ID: 1077539705

View in Genome Browser
Species Human (GRCh38)
Location 11:3140752-3140774
Sequence GGTACCCACATACCCCAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 87}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077539705_1077539718 18 Left 1077539705 11:3140752-3140774 CCTCCTTGGGGTATGTGGGTACC 0: 1
1: 0
2: 0
3: 17
4: 87
Right 1077539718 11:3140793-3140815 CCAGGAGCTGAGGCTGCCCCTGG 0: 1
1: 0
2: 6
3: 69
4: 683
1077539705_1077539712 0 Left 1077539705 11:3140752-3140774 CCTCCTTGGGGTATGTGGGTACC 0: 1
1: 0
2: 0
3: 17
4: 87
Right 1077539712 11:3140775-3140797 TGGGGCGGCCCCTCATGTCCAGG 0: 1
1: 0
2: 0
3: 20
4: 139
1077539705_1077539719 19 Left 1077539705 11:3140752-3140774 CCTCCTTGGGGTATGTGGGTACC 0: 1
1: 0
2: 0
3: 17
4: 87
Right 1077539719 11:3140794-3140816 CAGGAGCTGAGGCTGCCCCTGGG 0: 1
1: 0
2: 8
3: 51
4: 501
1077539705_1077539714 8 Left 1077539705 11:3140752-3140774 CCTCCTTGGGGTATGTGGGTACC 0: 1
1: 0
2: 0
3: 17
4: 87
Right 1077539714 11:3140783-3140805 CCCCTCATGTCCAGGAGCTGAGG 0: 1
1: 0
2: 3
3: 19
4: 266
1077539705_1077539720 29 Left 1077539705 11:3140752-3140774 CCTCCTTGGGGTATGTGGGTACC 0: 1
1: 0
2: 0
3: 17
4: 87
Right 1077539720 11:3140804-3140826 GGCTGCCCCTGGGTGTATCAAGG 0: 1
1: 0
2: 2
3: 8
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077539705 Original CRISPR GGTACCCACATACCCCAAGG AGG (reversed) Intronic
900993925 1:6110175-6110197 TGTACCCCAACACCCCAAGGCGG + Intronic
902398284 1:16144119-16144141 GGGACCCACTTACCTCCAGGAGG + Intronic
902787912 1:18745136-18745158 GCTCCCCACTTTCCCCAAGGAGG + Intronic
903925349 1:26827333-26827355 GGTACCCAAATGGACCAAGGAGG - Intronic
904601475 1:31674994-31675016 GGTACCCTCTTACCTTAAGGAGG + Exonic
906438100 1:45814537-45814559 TGTAAACACATACACCAAGGCGG + Intronic
915634110 1:157174398-157174420 GGGACCCTCATACTCTAAGGTGG - Intergenic
915939357 1:160109105-160109127 GGCACTCACATTCCTCAAGGGGG + Intergenic
917602419 1:176589966-176589988 GGTCCCCACATGCTCCCAGGAGG - Intronic
918309950 1:183278725-183278747 GGGCCCCACATCCCCAAAGGTGG - Intronic
918872536 1:189993981-189994003 ACTACCCACATACCCTACGGAGG + Intergenic
922024172 1:221735296-221735318 GGGACACACAGACCCCAAGGAGG + Intronic
923711956 1:236395247-236395269 GGTACCCACGTCCCCCTGGGCGG - Intronic
1065678096 10:28199477-28199499 TGTAGCCAGATACCCCAAGGTGG + Intronic
1067224686 10:44368010-44368032 GGAACACACAGAACCCAAGGCGG + Intergenic
1074763430 10:116684145-116684167 GATACCCAAACACCCCAGGGTGG + Intronic
1077460789 11:2708439-2708461 GGCACCCACAGCCCCCGAGGAGG + Intronic
1077539705 11:3140752-3140774 GGTACCCACATACCCCAAGGAGG - Intronic
1078059794 11:8035816-8035838 TGTACCCACATTCCTCTAGGGGG + Intronic
1078421589 11:11217202-11217224 GGCACCCACATATCCCACAGAGG + Intergenic
1083815343 11:65129716-65129738 TGTACAGACACACCCCAAGGAGG + Exonic
1086452798 11:86933647-86933669 GGTGCTCCCATACCCCAAGTGGG + Intronic
1087253854 11:95933915-95933937 GCTGCCCACAGACACCAAGGAGG - Intergenic
1089429853 11:118413874-118413896 GGTAGCCACATTGCCCAAGCTGG + Intronic
1091957786 12:4662118-4662140 AGTACCTACATATCCAAAGGAGG - Intronic
1094514949 12:31120723-31120745 GGCAGACACACACCCCAAGGCGG + Intergenic
1095835148 12:46629661-46629683 GGTACCCACCTCTCCCATGGGGG - Intergenic
1097826771 12:64182381-64182403 GGTTCTCACATACCCCATGGAGG + Intergenic
1100844453 12:98644764-98644786 GGTTCCCACGAACGCCAAGGCGG - Exonic
1102323019 12:111955230-111955252 GCCACCCACAGACACCAAGGAGG - Intronic
1103137724 12:118522150-118522172 GTTACTTACATCCCCCAAGGAGG + Intergenic
1105274210 13:18905457-18905479 GGGAGCCACATACCCCGAGCTGG + Intergenic
1106177026 13:27340423-27340445 GGCATCCTCACACCCCAAGGTGG + Intergenic
1109134128 13:58625677-58625699 TGTACCCACATACTCCAAATGGG + Intergenic
1113457546 13:110459075-110459097 AAAACCCACATACCCCAAGGCGG + Intronic
1114062552 14:19032232-19032254 GGTAGCCACATGACCCAAGGAGG + Intergenic
1114099709 14:19367765-19367787 GGTAGCCACATGACCCAAGGAGG - Intergenic
1123494250 15:20809234-20809256 GGTAGCCACATGACCCAAGGGGG - Intergenic
1123550747 15:21378317-21378339 GGTAGCCACATGACCCAAGGGGG - Intergenic
1125113808 15:36065112-36065134 GGCAAACACATTCCCCAAGGTGG - Intergenic
1128304790 15:66591236-66591258 GGTACCCCCTTTCCCCAAAGGGG + Intronic
1202959086 15_KI270727v1_random:105570-105592 GGTAGCCACATGACGCAAGGGGG - Intergenic
1134234403 16:12454210-12454232 GGTTACCACATGGCCCAAGGCGG - Intronic
1138411376 16:56843072-56843094 GTTACCCACATTCCTAAAGGTGG - Intronic
1145977614 17:28993344-28993366 GCTACCCACTGGCCCCAAGGTGG + Intronic
1146106203 17:30039567-30039589 GGTACCAAGATACCCCAAGTTGG + Intronic
1146291521 17:31610909-31610931 GGTACACTCATAACCCAATGGGG + Intergenic
1146666954 17:34711641-34711663 GGTACCCACTTGCCCTGAGGAGG + Intergenic
1148641690 17:49192654-49192676 GCTACCCACACAGCCCGAGGTGG - Intergenic
1150790461 17:68197643-68197665 TGGACCAACAAACCCCAAGGAGG - Intergenic
1152474653 17:80510152-80510174 GGTACCCTCCATCCCCAAGGAGG - Intergenic
1153056760 18:953256-953278 GGTACCCACTTAGCCCTAGAAGG + Intergenic
1154451774 18:14483689-14483711 GGTAGCCACATGACCCAAGGGGG - Intergenic
1156008701 18:32471505-32471527 AGTACCCACATACAGGAAGGTGG + Intergenic
1160014784 18:75132505-75132527 GATACACACAGAGCCCAAGGTGG + Intergenic
1162971164 19:14182387-14182409 GGGACCCAGATGCCCCAATGTGG + Intronic
1164828678 19:31303427-31303449 GGCACCCACAGTCACCAAGGTGG + Intronic
1167254457 19:48418908-48418930 GGCACACCCATACCCCTAGGAGG - Intronic
929999116 2:46849162-46849184 GGTACACACCTAAGCCAAGGGGG + Intronic
933859680 2:86453348-86453370 GGTAATCACATCCCCCAACGTGG - Intronic
935000608 2:99011029-99011051 CATACCCCCATCCCCCAAGGTGG + Intronic
935613598 2:105052810-105052832 GGGACACACAGACCACAAGGAGG - Intronic
937949911 2:127376454-127376476 GCCACCCACAGACACCAAGGAGG - Intronic
938479917 2:131652439-131652461 GGTAGCCACATGACCCAAGGAGG + Intergenic
939254461 2:139724346-139724368 GGTACCCACAAAAGCCAAAGAGG - Intergenic
945278106 2:208008709-208008731 GGTACCCACAAAACCCTGGGAGG - Intronic
947735978 2:232455797-232455819 GGCACCCATATACACCAAGTGGG + Intergenic
1169091094 20:2861915-2861937 GGGCACCACATAACCCAAGGTGG + Intronic
1170126459 20:12969581-12969603 GCCACCCACAGACCCCAAAGAGG - Intergenic
1171432287 20:25090710-25090732 GGGACCTACTTACTCCAAGGAGG + Intergenic
1176444370 21:6806531-6806553 GGTAGCCACATGACCCAAGGGGG + Intergenic
1176822535 21:13671569-13671591 GGTAGCCACATGACCCAAGGGGG + Intergenic
1178938381 21:36883902-36883924 GCCACCCACAGACACCAAGGAGG + Intronic
1180481044 22:15754859-15754881 GGTAGCCACATGACCCAAGGAGG + Intergenic
1181498290 22:23300725-23300747 GGTGCCCACATAACCCAGGCTGG + Intronic
1183748251 22:39704588-39704610 GGTGACCGCATAGCCCAAGGTGG - Intergenic
1184875867 22:47275139-47275161 GGCACCAACATTCCCCAAGAAGG - Intergenic
955545764 3:60028118-60028140 GGAAAACACATGCCCCAAGGTGG + Intronic
960486923 3:118264458-118264480 GGTACCTATATATCTCAAGGAGG + Intergenic
963545176 3:146648206-146648228 GGTACCCACATAAACCAAGATGG + Intergenic
963800619 3:149672429-149672451 GCTACCTACGTACCCGAAGGAGG + Intronic
974517767 4:62939008-62939030 GGTACATACAGACCCCAAGATGG - Intergenic
977034733 4:91935321-91935343 GCTGCCCACAGACACCAAGGAGG + Intergenic
987393591 5:17399862-17399884 GGGACCTAAATACCTCAAGGTGG + Intergenic
995066562 5:107869387-107869409 GGTACCCACAGACTCTAAGATGG + Intronic
999751089 5:154628679-154628701 GGTTCCCTGATGCCCCAAGGGGG + Intergenic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1027138604 7:75640982-75641004 TGTTCTCACATACCCCTAGGAGG - Intronic
1029581441 7:101439118-101439140 GGTCCAAACAAACCCCAAGGTGG - Intronic
1033444064 7:141404965-141404987 TGTGCCCACATACTGCAAGGGGG - Intronic
1037292609 8:17367294-17367316 AGTACCCACAAACACTAAGGAGG + Intronic
1040621942 8:49101312-49101334 GGTACCAAGATACCCCAAATTGG + Intergenic
1046454519 8:114440797-114440819 GGTCCCCATATACCTCTAGGAGG + Intergenic
1049048682 8:140173649-140173671 GGTCCCCACATACCTCCAGTAGG + Intronic
1055574349 9:77647316-77647338 GGTCACCACAGACCCCAAGCTGG + Intronic
1056510305 9:87298312-87298334 AGTACCCACTTCCCCTAAGGAGG + Intergenic
1058945554 9:109852297-109852319 GGTACACACAGACACAAAGGTGG - Intronic
1060589565 9:124808323-124808345 GGTAGCTACATACCTCCAGGAGG + Intronic
1061867223 9:133499084-133499106 GGTCCCCAGATTCCCCAAAGTGG + Intergenic
1203524828 Un_GL000213v1:77996-78018 GGTAGCCACATGACCCAAGGGGG - Intergenic
1185446577 X:261077-261099 GAAACCCACATACCTCACGGTGG - Intergenic
1190329100 X:49224826-49224848 GGCACCCACCTCCACCAAGGTGG + Exonic
1192718263 X:73665808-73665830 GGCACCCACAGACACCAAGGAGG + Intronic
1197744230 X:129920263-129920285 GGTACCCACAGTCCTCAGGGTGG - Intronic
1198186083 X:134255411-134255433 GATACCCACATCACCCAAGCTGG - Intergenic