ID: 1077543067

View in Genome Browser
Species Human (GRCh38)
Location 11:3156774-3156796
Sequence CTTCCACACAGGCCGAGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 217}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077543058_1077543067 3 Left 1077543058 11:3156748-3156770 CCTCCCTGCTCTGAGAGCCCATG 0: 1
1: 1
2: 4
3: 28
4: 327
Right 1077543067 11:3156774-3156796 CTTCCACACAGGCCGAGGGCCGG 0: 1
1: 0
2: 3
3: 19
4: 217
1077543056_1077543067 5 Left 1077543056 11:3156746-3156768 CCCCTCCCTGCTCTGAGAGCCCA 0: 1
1: 0
2: 6
3: 77
4: 561
Right 1077543067 11:3156774-3156796 CTTCCACACAGGCCGAGGGCCGG 0: 1
1: 0
2: 3
3: 19
4: 217
1077543059_1077543067 0 Left 1077543059 11:3156751-3156773 CCCTGCTCTGAGAGCCCATGCCA 0: 1
1: 1
2: 2
3: 40
4: 283
Right 1077543067 11:3156774-3156796 CTTCCACACAGGCCGAGGGCCGG 0: 1
1: 0
2: 3
3: 19
4: 217
1077543057_1077543067 4 Left 1077543057 11:3156747-3156769 CCCTCCCTGCTCTGAGAGCCCAT 0: 1
1: 0
2: 4
3: 39
4: 358
Right 1077543067 11:3156774-3156796 CTTCCACACAGGCCGAGGGCCGG 0: 1
1: 0
2: 3
3: 19
4: 217
1077543060_1077543067 -1 Left 1077543060 11:3156752-3156774 CCTGCTCTGAGAGCCCATGCCAC 0: 1
1: 1
2: 3
3: 20
4: 259
Right 1077543067 11:3156774-3156796 CTTCCACACAGGCCGAGGGCCGG 0: 1
1: 0
2: 3
3: 19
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077543067 Original CRISPR CTTCCACACAGGCCGAGGGC CGG Intronic
900043592 1:490634-490656 CTTCGACACAGGCAGCGGGAGGG + Intergenic
900065030 1:725637-725659 CTTCGACACAGGCAGCGGGAGGG + Intergenic
900137166 1:1122482-1122504 CGGCCTCACAGGCCGAGGCCAGG - Intergenic
900567534 1:3340975-3340997 CTGCCACACAGCCCGAGGGAAGG - Intronic
901323534 1:8353579-8353601 CTTTCTCCCAGGCTGAGGGCGGG - Exonic
903185406 1:21626236-21626258 CTCCGACACATGCCCAGGGCTGG - Intronic
903649337 1:24913497-24913519 CTTCCTCAAAGGCCAAGGCCTGG - Intronic
904336709 1:29802586-29802608 CATCCCCCCAGGCCCAGGGCTGG - Intergenic
904823115 1:33257766-33257788 GTTCCACACTGCTCGAGGGCAGG - Intronic
906238916 1:44229566-44229588 TTTCCACACAGGGTGCGGGCAGG + Intronic
906314368 1:44776689-44776711 CATCCACACAGTCCGTGTGCGGG + Exonic
907457487 1:54584892-54584914 CTGCCCCACAGGCCCAGAGCAGG + Intronic
907707864 1:56848150-56848172 GTTCCACACATTCCTAGGGCAGG + Intergenic
909660508 1:78076657-78076679 GTTCCTAACAGGCCAAGGGCTGG + Intronic
912252492 1:108025946-108025968 ATTCCTCACAGGCCAAGGGTAGG - Intergenic
912804401 1:112744010-112744032 CTTCCTCCCAGCCCCAGGGCTGG - Intergenic
916037414 1:160933550-160933572 CTTCCACACAGGGCGGCGGCTGG - Intergenic
920260224 1:204684106-204684128 CATGCACCCAGGCCGATGGCAGG - Intronic
921238735 1:213154653-213154675 GTTCCCCACTGGCCAAGGGCAGG + Intronic
921758419 1:218884553-218884575 GTTCCACAGAGCCCTAGGGCAGG + Intergenic
922099931 1:222471652-222471674 CTTCGACACAGGCAGCGGGAGGG + Intergenic
922261963 1:223951144-223951166 CTTCGACACAGGCAGCGGGAGGG + Intergenic
923083634 1:230684293-230684315 CTTCCTCCCAGGCTGAGGACTGG + Intronic
924343133 1:243053321-243053343 CTTCGACACAGGCAGCGGGAGGG + Intergenic
1066733355 10:38452253-38452275 CTTCGACACAGGCAGCGGGAGGG - Intergenic
1068168994 10:53369570-53369592 CTTCAACACAGGCAGAAAGCTGG - Intergenic
1068289508 10:54984385-54984407 CTTCCTCACAGGCATGGGGCAGG - Intronic
1068814506 10:61294431-61294453 CCTCCACACAGCCCAAGGACAGG + Intergenic
1072305997 10:94107954-94107976 ATTCCAGACAAGCCGTGGGCTGG + Intronic
1074247166 10:111706412-111706434 CTTCCTCACAGGGTGAAGGCAGG + Intergenic
1075117421 10:119638581-119638603 CATCCACACAGTCCGTGTGCGGG + Intergenic
1075538714 10:123294561-123294583 CTTCCTCACAGGGGCAGGGCAGG - Intergenic
1076120457 10:127932901-127932923 CTTCCACACAGGCTGTGGGCTGG + Intronic
1076969864 11:126865-126887 CTTCGACACAGGCAGCGGGAGGG + Intergenic
1077003017 11:334429-334451 CCTCCCCACAGGCTGAGGGTGGG + Intergenic
1077124159 11:925159-925181 CTGCCACACAGACCCTGGGCTGG + Intronic
1077298934 11:1838412-1838434 CTGCCACAGTGGCCGAGGGCTGG - Intergenic
1077334007 11:1995300-1995322 CTTCCAGACTAGGCGAGGGCAGG + Intergenic
1077543067 11:3156774-3156796 CTTCCACACAGGCCGAGGGCCGG + Intronic
1082030519 11:47600170-47600192 CTTCCTCACAGTCTGATGGCTGG - Intergenic
1083148212 11:60773987-60774009 CTTCCACACAGGCTCAGCTCAGG - Intronic
1083632345 11:64102312-64102334 CTTCCACACAGACGGAGGGCAGG - Intronic
1084147381 11:67272254-67272276 CTTCCACAGAGGTCAAGGGGGGG + Intronic
1084863696 11:72039363-72039385 CTGGCACCCAGGCCAAGGGCGGG - Intronic
1085326588 11:75611057-75611079 CCTACACACAGGCCTAGGGCTGG + Intronic
1087977479 11:104567205-104567227 GTTCCACAAAGGCTGAGGCCGGG + Intergenic
1088524456 11:110737944-110737966 CTTCCACAGAGGGCAAGGTCTGG + Intergenic
1088595384 11:111436943-111436965 TTGCCACACAGCCCCAGGGCAGG - Intronic
1089098261 11:115937862-115937884 CTTCCAGACTGGCTGAGGGCAGG + Intergenic
1089599624 11:119605383-119605405 CCTCCCCACAGGGAGAGGGCAGG + Intergenic
1202816990 11_KI270721v1_random:50482-50504 CTTCCAGACTAGGCGAGGGCAGG + Intergenic
1091589916 12:1836889-1836911 CTCCCACCCAGGGCCAGGGCTGG + Intronic
1091801524 12:3327661-3327683 CTGCCACACATGCCTGGGGCTGG + Intergenic
1092900027 12:13050020-13050042 CATCCACACAGGAAGAGTGCTGG - Intronic
1094002132 12:25706844-25706866 CTTCCACAGATCCCTAGGGCAGG - Intergenic
1095748594 12:45686864-45686886 CTTCCACAAAGCCCTTGGGCAGG + Intergenic
1097017348 12:55997001-55997023 CTTCCACACTGCCCGAGCTCCGG + Intergenic
1099495629 12:83342846-83342868 CTTCCACATATCCCTAGGGCAGG - Intergenic
1099969637 12:89487550-89487572 GTTCCACAGAGGCTGAGAGCAGG + Intronic
1101364917 12:104062878-104062900 GTTCCGAACAGGCCGAGGACTGG - Intronic
1101876915 12:108602206-108602228 ATTGCACACAGGCCAAGGTCAGG + Intergenic
1103750488 12:123155751-123155773 CTACCACAGAGGCAGTGGGCTGG + Exonic
1104961228 12:132489596-132489618 CTTCCACGCTCGCCGAGGGCAGG + Exonic
1107410941 13:40158306-40158328 CTTTCACTCAGGCCCCGGGCTGG + Intergenic
1108138026 13:47386236-47386258 GTTCCCCTCTGGCCGAGGGCAGG - Intergenic
1108494771 13:51014209-51014231 CTTCCTCATAGGCCAAGTGCAGG - Intergenic
1108579431 13:51816097-51816119 CTTCCACATAGGGGGCGGGCTGG - Intergenic
1109013081 13:56975086-56975108 CTTCCACACAGGATGAGGAGGGG - Intergenic
1110257225 13:73445391-73445413 CTTCCACACAGGAAGAGGAGGGG - Intergenic
1113389318 13:109880523-109880545 ATGCCACACAGCCGGAGGGCAGG + Intergenic
1114383502 14:22233033-22233055 CTTCCACAAATCCCTAGGGCAGG + Intergenic
1115560682 14:34580147-34580169 CTTTCACCCAGGCCGGAGGCTGG - Intronic
1115689197 14:35826300-35826322 CTTCCACCGAGCCAGAGGGCGGG - Exonic
1119320492 14:73727278-73727300 CTTCCACACAGAGGCAGGGCGGG + Intronic
1119720246 14:76885223-76885245 CTTCCACACTGGGCCTGGGCAGG + Intergenic
1119892241 14:78191649-78191671 CTTCCAGACATGTCTAGGGCTGG + Intergenic
1122941974 14:104985613-104985635 CTTCCACACTGGCCGAGCCCTGG - Intergenic
1122985181 14:105208588-105208610 CCAGCACCCAGGCCGAGGGCTGG + Intergenic
1123008017 14:105333725-105333747 GGTCCACACAGACCCAGGGCTGG + Intronic
1123804884 15:23860642-23860664 CTTCCAGAAAGCTCGAGGGCTGG + Intergenic
1125675518 15:41500428-41500450 CCTGTACACAGGCCCAGGGCAGG - Intronic
1125735073 15:41919171-41919193 CTTGCACAGAGGCCAGGGGCTGG - Intronic
1125828615 15:42695505-42695527 CTTCCTCCCAGGCCGTGGCCTGG - Intronic
1127053293 15:55106928-55106950 CTTCCACAGAGACCTAGGGCAGG - Intergenic
1128862129 15:71082926-71082948 GTTCCACAGAGGCCAACGGCAGG + Intergenic
1132087958 15:98923327-98923349 CTTCCTCACAGGCCGGGCTCGGG + Intronic
1132343523 15:101092810-101092832 CTACTGGACAGGCCGAGGGCAGG + Intergenic
1132796772 16:1728306-1728328 CCCTCACACACGCCGAGGGCTGG - Intronic
1132885378 16:2180010-2180032 CTTCCACCTTGGCCAAGGGCGGG + Exonic
1136232469 16:28894699-28894721 CTTGCACCCTGGCAGAGGGCTGG - Intronic
1137626317 16:49910955-49910977 CTTTCTCCCAGGCCCAGGGCTGG - Intergenic
1141908473 16:87042806-87042828 CATCCAGACAGGCAGAGGCCAGG + Intergenic
1142109612 16:88324166-88324188 CTTCCTCACAGCATGAGGGCTGG + Intergenic
1142450815 16:90172267-90172289 CTTCGACACAGGCAGCGGGAGGG - Intergenic
1142456750 17:61424-61446 CTTCGACACAGGCAGCGGGAGGG + Intergenic
1142810808 17:2394804-2394826 CTTGCACACAGCCCGGGGGATGG + Intronic
1142961983 17:3557027-3557049 CTGCCCCAGAGGCCCAGGGCAGG - Intronic
1143840229 17:9725941-9725963 CTTCCCCACCCCCCGAGGGCTGG + Intronic
1146744139 17:35313493-35313515 CTTCCACCGGGGCCGAGGTCAGG - Intergenic
1147597068 17:41724263-41724285 CTTCCTCCCAGGCCGTGGGAGGG + Exonic
1147923182 17:43931233-43931255 CTCCCAGACAGGGTGAGGGCAGG - Intergenic
1148340460 17:46870481-46870503 CTCCCAGACAGGGTGAGGGCAGG - Intronic
1149038543 17:52159683-52159705 CACCCACCCAGGCCGAGGCCAGG + Intronic
1150223629 17:63510904-63510926 CTTCCACACAGGCACTGAGCAGG + Intronic
1152423552 17:80206864-80206886 CCTCCGGACAGGCTGAGGGCAGG - Intronic
1152582564 17:81173043-81173065 CTTCCAGACAGCCCGTGGCCAGG + Intergenic
1152885465 17:82846631-82846653 CTTCCAGACAACCCGAAGGCAGG - Intronic
1156084290 18:33380221-33380243 CCTCATCACAGGCCGGGGGCAGG - Intronic
1157505397 18:48222667-48222689 TTTCCACACAGACACAGGGCAGG + Intronic
1159798428 18:72868993-72869015 CGTCCGCAGAGGCCGAGGGAGGG - Intergenic
1160616725 18:80136417-80136439 CTGGCCCACAGGCAGAGGGCTGG - Exonic
1160646667 19:196783-196805 CTTCGACACAGGCAGTGGGAGGG + Intergenic
1160904689 19:1446605-1446627 CTCCTGCAGAGGCCGAGGGCTGG - Intronic
1161081639 19:2313299-2313321 CTTCCACTCAGGACAAGGGGTGG + Intronic
1161519833 19:4717735-4717757 CTTCCAGACAGGCCGAGGCTTGG + Intronic
1165156879 19:33794618-33794640 CCTCCACAAAGGCCTGGGGCGGG + Intergenic
1167986495 19:53322760-53322782 CTACCACAGAGGCCTAAGGCTGG - Intergenic
1168667784 19:58217491-58217513 CTACCCCCCAGGCCGAGGACGGG - Intergenic
926126844 2:10277321-10277343 GCTCCACGCAGGCCGAGGGAAGG + Intergenic
927641949 2:24851106-24851128 CTTCCAGAGAAGCCGAGGTCAGG - Intronic
928987685 2:37196875-37196897 TTTCAACAGAGGCCGAGAGCTGG - Intronic
933892294 2:86783038-86783060 TTTGCACACAGACCCAGGGCAGG + Intergenic
934504546 2:94880265-94880287 CTTCCACACAGGCTGGCCGCTGG + Intergenic
934557433 2:95294845-95294867 GTTCCCCACAGGCCCAGGGGAGG + Intergenic
936036637 2:109118114-109118136 CTTCCACTCAGCCCAAAGGCTGG - Intergenic
937377620 2:121348467-121348489 ACCCCACACAGGCCGGGGGCAGG + Intronic
938370356 2:130764364-130764386 CCTCCACAGAGGCCCAGGCCTGG - Exonic
941307981 2:163894006-163894028 CTTCCACACAAGTCAAGGACTGG + Intergenic
941693724 2:168528382-168528404 CTTCCTCCCAGCCCTAGGGCTGG + Intronic
943675808 2:190715596-190715618 CTTCCAGAAAGGCAGAGGCCAGG + Intergenic
945169512 2:206981240-206981262 CTTCCAGAGATCCCGAGGGCAGG + Intergenic
947227889 2:227857704-227857726 TTTCCACACAGGAAGAGGACAGG + Intergenic
948362125 2:237429632-237429654 CTTGGATACAGGCTGAGGGCTGG - Intergenic
948849761 2:240699860-240699882 CTCCCACACAGGCAGAGAGCTGG + Intergenic
1170780045 20:19417076-19417098 CATACACAAAGGCCGATGGCAGG + Intronic
1171103851 20:22412960-22412982 CTTCAACATATGCCTAGGGCTGG - Intergenic
1174272631 20:49380708-49380730 CATTCACACAGACCGATGGCAGG - Intronic
1175153378 20:56953036-56953058 CTTCCACCCAGGACGAGGGACGG + Intergenic
1175658107 20:60789587-60789609 CTTCAAGCCAGGCTGAGGGCGGG - Intergenic
1175857842 20:62132275-62132297 CTTCCAGACAGGCCGAGTCTGGG + Intronic
1176278839 20:64289439-64289461 CTTCGACACAGGCAGCGGGAGGG - Intergenic
1177515606 21:22147658-22147680 CTTCCACAAATTCCAAGGGCAGG - Intergenic
1179783856 21:43719020-43719042 CTTCCTCCCAGCCCGGGGGCGGG + Intergenic
1179889851 21:44330055-44330077 TTGCCACATCGGCCGAGGGCAGG - Exonic
1180535157 22:16389370-16389392 CTTCCCCAGCGGCCCAGGGCTGG - Intergenic
1182764821 22:32751103-32751125 CTTCAACACCGGCTGGGGGCTGG - Intronic
1183075774 22:35426000-35426022 ATCCCACTCAGGCCGAGGTCAGG - Intergenic
1183492008 22:38121815-38121837 CTTCCACAGGGTCCAAGGGCGGG - Intronic
1184106989 22:42373525-42373547 CTTCCACACTGCCCCAGAGCTGG + Intergenic
1184130783 22:42515332-42515354 CTACCACCTAGGCTGAGGGCAGG - Intronic
1184140962 22:42577162-42577184 CTACCACCTAGGCTGAGGGCAGG - Intergenic
1185065107 22:48628217-48628239 CTTCTCCACAGGCCCAGGCCAGG + Intronic
950543280 3:13624885-13624907 CTTCCACACTGGCTTAGCGCTGG + Intronic
953136899 3:40189507-40189529 CTTCCAGGCAAGCCTAGGGCAGG + Intronic
954075333 3:48174392-48174414 CTTCAACACTGACCGAGTGCTGG + Exonic
955813070 3:62811703-62811725 CTTTCATACAGGGCAAGGGCTGG + Intronic
957990255 3:87617800-87617822 CTTCCACACAGGAAGAGGAGGGG + Intergenic
958142178 3:89575393-89575415 CATCCACACAGGCAGAGTGCAGG - Intergenic
960968383 3:123121394-123121416 CTTCTCCACAGGCCGAGACCAGG + Intronic
962375154 3:134852961-134852983 CTTCCATACTGTCAGAGGGCAGG + Intronic
968047471 3:195632123-195632145 CTTCCAGCCAGGCCTTGGGCCGG - Intergenic
968307142 3:197657801-197657823 CTTCCAGCCAGGCCTTGGGCCGG + Intergenic
968371014 3:198222739-198222761 CTTCGACACAGGCAGCGGGAGGG - Intergenic
968799641 4:2733563-2733585 CTTCCCCATAGGGCGAGGCCCGG - Intergenic
969651644 4:8471627-8471649 CTGCCCCACAGGCGGAGGCCTGG + Intronic
972503473 4:39698497-39698519 CTTCCTCACAGGCAGAAGGGCGG - Intronic
977465381 4:97378029-97378051 CTTCTACAGAGCCAGAGGGCTGG + Intronic
978576669 4:110196619-110196641 CAGCCACACAGGCACAGGGCTGG - Intronic
979259700 4:118635223-118635245 CTTCGACACAGGCAGCGGGAGGG - Intergenic
979328674 4:119405398-119405420 CTTCGACACAGGCAGCGGGAGGG + Intergenic
980989899 4:139730338-139730360 CTTCCTCACAGGCAGCAGGCAGG + Intronic
982395575 4:154911848-154911870 CTTCCACACACGGACAGGGCTGG + Intergenic
983015456 4:162607345-162607367 CTTCCACAGATCCCCAGGGCAGG - Intergenic
984699235 4:182807863-182807885 CTTCGGCAGAGGCCCAGGGCGGG - Intergenic
985571127 5:645889-645911 CGTCCACACAGGCCGCCGACGGG - Intronic
985809467 5:2072517-2072539 CTTCCACAGATTCCTAGGGCAGG - Intergenic
988651953 5:33162304-33162326 CATCCACACAGTCCGTGTGCAGG + Intergenic
990042185 5:51388811-51388833 CTTCCCCACAAGCAGAGTGCAGG - Intronic
991090344 5:62688442-62688464 CTGTCACCCAGGCTGAGGGCTGG + Intergenic
992162134 5:74014052-74014074 TTTCCAAACACGCCGAGGGCCGG + Intergenic
993016796 5:82543839-82543861 CTTCCACAGATCCCTAGGGCAGG - Intergenic
994725819 5:103434267-103434289 ATTCCATAGAGGCCGAGGCCTGG - Intergenic
995043826 5:107621259-107621281 CTACCAGACAGGCCCAGGGTTGG + Intronic
998468533 5:142364987-142365009 CTTCCACACAAAACCAGGGCAGG - Intergenic
999646242 5:153719556-153719578 CTTCCTCACAGCACGATGGCTGG + Intronic
1002583633 5:180226867-180226889 CATCCACACAGTCCGTGTGCAGG - Intergenic
1002730251 5:181328295-181328317 CTTCGACACAGGCAGCGGGAGGG - Intergenic
1002754279 6:145809-145831 CTTCGACACAGGCAGCGGGAGGG + Intergenic
1003120162 6:3312877-3312899 CTTTCAAACAGGCAGAGCGCAGG - Intronic
1004192969 6:13480456-13480478 CATCCACACTGCCTGAGGGCTGG + Intronic
1005597541 6:27393862-27393884 CTTCCACAGATCCCTAGGGCAGG - Intronic
1012039456 6:94185655-94185677 ATTCCACAGATCCCGAGGGCAGG + Intergenic
1013294488 6:108746645-108746667 CATCAGCACAGGCAGAGGGCAGG - Intergenic
1016162495 6:140898414-140898436 CTTCCACACAGGAAGAGGAGGGG + Intergenic
1017515492 6:155152450-155152472 ATTCCACACAGACAGAGAGCGGG - Intronic
1018930879 6:168239575-168239597 CTGCCACACGGGCCGAGGGCAGG - Intergenic
1021779083 7:24084269-24084291 CTTCCACAGATCCCTAGGGCAGG + Intergenic
1022232109 7:28424027-28424049 CTTCCTCACAGGCCCTGGGAAGG - Intronic
1023401426 7:39794845-39794867 CTTCGACACAGGCAGTGGGAGGG - Intergenic
1023491072 7:40742613-40742635 CTTCCTAACAGGCCAAGGACCGG + Intronic
1023940788 7:44767372-44767394 CTCACACACAGGCCGGGTGCGGG - Intronic
1024075406 7:45815489-45815511 CTTCGACACAGGCAGCGGGAGGG - Intergenic
1024648189 7:51385833-51385855 CTTCGACACAGGCAGTGGGAGGG + Intergenic
1025017555 7:55451185-55451207 CTTCCACACAGGCACAGGAGTGG + Intronic
1025129008 7:56365986-56366008 CTTCGACACAGGCAGCGGGAGGG + Intergenic
1025694404 7:63767514-63767536 CTTCGACACAGGCAGCGGGAGGG - Intergenic
1027677698 7:81180394-81180416 CTTCCACATATCCCTAGGGCAGG - Intronic
1029098241 7:98106294-98106316 AGTCCACACAGGGCCAGGGCGGG + Intergenic
1029481198 7:100814008-100814030 CTTCCGCAGAGAGCGAGGGCTGG - Exonic
1034285454 7:149880716-149880738 CCTGCACACAGGCAGAGGCCAGG - Intergenic
1039552138 8:38450925-38450947 TTCTCTCACAGGCCGAGGGCTGG + Intronic
1040059712 8:43093674-43093696 CCTCCGGACAGGCCGCGGGCAGG - Intronic
1042415599 8:68514226-68514248 CTTCCACACAGGATGAGGAGGGG + Intronic
1043399405 8:79868982-79869004 CATCCAGACAGGCAGAGAGCAGG - Intergenic
1044477722 8:92647651-92647673 GGTCCACACAGCCCGAGGGCTGG - Intergenic
1045115310 8:98974205-98974227 CCTCCCCACAGGCCCAGGGTCGG + Intergenic
1046521007 8:115325809-115325831 AATCCCCACAGGTCGAGGGCGGG - Intergenic
1046888873 8:119399925-119399947 CTTCCACAGAGCCCTAGGGCAGG - Intergenic
1047349534 8:124060472-124060494 TTTCCACACAGAGCCAGGGCAGG + Intronic
1047509587 8:125506055-125506077 CATTCCCACAGGCAGAGGGCTGG + Intergenic
1049253811 8:141603424-141603446 CTTCCCCACAGGCTGGGGGCTGG + Intergenic
1049393272 8:142382874-142382896 CCTCCACCCTGGACGAGGGCCGG - Intronic
1049598904 8:143498189-143498211 CTGCCACTCAGGCTGAGGTCTGG - Intronic
1051285576 9:15492648-15492670 CTTCCACACAGTCCTAGCACAGG + Intronic
1056685026 9:88752282-88752304 CCACCTCACAGGCCGAGGACTGG + Intergenic
1056764658 9:89437317-89437339 CTTCCTTACAGGCTGAGGGCAGG - Intronic
1056814542 9:89791927-89791949 CTTCCGCACAGGCTGAGAGCAGG + Intergenic
1061481751 9:130900867-130900889 CGTCCACACAGGCCTCTGGCTGG - Intergenic
1062689811 9:137835398-137835420 CAGCCACGCAGGCCGTGGGCAGG - Exonic
1062754663 9:138280809-138280831 CTTCGACACAGGCAGCGGGAGGG - Intergenic
1203578570 Un_KI270745v1:24969-24991 CTTCGACACAGGCAGCGGGAGGG - Intergenic
1190300673 X:49055181-49055203 CTTTCACACTTGCAGAGGGCAGG - Intronic
1191722780 X:64248621-64248643 CTTCCACACTGGCAGAGGAAAGG + Intergenic
1195571357 X:106401699-106401721 CTTCCACAAATGGAGAGGGCAGG - Intergenic
1196248498 X:113429167-113429189 CTCCCACCCTGGCCCAGGGCAGG - Intergenic
1198912838 X:141633726-141633748 CTTCCACACAGGCCAAGCAGAGG - Intronic
1199020551 X:142872318-142872340 CTTCCTCACAGGCTGAGAGCAGG + Intergenic
1199329624 X:146543573-146543595 CTTCCACAGATCCCCAGGGCAGG + Intergenic
1200016818 X:153170887-153170909 AATCCACACAGGTCAAGGGCAGG + Intergenic
1202101310 Y:21310483-21310505 CTTCCTAACAGGCCGCGGACAGG + Intergenic