322513 19:42027418-42027440 CAGCAAGGCTGGAGCAGAATAGG + Intronic
1166552079 19:43672505-43672527 CAGTGTGGCTGGAACAGATTAGG + Intergenic
1166673802 19:44727074-44727096 GATGGTGGCTGGACCAGAGTGGG - Intergenic
1166729375 19:45050121-45050143 CTGTGTGCCTGGAGCAGAGTAGG + Intronic
1167251638 19:48401580-48401602 GAGTGTGGCTGGAGCCCACTGGG + Intronic
1167426513 19:49432463-49432485 CAGCCTGGGTGGAGCAGAGCCGG - Intronic
1167487708 19:49772862-49772884 CTGTGTGGCTGGTGCAGAGAGGG + Intronic
1167654774 19:50756399-50756421 CGGTGTGGCTGGAGCCACGTGGG - Intergenic
1167656455 19:50767478-50767500 CGGTGTGGCTGGAGCCACGTGGG - Intergenic
1167708578 19:51096859-51096881 CAGTGTGGCGGGAACAGAGTGGG - Intergenic
1167882119 19:52468729-52468751 CAGTGTGGCTAGAACAAAGCAGG + Intronic
1167958505 19:53087207-53087229 CTGTGTGACTGGAGCAGAGGGGG + Intronic
1168073562 19:53965980-53966002 CAGCGTGGCCGGGGCAGAGTGGG + Intronic
1168309706 19:55454343-55454365 CACAGTGGCTGGCACAGAGTGGG + Intronic
925066230 2:930739-930761 CGATGTGGCTGGAGCTGAGGTGG - Intergenic
925572491 2:5326528-5326550 CAGTGTGGCTGGGACAAAGCCGG - Intergenic
925644091 2:6018307-6018329 CAGTGAAGCTGGAACAGAGCAGG + Intergenic
926496559 2:13595463-13595485 CATTATGGCTGGAACAGACTAGG - Intergenic
926892552 2:17650533-17650555 CAGAGTGGCTGGTGCAGGGGTGG - Intronic
927388233 2:22561490-22561512 CACAGTGCCTGGTGCAGAGTAGG - Intergenic
927788753 2:25993192-25993214 CAGTGTTGTTGGATGAGAGTAGG - Intergenic
928442256 2:31302307-31302329 CTGTGTAGCTGGAGCATGGTGGG + Intergenic
930257524 2:49109248-49109270 TGGTGTTGCAGGAGCAGAGTGGG + Intronic
930511411 2:52349913-52349935 CAGTGTGGCTGCAACAGAGTGGG - Intergenic
930750582 2:54930768-54930790 CAGCATGCCGGGAGCAGAGTGGG + Intronic
930889035 2:56361666-56361688 CAATGTGGCTGGAACAGAGTGGG + Intronic
932263182 2:70344045-70344067 CAGAGTGGCTGCAGCTGAGATGG + Intergenic
932397781 2:71459986-71460008 CAGTGGGGCTGGAGTAGCCTGGG + Intronic
932497557 2:72153873-72153895 CAGTGTTGCTGAAACAGAGCTGG + Intergenic
932561491 2:72875178-72875200 CAGTGTGGCTGGAATAAAGCAGG - Intergenic
933020803 2:77188601-77188623 CAGTGTGGATGGATCATATTTGG - Intronic
933149677 2:78899211-78899233 CAGTGTGGCTGGGAGAGAGAGGG + Intergenic
933699454 2:85244148-85244170 CAGAGTGGCTGGAGCAGAGTGGG + Intronic
934158778 2:89228333-89228355 CAGTGTGGCAGGAGCAGCTGTGG - Intergenic
934196827 2:89844299-89844321 CAGTGTGGCAGGAGCAGGTGCGG + Intergenic
934208497 2:89954095-89954117 CAGTGTGGCAGGAGCAGCTGTGG + Intergenic
934613383 2:95756609-95756631 CAGGCTGCTTGGAGCAGAGTGGG - Intergenic
934647512 2:96067811-96067833 CAGGCTGCTTGGAGCAGAGTGGG + Intergenic
934840886 2:97623631-97623653 CAGCCTGCTTGGAGCAGAGTGGG + Intergenic
934954455 2:98605934-98605956 CAGTGGGGCTGGAGGAAAGCAGG - Intronic
935499555 2:103821668-103821690 CAGTGTGTCAGGAGCTGAGTGGG - Intergenic
935800300 2:106689137-106689159 CTGTGTGGCTGGATTAGTGTGGG + Intergenic
936432292 2:112475014-112475036 GAATGTGGCTAGAGCAGAGCTGG - Intergenic
936985364 2:118307169-118307191 TAGAGTGTCTGGAACAGAGTGGG + Intergenic
937348548 2:121143707-121143729 CAGTGAGGCTGGAGCAGAGAGGG + Intergenic
937466169 2:122134967-122134989 CATAGTGGCTGGAGCTGAGTGGG + Intergenic
937911775 2:127079066-127079088 CAGTGTGGGTGGGGAAGACTGGG - Intronic
937916007 2:127099021-127099043 CAGGGTGGCCGGGGCAGGGTGGG + Intronic
938798842 2:134741296-134741318 CAGGGTGGCTGGAGTATGGTGGG + Intergenic
938902709 2:135811563-135811585 CAGTGTGGCTGGAGCAATGAGGG + Intronic
939869789 2:147514288-147514310 CAGTGTGCCTGGGACAGACTGGG + Intergenic
940165335 2:150764515-150764537 CAGTGTGGCTGGAAGAGGGGAGG - Intergenic
940427385 2:153545761-153545783 TAGTGTGGCCAGACCAGAGTTGG - Intergenic
940711424 2:157167049-157167071 CAGTGTGGCTAGAACAAAGCAGG + Intergenic
941052118 2:160746840-160746862 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
941264386 2:163341754-163341776 AAGAGTGGTTGGAGCAAAGTTGG + Intergenic
941379579 2:164776342-164776364 CAGTGTTGCTGGAACAAAGTGGG - Intronic
941422528 2:165300671-165300693 CTGAGTGGCTGGAGCAGAGTGGG + Intronic
941790003 2:169541860-169541882 CAGTGTGGCAGGAGTAGATGAGG - Intronic
942188121 2:173444108-173444130 AAGAGTGGGTGGAGCAGAGATGG - Intergenic
942206992 2:173629097-173629119 CAGTGTGGCTGGATATGAGTGGG + Intergenic
942367546 2:175243615-175243637 CAGTGTGACTGAGGCAGAGCAGG - Intergenic
942568534 2:177290189-177290211 GAGTGGGGATGGAACAGAGTAGG + Intronic
943731776 2:191309619-191309641 CAGCGTGGCTGGGGAAGAGAGGG - Intronic
944136636 2:196406680-196406702 CAGAGTGGCTGGAGCATGGCGGG - Intronic
944486996 2:200217426-200217448 CTGTGTGCCTGGAGTAGAGGTGG - Intergenic
945420834 2:209634048-209634070 CGGTGTGGCTGGAGCAAAGATGG - Intronic
946033379 2:216722935-216722957 CCTTGTTGCTGAAGCAGAGTGGG + Intergenic
946459521 2:219856684-219856706 CAGTGTAACTGGAGCATAGGGGG + Intergenic
947078911 2:226373849-226373871 CACTGTGGTTGGAGCACAGCAGG - Intergenic
947275101 2:228381894-228381916 CAGTGTGGCTAGAGCAGAGTGGG + Intergenic
947468572 2:230378359-230378381 CATTGTGGCTGGAGCTTAGCAGG - Intronic
947526416 2:230879258-230879280 GAGTGTGGCTGGAGGGGAGATGG + Intergenic
948197430 2:236106198-236106220 CAGTGTGGCTGGAGCTGGAGAGG + Intronic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948320589 2:237065624-237065646 CATTGTGGGTGGTACAGAGTGGG + Intergenic
1168788079 20:557017-557039 CATTGAGGCTAGAGCACAGTGGG - Intergenic
1168832393 20:853733-853755 CAGCATGGCTGCAGCAGAGTAGG - Intronic
1168857432 20:1018584-1018606 CAGTGGGGCTGGAAAAGAGTGGG - Intergenic
1168962796 20:1880463-1880485 CAGTGTGGCTGAAGCAGAGTGGG + Intergenic
1169005526 20:2204144-2204166 CAGTGTGGCTGGAATGAAGTGGG - Intergenic
1169088835 20:2844836-2844858 CAGTGTGGCTGGAGTGCTGTAGG + Intronic
1169162814 20:3396712-3396734 CGGTATGGCTGGAGCAGAGTAGG + Intronic
1169275336 20:4229970-4229992 CAATGTGGCTGGAACAGAGTAGG - Intronic
1170042095 20:12049798-12049820 GAGTGTGTATGGAGCAGTGTGGG - Intergenic
1170199407 20:13726344-13726366 CAGTGTGGCTGGAGCATTGTCGG - Intronic
1170574628 20:17653061-17653083 AAGTGTGCCCGGAGCAGAGAAGG + Intronic
1170590281 20:17766137-17766159 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1170693742 20:18638583-18638605 CAGTGTGGCTGGAGCTTGGAGGG + Intronic
1170994278 20:21336991-21337013 CAGTGTGGAAGGAGCAGAGGAGG + Intronic
1171462047 20:25303477-25303499 CAGTGTGGGTGGACCAGGCTGGG - Intronic
1171981374 20:31631683-31631705 CAGTGTGGCTGGGGCATGGTGGG + Intergenic
1172041045 20:32046156-32046178 CATTGTGGCTGGAACACAGAGGG - Intergenic
1172282268 20:33716313-33716335 CAGTGTGGCTGGAGCAGCAGAGG - Intronic
1172692239 20:36797918-36797940 CACTGTGGATGGAGCAGTGGGGG - Intronic
1172874419 20:38155700-38155722 TTGTGAGGCTGGAGCACAGTGGG + Intronic
1172972363 20:38882943-38882965 CAGTGTGGCTGAACCAGTGAGGG + Intronic
1173225069 20:41157774-41157796 TAGTGTGGATGGAGCAGAGAGGG + Intronic
1173343369 20:42175302-42175324 CAGTGTGGCTGCAGCCTAGAGGG - Intronic
1173747088 20:45445971-45445993 CAGTGTGGCTGGGGCTGAGTGGG + Intergenic
1173861684 20:46287917-46287939 CAGTGAGGTTGGAGAGGAGTGGG + Intronic
1174066324 20:47868262-47868284 AACTGTGCCTGGAGCACAGTCGG + Intergenic
1174126308 20:48309445-48309467 CAGTGTGGCCACAGCAGAGTGGG - Intergenic
1174159729 20:48542249-48542271 CAGAGTGCCTGGTGCATAGTAGG - Intergenic
1174288394 20:49488846-49488868 CAGTGTGGCTGAAATAGAGCAGG + Intergenic
1174299260 20:49569570-49569592 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
1174308524 20:49632236-49632258 CAGCGTGGCTGGAGTAGAGGGGG - Intergenic
1174361116 20:50029535-50029557 CAGTCGGGTGGGAGCAGAGTGGG + Intergenic
1174392297 20:50225194-50225216 CCATGTGGCTGGAGTAGAATGGG + Intergenic
1174406747 20:50307788-50307810 AAATGAGCCTGGAGCAGAGTAGG + Intergenic
1174426122 20:50432662-50432684 CATTATGGCTGGAGCAGGATGGG - Intergenic
1174514839 20:51083705-51083727 CAGTGTGGCTGGCAGAGAGTGGG + Intergenic
1174578685 20:51555657-51555679 CAGTGGGGCTGGATCAGAAGGGG - Intronic
1174727249 20:52876078-52876100 CAGTGTGGTTGGAGTAGGGATGG + Intergenic
1175105446 20:56611525-56611547 CACTGTGCCTGGCACAGAGTCGG + Intergenic
1175129183 20:56776438-56776460 CAGTGGCGCTGGAGGAGGGTGGG - Intergenic
1175171251 20:57082803-57082825 CGCTGTGGCTGGAACAGAGCAGG + Intergenic
1175665432 20:60854604-60854626 CAGTGCGGCTGGAACAAAGCAGG - Intergenic
1175985810 20:62763725-62763747 CAGAGTGGCTGGAGAGGAGAAGG + Intergenic
1176024030 20:62976834-62976856 CAGTCTGGCTGGATCAGAAGAGG - Intergenic
1176028078 20:62996316-62996338 CAGTGTGTCTGGACCACAGCAGG + Intergenic
1176245096 20:64093633-64093655 CAGTGTGGGGGGGGCAGTGTGGG + Intronic
1176245152 20:64093819-64093841 CAGTGTGGGGGGGGCAGTGTGGG + Intronic
1176419988 21:6506351-6506373 CAGTGTGGCTGGAACAAAGCAGG + Intergenic
1176443408 21:6798744-6798766 CAGCCTGGCGGGAGCAGAGGCGG - Intergenic
1178097805 21:29234551-29234573 AGGGGTGGCTGGAGAAGAGTTGG - Intronic
1178462833 21:32818544-32818566 CAGTGTGGATGCAGCAGGGCAGG - Intergenic
1178798449 21:35767748-35767770 CAGTGTGGCTACAGGAGAGAAGG - Intronic
1178895147 21:36551489-36551511 CAGGGTGGCTGGCACAGGGTAGG + Intronic
1179695479 21:43114671-43114693 CAGTGTGGCTGGAACAAAGCAGG + Intergenic
1180721592 22:17913196-17913218 CAGAGTGGCAGGAGCAGATGAGG - Intronic
1181002356 22:19993875-19993897 CATTGTGGCTGGGGCTGGGTGGG - Intronic
1181020722 22:20100805-20100827 CAGTGTGGGAGGATCGGAGTAGG - Intronic
1181130163 22:20726542-20726564 CTGTGGAGGTGGAGCAGAGTTGG + Intronic
1181153635 22:20903154-20903176 CATTGTGCCTGGCACAGAGTAGG + Intergenic
1181733214 22:24862626-24862648 CACAGTGGCTGGCACAGAGTAGG - Intronic
1181764219 22:25079679-25079701 CACGGTGGCTGCAGCAGACTGGG + Intronic
1181842654 22:25677248-25677270 CAGAGTAGCTGGAGCATAGCTGG - Intronic
1181967350 22:26666508-26666530 CAGTGTGGCAGGAGCAGAGCTGG + Intergenic
1182053018 22:27327714-27327736 CAGTGGAGCTGGAGTAGGGTGGG + Intergenic
1182087394 22:27570738-27570760 CAGCGTGGCTGGAGTGGAGTGGG - Intergenic
1182219814 22:28749245-28749267 CATTGTGGCTGGAGTGGAGAAGG - Intronic
1182269986 22:29147371-29147393 CAGAGTGCCTGGCGCAGAGTGGG - Intronic
1182953934 22:34403191-34403213 CAGTATGGCTAGAGCATAGCGGG - Intergenic
1183049052 22:35246047-35246069 CACTGTGGCTGGGTGAGAGTGGG + Intergenic
1183097334 22:35560932-35560954 CAATGTAGCTGGAGCACAGAGGG + Intergenic
1183692451 22:39398399-39398421 CACTGTGGCTTGCACAGAGTTGG - Intergenic
1183944739 22:41318810-41318832 TGGTGAGGATGGAGCAGAGTGGG - Intronic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1184317337 22:43706176-43706198 CAGTGTTCCTGGAGCCGAGTTGG - Intronic
1184329688 22:43819452-43819474 CAGTGTGGCTGGGCCAGAGAGGG + Intergenic
1184374754 22:44104710-44104732 CAGGGTGGCTGGGGCAGTGAAGG - Intronic
1184783088 22:46658775-46658797 CAGCGTGGCTGGGGCAGACAGGG - Intronic
1185148116 22:49150175-49150197 CTGTGTGGAGGGAGCAGGGTGGG - Intergenic
1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG + Intronic
949660706 3:6275315-6275337 CAGTGTGACTGGAACAAAGCAGG - Intergenic
949669361 3:6380676-6380698 CAGGCTGGCTGGAGCAGAAATGG + Intergenic
949857788 3:8477832-8477854 CAGTGTGCCTGAAGCATTGTAGG + Intergenic
949917207 3:8974423-8974445 CCATGTGGCTGGAGCTGAGGGGG - Intergenic
950076474 3:10190912-10190934 CACTGTGGCTGGGGAAGAGAGGG + Intronic
950129637 3:10533360-10533382 CAGAGTAGCTGGAACATAGTAGG - Intronic
950183704 3:10932426-10932448 GAGTGGGGCTGGTGCACAGTAGG - Intronic
950351410 3:12357296-12357318 CGGCGTGCTTGGAGCAGAGTGGG - Intronic
950552399 3:13674779-13674801 CAGCGTGGCTGAAACACAGTAGG + Intergenic
950874923 3:16263176-16263198 CAGTGTGACCAGAGCAGAGCAGG - Intronic
951931225 3:27969178-27969200 CTGTGTGGTTGGAGCAGAGAGGG - Intergenic
952739065 3:36717915-36717937 CACTGTGCCTGGTGCAGAGTTGG - Intronic
952981036 3:38736182-38736204 CTTTTTGGCTGGAGCAAAGTGGG + Intronic
953399761 3:42602465-42602487 CAGTGTGGCTGGAGTAGAAGAGG + Intronic
953405460 3:42657560-42657582 CAGTGCAGCAGGACCAGAGTGGG + Intronic
953447622 3:42981018-42981040 CAGAGTGCCTGGAGGAGAGATGG + Intronic
953576973 3:44120734-44120756 CAGTGGGGCTGGGGCAGAGTGGG - Intergenic
954343650 3:49977202-49977224 CAGTGTGGCTACAGCAAAATAGG - Intronic
954729181 3:52643313-52643335 CAGTCTGGCTGCAGCCAAGTTGG + Exonic
955503825 3:59611381-59611403 CAGTGTGGCTGGAACACAGTGGG + Intergenic
955829596 3:62986932-62986954 CAGTGGGGCTGGGGCAGAGTGGG - Intergenic
955926644 3:64012643-64012665 CAGGGTGGCTCCAGCATAGTTGG - Intronic
955961579 3:64346317-64346339 CGGTGTGGCTGGAGCACAGTGGG + Intronic
955982454 3:64540655-64540677 CAGTGTGGGGGAAGCAGAGCTGG - Intronic
956108373 3:65845492-65845514 CACAGTGTCTGGAACAGAGTAGG + Intronic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
956425403 3:69129224-69129246 CAGTTAGGATGGGGCAGAGTTGG - Intergenic
956519172 3:70084768-70084790 TAGTGTGCCTGGAACACAGTAGG - Intergenic
956682096 3:71790439-71790461 CAGTGTGGCAGGAGCAGAGCTGG - Intergenic
957017317 3:75083172-75083194 GAGTGGGGGAGGAGCAGAGTGGG + Intergenic
957064533 3:75510608-75510630 CAGAGTGGCTGAAATAGAGTAGG - Intergenic
957073850 3:75585966-75585988 TAGTCTGGCTGGAGGAGAGTGGG + Intergenic
957151888 3:76497066-76497088 CATTGTGGCTGGAGTGCAGTGGG - Intronic
957888151 3:86317643-86317665 CAGTGTGGCTAGAACAGATTAGG - Intergenic
958842025 3:99217684-99217706 CCTTGTAGCTGGAGCATAGTAGG - Intergenic
959824066 3:110771832-110771854 CAGTGTGGCTGCAGCAGAGCTGG - Intergenic
960430546 3:117563310-117563332 CAGTCTGGCTGGAGTGCAGTAGG + Intergenic
960444896 3:117735855-117735877 CAGTGTGACTGGACTAGAATGGG - Intergenic
960676314 3:120198802-120198824 CTGTGTGGCTGGAGTGGAGTGGG - Intronic
960834941 3:121896518-121896540 GAGGGTGGGTGGAGGAGAGTAGG - Intronic
961107629 3:124255723-124255745 CAGTGCAGATGGAGCAGGGTGGG + Intronic
961262683 3:125615312-125615334 CAGTGTGGCTAGAACAAAGCAGG + Intergenic
961280237 3:125760754-125760776 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
961280940 3:125765693-125765715 CTGTGGGGCTGGAGCATGGTGGG - Intergenic
961288821 3:125828792-125828814 CAGAGTGGCTGAAATAGAGTAGG + Intergenic
961505926 3:127370402-127370424 CAGGGTGGTGGGAGCAGAGGGGG + Intergenic
961562279 3:127738813-127738835 CTGTGCGGCTGGTGCAGATTGGG - Intronic
961639023 3:128353349-128353371 CAGTGTGGCAGGGGCTGACTGGG + Intronic
961874169 3:130008793-130008815 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
961898249 3:130187234-130187256 CAGAGTGGCTGAAATAGAGTAGG - Intergenic
962449493 3:135500792-135500814 CAGTGTGGCTAGAGTACAGCAGG + Intergenic
962623680 3:137203582-137203604 CACTGTGCCTGGAACACAGTAGG + Intergenic
962886210 3:139630348-139630370 CACTGTGGCTGCCACAGAGTTGG + Intronic
964246973 3:154665438-154665460 CACTATGCCTGGAGCAGAGCAGG - Intergenic
964415885 3:156446982-156447004 CAGTGTGGCCAGAGAAGAGAAGG - Intronic
964612829 3:158632099-158632121 CAATGTGGCTGGAGCAAAAGGGG + Intergenic
964626155 3:158762044-158762066 CAGAGTGGCAGGAGCAGGATGGG + Intronic
966209622 3:177439734-177439756 CAGGGTTGGTGGAGCAGGGTTGG - Intergenic
966887741 3:184386187-184386209 CAGTGGGGAGGGTGCAGAGTTGG + Intronic
966891429 3:184410147-184410169 CACTGTGGCTGGAGTGCAGTGGG - Intronic
967135436 3:186509056-186509078 CAGTGTGCCTGGCACAGAGTAGG - Intergenic
967815663 3:193796168-193796190 CAGCGTGGCTGGAGTAAAGAGGG - Intergenic
967912090 3:194550844-194550866 TGCCGTGGCTGGAGCAGAGTTGG + Intergenic
967912316 3:194552516-194552538 CAGAGTGGCCGCAGCAGAGTGGG - Intergenic
968598995 4:1500377-1500399 CACTGGGACTGGGGCAGAGTAGG + Intergenic
969017434 4:4113276-4113298 CAGCCTGGCTGGAGGAGAGTGGG + Intergenic
969304241 4:6316761-6316783 CTGTGTGCCTGTGGCAGAGTGGG + Intergenic
969736512 4:8995029-8995051 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
969795703 4:9526592-9526614 AAGTCTGGCTGGAGGAGAGTGGG - Intergenic
969796415 4:9531522-9531544 CTGTGAGGCTGGAGCATGGTGGG - Intergenic
969982566 4:11173225-11173247 CAGTGTGGCTGGAATAAAGCAGG + Intergenic
970159103 4:13171332-13171354 CAGTGTGGCTGGTGCAGAGAGGG - Intergenic
970301539 4:14686227-14686249 CAGTATGGCAGGAGTAGAGCAGG + Intergenic
970444090 4:16109612-16109634 AAGTGTGCCTGGCACAGAGTTGG + Intergenic
971154660 4:24068504-24068526 CTGTATGACTGGAGCATAGTAGG + Intergenic
971238949 4:24869955-24869977 CAGTCTGGCTGGGCCAGTGTAGG - Intronic
971550406 4:27948403-27948425 CTGTCTGCCTGTAGCAGAGTTGG + Intergenic
972396132 4:38661367-38661389 CAGCGTTGCTGGAAAAGAGTAGG + Intergenic
972561698 4:40234494-40234516 CAGAGTTGCTGGACCAGAGGAGG + Intronic
973666600 4:53165571-53165593 CAGTGTGGCTGGAGCAAACAAGG - Intronic
973668609 4:53190350-53190372 CCATGTGGCTGGAGCACAGCAGG - Intronic
973811321 4:54573139-54573161 GAGTATGGCTGGAGCACAGGTGG - Intergenic
973832616 4:54776916-54776938 GAGTGTGGCTGGAATAGAGTGGG + Intergenic
975845193 4:78517698-78517720 CAGTGTGCCTGGTGTAGAATAGG + Intronic
976035877 4:80820514-80820536 CAGTGTTGCTGGAGCGTAGTGGG + Intronic
976204671 4:82613447-82613469 CAGTGTGGCTAGAACAAGGTAGG - Intergenic
976528242 4:86118381-86118403 CAGTGTGGCTGGAGAATTGTTGG - Intronic
976763613 4:88576417-88576439 CAGCATGGCTGGAGCAGAGTGGG - Intronic
976877776 4:89876673-89876695 CAGTGTGGCTGGGACCTAGTAGG + Intergenic
977449055 4:97171218-97171240 CAGTGTGGCTAGAATAAAGTAGG - Intergenic
977679642 4:99784960-99784982 TAGTGTGGCTGGAGCAGAGCAGG - Intergenic
978116844 4:105029451-105029473 CAGTATAGCTTGAGCAGAATTGG - Intergenic
978871925 4:113589111-113589133 CAGTGTGGCTGGGGCTGAGTGGG + Intronic
979443009 4:120774657-120774679 CAGTGTGGCTGGGGTTGTGTTGG - Intronic
980002472 4:127506554-127506576 AAGTGAGGCTGGAGGAGATTTGG - Intergenic
980204903 4:129705094-129705116 GAGAGTGTCTGGAGCATAGTAGG + Intergenic
980853334 4:138410472-138410494 CAGAGTGACTGGAGCAGTGTGGG - Intergenic
981144124 4:141305089-141305111 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
981729753 4:147885013-147885035 CAGTGGGGGTGGAGCCAAGTGGG + Intronic
982394522 4:154901833-154901855 CAGTGTAGCTGGTGCAGACTGGG - Intergenic
982469796 4:155774248-155774270 CAATGTGGCTGGAACAGAGGAGG - Intronic
983302422 4:165944448-165944470 CAGTGTTTCTGGAGCATAATGGG + Intronic
983420806 4:167513597-167513619 CAGAGTGCCTGGCACAGAGTAGG + Intergenic
984930122 4:184839600-184839622 AAGTGTGACTGCAGGAGAGTTGG - Intergenic
985006292 4:185537943-185537965 CAATGAGGATGGAGCAGAGTGGG + Intergenic
985937605 5:3108719-3108741 CAGTGTGGGTAGGGCAGAGACGG - Intergenic
986134232 5:4959322-4959344 AAGGGTGGCTGGAGCAGGGAAGG - Intergenic
986926071 5:12753645-12753667 CAGTGCGGCTGGAACAAAGCAGG - Intergenic
987269378 5:16290386-16290408 CATTGTGGCAGGAGCAGAGGGGG + Intergenic
987707616 5:21475566-21475588 CAGTGAGGCTGCAGCAGCATGGG + Intergenic
987797090 5:22641590-22641612 CTGTGTGGCTTGGGCAGAGCAGG - Intronic
989747445 5:44847014-44847036 CAGTGTATCTGGAGCATGGTGGG + Intergenic
989947349 5:50254602-50254624 CAGTGTGGGGTGGGCAGAGTGGG + Intergenic
990399455 5:55423464-55423486 CAGTGTGGCTGGAGCAGAATGGG + Intronic
990449068 5:55918570-55918592 CAGCGTGCATGGGGCAGAGTTGG + Intronic
990477603 5:56176109-56176131 CAGGGTGGAAGGAGCAGGGTAGG - Intronic
990801826 5:59612870-59612892 CAGAGTGACTGGACCAGAGGAGG + Intronic
990974676 5:61548915-61548937 AACTGTGGCTGGGGCAGAATGGG + Intergenic
991012588 5:61899391-61899413 CAGTGGGGGTGCAGCAGGGTGGG + Intergenic
991260507 5:64662626-64662648 CAGAGTGCCTACAGCAGAGTGGG - Intergenic
991442298 5:66663661-66663683 CACTGTAGCTGGAATAGAGTGGG + Intronic
991446198 5:66702677-66702699 GAGTGTGGCTGGAGCAGAACAGG + Intronic
991682745 5:69154752-69154774 CAGTGTGGCTAGAGTATAGAGGG - Intergenic
992381707 5:76243851-76243873 CAGTGTGGCTGCATGTGAGTTGG - Intronic
992781420 5:80131579-80131601 CAGTAATGCTGGAACAGAGTGGG + Intronic
993042730 5:82834072-82834094 CAGGGTGGAAGGAGCAGAGAGGG + Intergenic
993643428 5:90433874-90433896 CAGTATGGTTGCAGCAGAGCAGG + Intergenic
994151935 5:96457527-96457549 CAGGGTGGCTGGAGCAACATAGG - Intergenic
995848494 5:116520090-116520112 CACAGGGGCTGGAACAGAGTGGG - Intronic
995856762 5:116600823-116600845 CCATGTGGCTGGTACAGAGTGGG + Intergenic
996036051 5:118759914-118759936 CAGTGTGGCTAGAGTAAAGCAGG - Intergenic
996273465 5:121636853-121636875 CAGTGTGGCTAGAACACAGTAGG - Intergenic
996417198 5:123223060-123223082 CAGTGTGCAAGGAGCAGAGGGGG - Intergenic
997090467 5:130850526-130850548 CAGTGTGCCTGTAGCAAAATTGG + Intergenic
997198005 5:131992444-131992466 CAGAGTGGCTGCACCGGAGTAGG - Intronic
997293378 5:132753755-132753777 CACTGTGGTTGGAGCAGGCTTGG - Exonic
997812758 5:136988361-136988383 CAGCCTTGCTGGAGCAGAGGAGG - Intronic
997894297 5:137702461-137702483 CAGTCTGGCTGGAGCACATTAGG + Intronic
998253926 5:140570738-140570760 CAGTCTGGCTGGAGCTGAACAGG - Intronic
998335013 5:141364165-141364187 TAGTATGGAGGGAGCAGAGTCGG - Intronic
998548287 5:143050881-143050903 GATGGTGGCTGGAGCAGAGGAGG - Intronic
998921336 5:147071506-147071528 CAGTGTGTCTGAAGTTGAGTAGG - Intronic
999143419 5:149377666-149377688 GGGTGTGGCTGGAGAAGAGTGGG + Intronic
999175590 5:149629599-149629621 CAGTGTGGCCGGAGAAGAAAGGG + Intronic
999510441 5:152245123-152245145 CAGTGTAGCTGGAGCCAGGTGGG + Intergenic
999538883 5:152549977-152549999 CAGTGTGGCTGGAGTAAAATGGG - Intergenic
999970836 5:156860760-156860782 GATGGTGGCTGGAGGAGAGTCGG - Intergenic
1000166759 5:158657314-158657336 CAGGGTGGCTGGACCACAGATGG - Intergenic
1000326662 5:160177527-160177549 CAGTGTGGCTGGATCAGAGGAGG - Intergenic
1000380114 5:160621344-160621366 CAGTGTGTAGGGAGTAGAGTTGG + Intronic
1000922978 5:167160372-167160394 CAGTGAGGCTGGAGCACAGCAGG - Intergenic
1001311772 5:170616304-170616326 CAGTGTGCCTGGCCCAGGGTAGG - Intronic
1001403381 5:171459767-171459789 CAGAACGGCTGGAACAGAGTGGG + Intergenic
1001527325 5:172438088-172438110 CAGCCAGGCTGGAGCAGAGGAGG - Intronic
1001579807 5:172790858-172790880 CAGGATGCCTGGTGCAGAGTCGG + Intergenic
1001929672 5:175664022-175664044 AAGTGTGGCTGGAGCCAAGTTGG + Intronic
1001975245 5:175993497-175993519 CAGTGTGGCTTGAGTGGAGTGGG - Intronic
1002139324 5:177129246-177129268 CAGGGTAGCTGGAACAGAGGAGG + Intergenic
1002242186 5:177850273-177850295 CAGTGTGGCTTGAGTGGAGTGGG + Intergenic
1002872526 6:1179669-1179691 CAGTGTGGCTGGAGCAGGGGAGG - Intergenic
1002951063 6:1811955-1811977 CAGTGTACCTGGAACATAGTAGG - Intronic
1003078790 6:3004443-3004465 CATTGTGGCTGAAGCTGAGTTGG - Intronic
1003208322 6:4035590-4035612 CATTTTGGCTGGATCAGAGAAGG + Intronic
1003257256 6:4485308-4485330 CACTGTGGCTGGGGCAGAGTGGG - Intergenic
1003385174 6:5660805-5660827 CAGTGTGGCTGGAAAAGTGGGGG + Intronic
1003530154 6:6930360-6930382 CAGTCTGGCTGGGGCAGAGTAGG + Intergenic
1003688022 6:8323712-8323734 CAGTGTGGCAGGAGAAGGGCAGG - Intergenic
1003708472 6:8562107-8562129 CCATGTGGCTGGAGTAGAGGAGG - Intergenic
1004698768 6:18058942-18058964 CAGTGTGGGTGCAGGACAGTGGG + Intergenic
1004755032 6:18601710-18601732 CACTGTGACAGGAGCAGTGTGGG + Intergenic
1004817633 6:19329880-19329902 CAGTGTGGCTGAAGTAGAGTGGG + Intergenic
1005019342 6:21402529-21402551 CAGTGTGGGGAGAGCAGACTGGG + Intergenic
1005355473 6:24979191-24979213 CAGTGGGAGTGGAGCAGAGAGGG - Intronic
1005808263 6:29495291-29495313 CAGTGTGGGAGGAACAGAGTGGG - Intergenic
1006164812 6:32058029-32058051 GAGTGTGGGTGGGGCAGGGTTGG - Intronic
1006251470 6:32790635-32790657 CAGTGAGGCTGGAACAGAACGGG + Intergenic
1006448710 6:34093608-34093630 CTGTGTGGCTGGAGCAGAGCAGG + Intronic
1006728169 6:36215028-36215050 CAGTTTGGCTGCAGCAGAGGGGG + Intronic
1006811117 6:36821237-36821259 CCGTGTGACTGGAGTGGAGTGGG + Intronic
1007085904 6:39145093-39145115 CAGTGTGGCTTGACCTAAGTGGG - Intergenic
1007100377 6:39241977-39241999 CTGTGGGGCGGGAGCAGAGGCGG - Intergenic
1007192190 6:40028915-40028937 CAGTGAGGGTGGAGAAAAGTAGG + Intergenic
1007750443 6:44067795-44067817 CAGGCTGGCAGGATCAGAGTCGG + Intergenic
1007899297 6:45395071-45395093 AAGTGTGGCTGAAGCCTAGTAGG - Intronic
1009020600 6:57944966-57944988 CAGTGAGGCTGCAGCAGCATGGG - Intergenic
1010598729 6:77797745-77797767 CAGTGTGGCTAGAACAAAGCAGG - Intronic
1010628679 6:78170595-78170617 CAGTGTCTATGGAGCAGAGTTGG - Intergenic
1010767346 6:79791264-79791286 CAGCTTGGCTTGAGCAGGGTGGG - Intergenic
1010879662 6:81152270-81152292 CAGCATGGCTGGGGCAGACTTGG + Intergenic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1011380826 6:86740518-86740540 CAATGTGGCTGGAACAAAGCAGG - Intergenic
1012355582 6:98310045-98310067 CAGTGTGTCTGGAGCAAAAGGGG - Intergenic
1013033218 6:106356411-106356433 CAGTGATGCTGGAGAAGAGAGGG - Intergenic
1013469577 6:110449925-110449947 CAGTGTGGCAGAAGTAGAGAAGG - Intronic
1013473349 6:110485730-110485752 CAGTGTGGCTGGAGTGGAGCAGG - Intergenic
1014007870 6:116442202-116442224 CAGTGTGGCTAGAGCAGAGTGGG + Intergenic
1014968875 6:127790813-127790835 CACTCTGGCTGCAGCAGGGTGGG + Intronic
1016056361 6:139581709-139581731 CCCAGTGGCTGGAACAGAGTAGG - Intergenic
1016572439 6:145530236-145530258 CAGTGTGGCTGGAACAATCTGGG + Intronic
1016873781 6:148844557-148844579 CTGAGTGGCTGGAGCAGACAGGG - Intronic
1016900316 6:149094285-149094307 GAGTTTGGATGGAGGAGAGTGGG + Intergenic
1016912659 6:149214570-149214592 CAGTGTGACTGGAGCACAGAGGG - Intergenic
1017112039 6:150941260-150941282 CAGGGTGGCTGGAGCCCCGTGGG + Intronic
1017889608 6:158627673-158627695 CAGCGTGGCTGGAGATGAGCAGG + Intronic
1018098835 6:160418191-160418213 CAGTGTGGCTTGAACAAAGCAGG + Intronic
1018339062 6:162830352-162830374 CAGTATGGCTGGAGCCATGTGGG - Intronic
1018441719 6:163820061-163820083 CAGTGTGGCTGGAATAGCGGAGG - Intergenic
1018940959 6:168308633-168308655 CAGGGTGGCTGGAGTACAGACGG - Exonic
1019120823 6:169802126-169802148 GAGCCTGGGTGGAGCAGAGTAGG - Intergenic
1019457317 7:1137168-1137190 CAGTGTGGCTGCAGCCAATTTGG - Intronic
1019744659 7:2692870-2692892 CAGTGTGGCTGGAACAAATTGGG - Intronic
1019778623 7:2926918-2926940 CAGTGTGGGTGGAGGAGGTTGGG + Intronic
1019922431 7:4171607-4171629 TAGAGAGGCTGGAGCAGAGCCGG + Intronic
1020114923 7:5470889-5470911 CTGCGTGGCTGGAGCAGCCTGGG - Intronic
1020147932 7:5659461-5659483 CAGTATGGCTGGAGCCCAGTGGG + Intronic
1020210252 7:6153753-6153775 CAGTGCACCTGGAGCAGAGAGGG + Exonic
1020627274 7:10596912-10596934 CAGTATGGCTGGGGCAGAGCCGG + Intergenic
1021508394 7:21409899-21409921 CAGTCTGGCTGGAGCAGGATAGG - Intergenic
1021851615 7:24814212-24814234 CAGTGTGGCCAGAGGACAGTGGG + Intronic
1022201658 7:28123106-28123128 CAGTGTGGCTAGAGGAGAGAGGG - Intronic
1022408482 7:30116962-30116984 CAGTTTGGCTTCAGGAGAGTGGG + Intronic
1023124046 7:36937222-36937244 CAGTCATACTGGAGCAGAGTTGG + Intronic
1023170342 7:37385340-37385362 CAGTGTGGCTGGAGGGGAGGGGG - Intronic
1023852411 7:44157804-44157826 CACTGAGGCTGGAGCAGAGGCGG + Intronic
1024558001 7:50620314-50620336 CAGTCTGGCTGCAGGAGAGGAGG - Intronic
1024590888 7:50881952-50881974 TCCTGTGGCTGGAGCAGAGGTGG + Intergenic
1024818747 7:53302660-53302682 CACTGTGTTTGGAGCTGAGTGGG - Intergenic
1024863940 7:53881112-53881134 CAGTGTTTATGGAGCTGAGTAGG - Intergenic
1025703748 7:63843917-63843939 CACCGAGGCTGGAGCACAGTGGG - Intergenic
1026511528 7:71031443-71031465 TAGTGTGGCTGGGACACAGTGGG - Intergenic
1026735174 7:72944762-72944784 CAGTGTGGCTGCAGGAGTGGTGG + Intronic
1026785515 7:73299691-73299713 CAGTGTGGCTGCAGGAGTGGTGG + Intergenic
1027108557 7:75420245-75420267 CAGTGTGGCTGCAGGAGTGGTGG - Intronic
1027309341 7:76937867-76937889 CTGCGTGGCTGGAGCAGAGTAGG - Intergenic
1028240786 7:88418189-88418211 CACTGAGGCGGGAGAAGAGTAGG - Intergenic
1028539210 7:91923962-91923984 CAGTGTGCCTGGGTCAGAGTAGG + Intergenic
1028615846 7:92766000-92766022 CACTGTGGCTGGAGAACCGTGGG + Intronic
1029015490 7:97311625-97311647 CAGAGTGGCTAGAGAAGGGTAGG + Intergenic
1029075926 7:97934106-97934128 CAGTCTGACTGGAGGAGAGTGGG + Intergenic
1029210940 7:98907922-98907944 CAGTGTGGCTGCAGCACATCAGG - Intronic
1029434722 7:100556567-100556589 CAGTGAGGGTGGAGAAGAGAAGG - Intronic
1029482800 7:100823366-100823388 CAGTGTGGCTGGAGCACAGTGGG + Intronic
1029745657 7:102514506-102514528 CCGGGTGGCTGGATCAGAGGTGG + Intronic
1029763596 7:102613485-102613507 CCGGGTGGCTGGATCAGAGGTGG + Intronic
1029796098 7:102896082-102896104 CAGAGTGGCTGGAGTAGAGTTGG + Intronic
1029905864 7:104093021-104093043 CAGTGGGGCTGGAGGAGACAAGG + Intergenic
1029959554 7:104675298-104675320 CAGAGAGGCTGGAGCAGAGTGGG + Intronic
1030318501 7:108140691-108140713 CAATGTGGCTAGAGCAGAGTGGG + Intergenic
1030789470 7:113706259-113706281 CAGTGTGGTTCGGTCAGAGTGGG - Intergenic
1030968004 7:116017635-116017657 CAGTATGGCTAGACCACAGTAGG - Intronic
1031895623 7:127345597-127345619 CAGTGTGGCTGCATTCGAGTGGG + Intergenic
1032335228 7:131018638-131018660 TCGTGTCACTGGAGCAGAGTGGG - Intergenic
1032411603 7:131697571-131697593 CAGTGTGGCTGAAGTGGAGTAGG + Intergenic
1032491925 7:132330218-132330240 CAATTTGGCTGGAGCTGAGTAGG + Intronic
1032626310 7:133595078-133595100 CAGTGTGGATGGAGGAGTGTAGG + Intronic
1035920101 8:3667488-3667510 CAGGGTGGCTGGAGCCAACTAGG + Intronic
1036241594 8:7086233-7086255 CAGTCTGGCTGAAGGAGAGTGGG - Intergenic
1036258483 8:7222815-7222837 CTGTGGGGCTGGAGCATGGTGGG + Intergenic
1036260244 8:7233884-7233906 TAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1036306373 8:7605639-7605661 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1036308137 8:7616693-7616715 CTGTGGGGCTGGAGCATGGTGGG - Intergenic
1036310538 8:7681411-7681433 CTGTGGGGCTGGAGCATGGTGGG + Intergenic
1036312281 8:7692440-7692462 TAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1036357219 8:8053624-8053646 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1036702314 8:11020929-11020951 CATAGTGGCTGGCACAGAGTAGG + Intronic
1036706694 8:11052105-11052127 CAGTTTGGTTGGAGCAGAGGGGG - Intronic
1036831141 8:12020844-12020866 CAGCCTGGCTGGAGGAGAGTGGG + Intergenic
1036901350 8:12671629-12671651 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1037051732 8:14382228-14382250 CTGTGTAGCTGGAGCAGAAGAGG + Intronic
1037094337 8:14965255-14965277 CAGTTTGACTGGACCAGATTTGG - Intronic
1037162867 8:15793937-15793959 CAGTGTGGCTAGAGCAAAGTGGG + Intergenic
1037272045 8:17141088-17141110 CTGTGGAGCTGGAGCAGAATGGG + Intergenic
1037620348 8:20558160-20558182 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
1037676563 8:21056117-21056139 CAGAGTGGCTGGCACATAGTAGG + Intergenic
1037750936 8:21682007-21682029 CCCTGTGGCTGCAGCAGAGTGGG + Intergenic
1038893316 8:31752295-31752317 CAGAGTGACTGGAGCTAAGTGGG + Intronic
1039567334 8:38560718-38560740 AAGAGTAGCTGGAGCAGAATGGG - Intergenic
1039892285 8:41693835-41693857 CAGTGCGTCTGGAACACAGTAGG - Intronic
1040055629 8:43055123-43055145 CAGGGTGGTTGGGGCACAGTGGG + Intronic
1040562195 8:48532929-48532951 AAGCCTGGCTGGAGCGGAGTGGG - Intergenic
1041527419 8:58822856-58822878 CACAGTGGCTGTGGCAGAGTAGG - Intronic
1041618325 8:59934433-59934455 CAGTGTGGCAGGAGCATAGTTGG + Intergenic
1041866920 8:62584581-62584603 CAGTGTGGCTGGCACAAGGTAGG - Intronic
1041876780 8:62697283-62697305 CAGCATGGCTGGAACAGAGTAGG - Intronic
1042020406 8:64368393-64368415 CAGGGTGCCCAGAGCAGAGTTGG + Intergenic
1042077789 8:65015320-65015342 CATTGTGGCAGGGGCAGAGGTGG - Intergenic
1042193395 8:66210863-66210885 CAGAGTGCCTGGAGGAGATTTGG - Intergenic
1042318785 8:67452905-67452927 CAATGTGGCTGGAGCCAAGTGGG + Intronic
1042328935 8:67557522-67557544 CAGTGTTGCTGGTTCAGATTGGG - Intronic
1042339202 8:67661311-67661333 CATTGTGGCTGGAGTAGAGTAGG + Intronic
1042705709 8:71664134-71664156 CAGTGTGGCTGGAGGAGGGTGGG - Intergenic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1043614023 8:82103355-82103377 CAGTGTGGCTAGAATAAAGTGGG + Intergenic
1044094977 8:88052412-88052434 CAGTGGAGATGGAGCAAAGTGGG - Intronic
1044876515 8:96673067-96673089 TAGAGTGACTGGAGCAGAGAAGG + Intronic
1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG + Intronic
1045249628 8:100472686-100472708 CAGGGTGGATGGAGTTGAGTGGG - Intergenic
1047213280 8:122856973-122856995 CAGGGTGGCTGGAGCCGAGAAGG - Intronic
1047488024 8:125350434-125350456 CAGTGTGCCTTGAGCACAGTGGG + Intronic
1047534771 8:125709465-125709487 CAGAGTGCCTGGAGCATAGCAGG - Intergenic
1048812487 8:138301604-138301626 CAGAGGGCCTGGGGCAGAGTAGG - Intronic
1048981980 8:139707283-139707305 CAGTGTGTCTGGGCCAGGGTGGG + Intergenic
1049196013 8:141316044-141316066 CAGAGTGCCTGGAGCAGAGCAGG - Intergenic
1049199785 8:141334434-141334456 CAGTGGGGCTGGGACAGAGAGGG - Intergenic
1049684229 8:143932897-143932919 CCGTGTGGATGGCGCTGAGTGGG - Exonic
1049743861 8:144254798-144254820 AGGTGTGGCTGGAGCAGAGCAGG - Exonic
1050131202 9:2414570-2414592 GACTCTGGATGGAGCAGAGTTGG - Intergenic
1050495012 9:6231349-6231371 TAGTGTGGCTGGAGCAGAGCGGG - Intronic
1050814624 9:9794468-9794490 CAATGTGGCTAGAGCAGAGAAGG + Intronic
1050944017 9:11495259-11495281 CAGAGTGGCTAGAACAAAGTAGG - Intergenic
1051033114 9:12707545-12707567 AACTGTGGCTGGAGTAGAGTGGG + Intronic
1051667187 9:19476432-19476454 CAGCGTGGCAGGGCCAGAGTAGG - Intergenic
1052560403 9:30077450-30077472 CAGTGTGGCTAGAACAAAGCAGG - Intergenic
1052758180 9:32563380-32563402 CAGGATGGCTGGAGTACAGTGGG + Intronic
1052827484 9:33187549-33187571 CAGTGTGGCTGGCGCAGAGGAGG - Intergenic
1052858205 9:33420222-33420244 ATGTGTGGCTGGAGCAGGATGGG + Intergenic
1052866303 9:33466505-33466527 CTGGGTGACTGGAGCAGAGGTGG + Intronic
1053121891 9:35553699-35553721 AAGTGTGGCTGGAGCACAGTGGG + Intronic
1053526125 9:38832729-38832751 CACTATGCCTGGAACAGAGTGGG + Intergenic
1054906588 9:70418915-70418937 AAGTGGGGCGGGAGCAAAGTAGG - Intergenic
1055249585 9:74286988-74287010 CAATGTGGCTGGAGCAGGGTGGG - Intergenic
1055882959 9:81023902-81023924 CAGCGTGGCTAGAACAGAGCAGG + Intergenic
1055900129 9:81224628-81224650 AAGTCTGGCTGGAGCAGGGTTGG - Intergenic
1056108494 9:83371660-83371682 GGGTGGGGCTGGAGCAGAATTGG - Intronic
1057328155 9:94085496-94085518 AAGTGTGGGAGGAGCAGTGTGGG + Intronic
1057786913 9:98094651-98094673 CAGTGTGACTGGAGAAGGGCAGG + Intronic
1057834788 9:98435650-98435672 CAGTGTGGCTGGAATAAAGTGGG - Intronic
1057987625 9:99733222-99733244 CAGAGTAGCGGGAGGAGAGTGGG + Intergenic
1057987751 9:99734436-99734458 CAGAGTAGCAGGAGGAGAGTGGG + Intergenic
1058067663 9:100567157-100567179 AAGTGTGGCTGCAGAAGAGGGGG - Intronic
1059400757 9:114069635-114069657 CAGCGTGCCTGGGGCAGAGTGGG + Intronic
1059434165 9:114266427-114266449 CGGTGTGGCTGGGGCGGACTAGG + Intronic
1059727442 9:117023292-117023314 CAATGTGGTTGGGGCAGACTGGG - Intronic
1059877407 9:118650359-118650381 CTGTGTGGCTGGAGTATAATGGG + Intergenic
1059953870 9:119495903-119495925 CAGTGAGGCTGGGGGAGAGAGGG + Intronic
1060065935 9:120501167-120501189 CAGGGTTGCTGGAGCAGAACTGG - Intronic
1060246898 9:121954063-121954085 CAGTGGGGCTGGGGCTGTGTTGG - Intronic
1060463666 9:123883000-123883022 CATTGTGGCTGGAGTTCAGTGGG - Intronic
1060893586 9:127203571-127203593 AAGTGAGGCTGGGGCAGGGTTGG + Intronic
1060960364 9:127676474-127676496 CAGAGTGGCTGGAGGGGAATCGG + Intronic
1061327663 9:129874060-129874082 CAGAGTGGCGGGAGGAGAGCTGG + Intronic
1061390473 9:130314905-130314927 CAGTGAGGCAGAGGCAGAGTGGG + Intronic
1061393203 9:130329154-130329176 CAGTGGGGCTGGAGCAGAAATGG - Intronic
1061720077 9:132546056-132546078 CAGGGTGCCTGGCACAGAGTAGG + Intronic
1061796939 9:133091062-133091084 CAGAGTTGTTGGGGCAGAGTCGG + Intergenic
1062057034 9:134474126-134474148 CAGGGTGACTGCAGCAGAGTGGG + Intergenic
1062184139 9:135207650-135207672 CAGCGTGGCTGGAACAAAGCAGG + Intergenic
1062215798 9:135389211-135389233 CAGGGTGGCTGGAGCTCAGGAGG - Intergenic
1062497384 9:136838152-136838174 CTCTGTGGCTGGAGCAGACGAGG + Intronic
1203525793 Un_GL000213v1:85783-85805 CAGCCTGGCGGGAGCAGAGGCGG + Intergenic
1186613213 X:11159132-11159154 CTGTGAGGCTGGAAGAGAGTAGG + Intronic
1186812716 X:13206042-13206064 TGGTGAAGCTGGAGCAGAGTAGG + Intergenic
1187455457 X:19437439-19437461 TTGTGTAGCTGGAGCATAGTAGG - Intronic
1188722104 X:33535099-33535121 CTGTGTGGCAGTAGCAGAGGGGG + Intergenic
1188874529 X:35413802-35413824 CATTGTGAATGGAGCAGATTTGG - Intergenic
1189244671 X:39554336-39554358 TAGTGTGGCTGGAGCAGAGCGGG + Intergenic
1189351270 X:40277563-40277585 TAGAGTGGCTGGCACAGAGTGGG + Intergenic
1189653641 X:43217658-43217680 CTGTGTTGCTGGATTAGAGTTGG - Intergenic
1192440734 X:71171555-71171577 CAGGGTGGTTGCAGCAGAGGAGG - Intergenic
1193010426 X:76669478-76669500 CAGTAGGGGTGGTGCAGAGTGGG - Intergenic
1194016200 X:88624640-88624662 CAGTGTGGCTAGAGGAGTGCAGG + Intergenic
1194023317 X:88721200-88721222 CAGTGTGGCTAGAACAAAGCAGG - Intergenic
1194429401 X:93782421-93782443 CAGTGTGACTGGAGCATAAAGGG + Intergenic
1195920489 X:109978452-109978474 CAGAGTGACTGGAGCAGCTTGGG + Intergenic
1195941207 X:110169394-110169416 CAGTGAGGCTGGAGGAGAGTGGG - Intronic
1196349652 X:114711809-114711831 CACTGTGCCTGGAACAAAGTAGG + Intronic
1196683613 X:118493313-118493335 CAGTGTGGCTGGAGCGTAGAAGG - Intergenic
1196689286 X:118541982-118542004 CAGTGTCCCTGGTACAGAGTAGG + Intronic
1197780483 X:130154321-130154343 CCGTGTTGCTGTACCAGAGTTGG - Intronic
1197805902 X:130398368-130398390 CAGTGTGGCTGGAGAGGAGTAGG - Intergenic
1197979242 X:132198331-132198353 CAGAGTGGTAGGAGCAGATTGGG - Intergenic
1198018591 X:132636005-132636027 CAGGGCGTCTGGAGCAGAGAAGG - Intronic
1198270989 X:135055872-135055894 CAGAGTGGTTAGAGAAGAGTTGG + Intergenic
1198575298 X:138004175-138004197 CAGTGTGGCTGGAGCATAGAGGG + Intergenic
1199429842 X:147746332-147746354 CAGTGTGGCTGAAGGGGAGGAGG - Intergenic
1199709247 X:150456857-150456879 AAGAGTGGGTGCAGCAGAGTAGG + Intronic
1199828797 X:151528253-151528275 CAGTGTGTCTGGGGCAGAGAGGG + Intergenic
1199851524 X:151727503-151727525 GAGGGTTGCTGGAGCAGATTTGG + Intergenic
1200051263 X:153433096-153433118 CTGTGTGGCTGGAGGCCAGTGGG + Intergenic
1200098323 X:153674414-153674436 CAGTGTGGCCGGGGAAGAGGTGG - Intronic
1200688588 Y:6281128-6281150 CAGGGTGACTGGAGCATAGCTGG + Intergenic
1201046685 Y:9893560-9893582 CAGGGTGACTGGAGCATAGCTGG - Intergenic
1201519567 Y:14858505-14858527 CAGCCAGGCTGGAGTAGAGTAGG - Intergenic