ID: 1077541653

View in Genome Browser
Species Human (GRCh38)
Location 11:3149345-3149367
Sequence CCTGGCCACCAGATAGGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 136}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077541653_1077541662 5 Left 1077541653 11:3149345-3149367 CCCTACCCTATCTGGTGGCCAGG 0: 1
1: 0
2: 1
3: 6
4: 136
Right 1077541662 11:3149373-3149395 GGCAAGATCTTGCAGTGTACTGG 0: 1
1: 0
2: 0
3: 6
4: 93
1077541653_1077541664 17 Left 1077541653 11:3149345-3149367 CCCTACCCTATCTGGTGGCCAGG 0: 1
1: 0
2: 1
3: 6
4: 136
Right 1077541664 11:3149385-3149407 CAGTGTACTGGCCTCTGGTGAGG 0: 1
1: 0
2: 2
3: 34
4: 287
1077541653_1077541666 21 Left 1077541653 11:3149345-3149367 CCCTACCCTATCTGGTGGCCAGG 0: 1
1: 0
2: 1
3: 6
4: 136
Right 1077541666 11:3149389-3149411 GTACTGGCCTCTGGTGAGGGAGG 0: 1
1: 0
2: 2
3: 20
4: 198
1077541653_1077541665 18 Left 1077541653 11:3149345-3149367 CCCTACCCTATCTGGTGGCCAGG 0: 1
1: 0
2: 1
3: 6
4: 136
Right 1077541665 11:3149386-3149408 AGTGTACTGGCCTCTGGTGAGGG 0: 1
1: 0
2: 2
3: 29
4: 346
1077541653_1077541663 12 Left 1077541653 11:3149345-3149367 CCCTACCCTATCTGGTGGCCAGG 0: 1
1: 0
2: 1
3: 6
4: 136
Right 1077541663 11:3149380-3149402 TCTTGCAGTGTACTGGCCTCTGG 0: 1
1: 0
2: 0
3: 9
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077541653 Original CRISPR CCTGGCCACCAGATAGGGTA GGG (reversed) Intronic
900306508 1:2011798-2011820 CCTGGCCACCACACAGGAAAGGG + Intergenic
902380408 1:16049905-16049927 GCTGGCCACCAGGTAGGCTCCGG + Exonic
903386550 1:22930610-22930632 CCTGGCTCCCAGTCAGGGTAGGG - Intergenic
903673133 1:25048096-25048118 CCTGGTCACCAGAAAGGGCTGGG + Intergenic
906990634 1:50733820-50733842 CCTGGGCAGCAGAGTGGGTATGG - Intronic
907534224 1:55134633-55134655 CCTGGCCACCTGCTAGTGAAGGG + Intronic
908316045 1:62933677-62933699 CCTGGCTACCTGATAGTGTGTGG + Intergenic
909949314 1:81701035-81701057 GCTGGCAAGCAGACAGGGTACGG + Intronic
911899203 1:103480030-103480052 CCTGGACACCAAATAGGTTGGGG - Intergenic
912480366 1:109978181-109978203 CCTGCACACCAGAGAGGGTGAGG + Intergenic
915831928 1:159139375-159139397 CCTGGACACAAAATAGGGAAAGG - Intronic
921164497 1:212496766-212496788 TTTGGCTACCAGATCGGGTAAGG - Intergenic
922676648 1:227557145-227557167 CCTGGGCACAAGATAGGTCATGG + Intergenic
1064464054 10:15562150-15562172 CCTCCCCACCTGATAGGGTTAGG - Intronic
1067053641 10:43039130-43039152 GCTGGACACCAGCTTGGGTAGGG - Intergenic
1067694066 10:48523138-48523160 CCTGTAAACCATATAGGGTAAGG - Intronic
1073928356 10:108544278-108544300 CTTGGCTACCAAATAGGGAAGGG - Intergenic
1073986387 10:109214723-109214745 CCTGGACACCAGGGAGGTTAAGG - Intergenic
1074869365 10:117564870-117564892 CCAGGCCACCCCACAGGGTAGGG - Intergenic
1077541653 11:3149345-3149367 CCTGGCCACCAGATAGGGTAGGG - Intronic
1081439485 11:43064740-43064762 CCTGGACACCAGGTAGATTATGG - Intergenic
1088535681 11:110858380-110858402 CCTGGTCAGCTGAAAGGGTATGG - Intergenic
1088607149 11:111542524-111542546 ACTGGCCAGCATATAGGGCAAGG - Intronic
1092798812 12:12142336-12142358 GCAGGCCCCCAGATATGGTAAGG + Intronic
1093561650 12:20549301-20549323 TCTGGCCACTAGATGGGGCATGG - Intronic
1096227326 12:49874548-49874570 CCTGGGCCCCAGATATGGCAGGG - Intronic
1096544858 12:52331030-52331052 CCTGGCCACCAGATAGTTATAGG + Intergenic
1098097357 12:66972915-66972937 CCTGGCCCCCAAACAGGGTCCGG + Intergenic
1102867051 12:116382818-116382840 CCTGCCCCCCATATAGGGAAGGG + Intergenic
1106165905 13:27246158-27246180 CCTGGCCACTATATAGGAAATGG + Intergenic
1113433105 13:110267221-110267243 CCTGGACACCAGATAGTGCGAGG - Intronic
1115848457 14:37565692-37565714 CCTGGTCAAAAGATAGGGAAAGG - Intergenic
1117346873 14:54841451-54841473 GCTGGCCACCAGTGAGGGCAGGG + Intergenic
1117436179 14:55717089-55717111 CCTGGGGACCAGACAAGGTAGGG - Intergenic
1122038288 14:98964274-98964296 CCTGGCCACCAGGAAGGATCTGG + Intergenic
1128527487 15:68422376-68422398 CCTGGTCACCAGAGAAGGAAAGG - Intronic
1131259075 15:90879335-90879357 CCTGGGCACCACAGATGGTATGG - Intronic
1131698016 15:94901353-94901375 CTTGGGGACCAGATAGGGCAGGG - Intergenic
1132942598 16:2515346-2515368 CCAGGCCACCAGGCAGGGTGGGG - Intronic
1134085593 16:11355374-11355396 GCTGGCCAGCAGATGGGCTAGGG + Intergenic
1135007310 16:18837687-18837709 CCTGGCTACCAGATAGGGAAGGG + Intronic
1136105181 16:28025282-28025304 CCTGGCCAGCAGCTAGGGCCAGG + Intronic
1136141008 16:28288726-28288748 CCTGGTCAGCAGAGAGGGCAGGG - Intergenic
1136537741 16:30910392-30910414 CCTGGCCACCAGACAGGACAGGG + Intergenic
1136671205 16:31859959-31859981 CTTGGCTACCAAATAGGGAAGGG + Intergenic
1137842260 16:51651335-51651357 CCTTGCCAGCAGCTCGGGTAGGG + Intergenic
1138531698 16:57637951-57637973 CCAGGCCAGCAGATAGGGTGGGG - Intronic
1140086061 16:71798312-71798334 CCTGGCTACTCGGTAGGGTAAGG - Intronic
1144833143 17:18142848-18142870 CCTTGGACCCAGATAGGGTAGGG - Intronic
1147422800 17:40331017-40331039 CCTGGCCCCCAGCTAGGGTGGGG + Exonic
1149583278 17:57766612-57766634 CCTGGCCACCTCATTGGGCAGGG + Intergenic
1151990238 17:77570077-77570099 CCTGGCCCCCAGAGAGGCTGTGG + Intergenic
1152094920 17:78267344-78267366 CCTGGCCTCCAGAGTGGGCAGGG - Intergenic
1152797819 17:82316614-82316636 CCTGGCCAGCAGCTGGGGTTGGG + Intronic
1156861925 18:41847036-41847058 CTTGGCCACCAAAGAGGTTATGG + Intergenic
1157284933 18:46371271-46371293 CCTGACCTCCTGATAGGGTTTGG - Intronic
1159502446 18:69291261-69291283 CCTAGCCCCAAGACAGGGTAGGG + Intergenic
1162011367 19:7817435-7817457 AATGGCCACAAGGTAGGGTATGG + Intergenic
1163463661 19:17454440-17454462 CCTGGCCAGGAGATAAAGTAGGG - Intronic
1164779628 19:30882020-30882042 GCTGGCCACCAGGAAGGGAATGG + Intergenic
1167851946 19:52208904-52208926 CCTGGAGACCACACAGGGTAGGG - Intronic
926774486 2:16408521-16408543 CATGGCCACAAGATGGAGTAAGG - Intergenic
927509727 2:23636928-23636950 CCTGGCAACTCGACAGGGTAGGG - Intronic
927645318 2:24873597-24873619 CCTGGCCGCCAGGCAGGGTTGGG - Intronic
928174909 2:29027000-29027022 CCAGGACACCAGGTAGGGCAGGG + Exonic
929447457 2:42012346-42012368 CCATACCACCAGATAGGGTGGGG - Intergenic
929484535 2:42342082-42342104 CCTCGCCACTAGAGAGGGTGGGG - Intronic
937218631 2:120328642-120328664 CTAGGCCACCAGCAAGGGTATGG - Intergenic
941614271 2:167701286-167701308 CGTGACCACCAGATATGGTGAGG + Intergenic
946369212 2:219270397-219270419 TCTGGACACCAGATTGGGGAAGG + Intronic
947508369 2:230727756-230727778 CCTCGCAACCAGCTAGGGGAAGG + Intronic
1169723314 20:8702239-8702261 CATGGCCACCAGGAAGGCTAAGG - Intronic
1172573534 20:35988755-35988777 CCTGGACACTAGATAAGGTGGGG - Intronic
1174042973 20:47713027-47713049 CCTGCCCCCCAGACAGGGTCTGG - Intronic
1175948146 20:62568227-62568249 CCTGGGCATCAGAGAGGGTGAGG + Intronic
1179303630 21:40135301-40135323 CCTGGCCTCCATATAGGGAGTGG + Intronic
1180741378 22:18055417-18055439 GCAGGCCACCAGAAAGGGTTTGG - Intergenic
1183195031 22:36347617-36347639 CCCAGCCACCAGAGAGGCTAAGG + Intronic
1185289819 22:50017668-50017690 CCTGGCCTCCATACAGGGTTGGG - Intronic
1185350462 22:50333943-50333965 CTTGGCTACCAAATAGGGAAGGG - Intergenic
951113616 3:18834325-18834347 CCTGGCTTCCAGATAGGATTTGG - Intergenic
954101386 3:48375311-48375333 CTTGGCCACCAGATAGTTAAGGG - Intronic
960680506 3:120242903-120242925 CTTGGTCACCACACAGGGTAAGG + Intronic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
962392486 3:134984579-134984601 CCTGGGCCCCAGAGAGGGAAGGG + Intronic
962392498 3:134984608-134984630 CCTGGGCCCCAGAGAGGGAAGGG + Intronic
962392510 3:134984637-134984659 CCTGGGCCCCAGAGAGGGAAGGG + Intronic
963606919 3:147420043-147420065 CCTAGAGACCAGAAAGGGTAGGG + Intronic
963887408 3:150597840-150597862 CCTGGACACCAGCCAGGGTCAGG + Intronic
968472849 4:789955-789977 CGTGGCCACCTGTTGGGGTAGGG - Intronic
969251842 4:5973437-5973459 CCTGAGCACCATAAAGGGTAAGG + Intronic
969477887 4:7431649-7431671 CCTGGCCACCGGATGGGCCATGG - Intronic
971002523 4:22338851-22338873 CCTGGCCTTCAGATAGGAGATGG + Intergenic
973265533 4:48206841-48206863 CCTAGCTACCAGAGAGGGTGAGG + Intronic
974989179 4:69063386-69063408 CCTGGGCACAAGATAGGTCAGGG + Intronic
979849375 4:125557122-125557144 CCTGGCCATCTGATATGGTTTGG - Intergenic
982117414 4:152109121-152109143 CCTGGCATCCAGAAAGGGTGGGG + Intergenic
982189993 4:152843910-152843932 CCTGGCCACAAGTCAGGGGAGGG - Intronic
982319978 4:154067575-154067597 CCGGGCCAACAGAGAGGCTATGG - Intergenic
986582680 5:9281663-9281685 CCAGATCACCAAATAGGGTAAGG + Intronic
986796629 5:11218963-11218985 CCTGGCCTGCACATAGGGTGTGG + Intronic
993379508 5:87190380-87190402 CCTGGCTTCCAGAGAGGGAAGGG - Intergenic
997538350 5:134640326-134640348 CCTGGCCACTCGGGAGGGTATGG + Intronic
999116807 5:149171549-149171571 CCTGGAGAGCAGATAGGGTATGG - Intronic
1002379664 5:178817640-178817662 CATGGCCACCTGATGGGGTAGGG - Intergenic
1004588989 6:17030709-17030731 CCTGCACACCAGAAAGGGTGGGG - Intergenic
1006295430 6:33168071-33168093 ACGGGCCACCAGGTAGGGTGTGG - Intronic
1006621748 6:35370179-35370201 CCTGGCCCACAGACAGGGTCAGG - Intronic
1008751952 6:54745940-54745962 CTTAACCACCAGATTGGGTATGG + Intergenic
1010797231 6:80131578-80131600 ACTGGCAACAAGATAGGGAATGG - Intronic
1011360397 6:86518053-86518075 CCTAGCAACCAGACATGGTAAGG + Intergenic
1014824407 6:126032215-126032237 TCTGGCCACCATGTAGGGCATGG - Intronic
1017064091 6:150512709-150512731 CCTTGCCAGCAGAAAGGGCATGG + Intergenic
1019540284 7:1548180-1548202 GATGGCCACCAGACAGGGCACGG - Intronic
1024030685 7:45457121-45457143 CCTGGACACCAGCTGGGGTGAGG - Intergenic
1024459788 7:49648267-49648289 CCTGGGCACCTGATATGGTTTGG - Intergenic
1026404724 7:70053391-70053413 CCTGGCCCAGGGATAGGGTAGGG - Intronic
1026569220 7:71514806-71514828 CCTGACCACCTGATATGGTTTGG + Intronic
1026892765 7:73992114-73992136 CCTGGGCAGCAGACAGGGTGAGG + Intergenic
1030003300 7:105089312-105089334 CCTGGCTACGCGATAGGCTAAGG - Intronic
1030026116 7:105326294-105326316 TCTGGCCACCATATGGGGAATGG - Intronic
1034270184 7:149799912-149799934 CCTGGCCTCCATCTGGGGTATGG - Intergenic
1037295056 8:17390949-17390971 CCTGGGCACCTGATATGGTCTGG - Intronic
1038590775 8:28835433-28835455 CCTGGCCAACTGTTAGAGTATGG - Intronic
1039214682 8:35256866-35256888 CTTAGCCACTAGATACGGTAGGG + Intronic
1041390994 8:57347383-57347405 CCTGGCCACGAGGTTGGATATGG + Intergenic
1045278132 8:100724853-100724875 CCTGACCACCAGGTAGGATTGGG + Intergenic
1047536781 8:125727243-125727265 CTAGGCCTCCAGAGAGGGTAGGG + Intergenic
1049781594 8:144431436-144431458 CCTGCCCACCAGATAGGACCCGG - Intronic
1050185205 9:2965759-2965781 CCAGGCCACCAGTCAGGGTAAGG + Intergenic
1054810517 9:69430419-69430441 CCTGGCCACCTGCCAGGGAAGGG + Exonic
1057211214 9:93202090-93202112 CCTGGCCTCCAGGTAGGCTTGGG + Intronic
1057545847 9:96020323-96020345 CCTGGCCCCCTGATATGGTTTGG - Intergenic
1060415587 9:123427520-123427542 CCAGGGCACCAGATAGAGGAGGG - Intronic
1061092942 9:128436947-128436969 CCTGGCCACCACCTTGGGCATGG + Exonic
1062089411 9:134667282-134667304 AGTGCCCACCAGATAGGCTAGGG - Intronic
1187137060 X:16558260-16558282 CCTGGTCACCAGGTAGAGGAGGG - Intergenic
1188728984 X:33622609-33622631 CACGGCCACCAGATAGAGTTGGG + Intergenic
1189197276 X:39162768-39162790 CCAGGCCACCAGATAGTTAAAGG + Intergenic
1196364859 X:114912836-114912858 CCTGGCCCTCTGATAGGGTTTGG - Intergenic
1198265601 X:135005849-135005871 ACTGGCCCCCAGATAGTGGAGGG - Intergenic
1198531253 X:137550923-137550945 CCTGGCGACCAGAGAGGGCTTGG - Intergenic
1200246681 X:154530242-154530264 CCTGGACCCTAGATAGGGAAAGG - Intergenic
1202015980 Y:20407106-20407128 CCTGCCCCCCAAATAGGGCATGG + Intergenic