ID: 1077543564

View in Genome Browser
Species Human (GRCh38)
Location 11:3159094-3159116
Sequence CCTTGTGTTCAGAGGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 217}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077543564_1077543571 -8 Left 1077543564 11:3159094-3159116 CCAGCCACCCTCTGAACACAAGG 0: 1
1: 0
2: 1
3: 19
4: 217
Right 1077543571 11:3159109-3159131 ACACAAGGGACAGCAGGTTGAGG 0: 1
1: 0
2: 2
3: 20
4: 243
1077543564_1077543572 -7 Left 1077543564 11:3159094-3159116 CCAGCCACCCTCTGAACACAAGG 0: 1
1: 0
2: 1
3: 19
4: 217
Right 1077543572 11:3159110-3159132 CACAAGGGACAGCAGGTTGAGGG 0: 1
1: 0
2: 4
3: 40
4: 267
1077543564_1077543573 -1 Left 1077543564 11:3159094-3159116 CCAGCCACCCTCTGAACACAAGG 0: 1
1: 0
2: 1
3: 19
4: 217
Right 1077543573 11:3159116-3159138 GGACAGCAGGTTGAGGGCACAGG 0: 1
1: 2
2: 3
3: 36
4: 329
1077543564_1077543574 23 Left 1077543564 11:3159094-3159116 CCAGCCACCCTCTGAACACAAGG 0: 1
1: 0
2: 1
3: 19
4: 217
Right 1077543574 11:3159140-3159162 GAGAGTGTGCACGCACCCTGAGG 0: 1
1: 0
2: 0
3: 8
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077543564 Original CRISPR CCTTGTGTTCAGAGGGTGGC TGG (reversed) Intronic
903224546 1:21887308-21887330 CGTTGGGCTCACAGGGTGGCGGG + Exonic
903263910 1:22145088-22145110 CCTTGTGATGAGAGGTTAGCTGG + Intergenic
903504845 1:23825977-23825999 TCTTGTGTTTAGAGTGTGGGAGG + Intronic
905178039 1:36150298-36150320 GCTTGTTTTTGGAGGGTGGCTGG - Intronic
905545102 1:38791551-38791573 CATTGTGCTGAGAGGGTGGGTGG - Intergenic
905875370 1:41428687-41428709 CCTTCTGTTCTCATGGTGGCTGG - Intergenic
906663046 1:47596050-47596072 GCATGTCTTCAGATGGTGGCAGG + Intergenic
907936795 1:59048897-59048919 AAATGTGTTCAGAGAGTGGCAGG + Intergenic
909854218 1:80507645-80507667 CCTTGTGTTCAGAGGATTTCAGG - Intergenic
910227469 1:84950730-84950752 GCTTGTGTTCAGAGACAGGCAGG - Intronic
911261777 1:95694846-95694868 ACTTCTGTTTGGAGGGTGGCAGG + Intergenic
912179663 1:107204572-107204594 GATTGTATTCAGATGGTGGCTGG - Intronic
912547418 1:110460936-110460958 CCTGGTATCCAGAGGGAGGCCGG + Intergenic
912550955 1:110484988-110485010 CCGTGTGGGCAGAGAGTGGCTGG - Intergenic
916171047 1:162002018-162002040 CCCTGTGTCCACAGTGTGGCGGG + Intronic
918994858 1:191744175-191744197 CCTTGTCTTCACATGGTGGAAGG + Intergenic
920539767 1:206769553-206769575 CACTGTGTTCACAGGCTGGCCGG + Intronic
921490161 1:215765641-215765663 CCATGTGTTCAGAGGTGGGATGG - Intronic
921839762 1:219815819-219815841 TCCTGTGTTTGGAGGGTGGCAGG + Intronic
922243335 1:223771303-223771325 CCTTGTGATCAGAGTCTGGCTGG - Intronic
922417972 1:225439057-225439079 CCTTGTCTTCAGGTGTTGGCTGG - Intergenic
922451014 1:225737359-225737381 CCTGGTGTCCAGGGTGTGGCTGG + Intergenic
922910393 1:229210929-229210951 CCATGTGTTGAGATGGTGGAGGG - Intergenic
923207022 1:231768969-231768991 TCCTGTGTTCAGAGGGCAGCTGG + Intronic
924464321 1:244286258-244286280 CAGTGTTTTCAGAGGGTGGCAGG - Intergenic
1064238124 10:13596370-13596392 CATTGGGTTCAAATGGTGGCAGG + Intronic
1064910257 10:20393521-20393543 CCTTGTGTGCCTTGGGTGGCTGG + Intergenic
1067078386 10:43200768-43200790 CCTTGTCTACAGCCGGTGGCCGG + Exonic
1067582201 10:47452854-47452876 CCTTGGGTGCAGGGGCTGGCGGG - Intergenic
1067895110 10:50170495-50170517 CACTGTCTTCACAGGGTGGCAGG - Intergenic
1072306568 10:94113478-94113500 CTGAGTGTTCAGAGGGTGGATGG + Intronic
1073293699 10:102425652-102425674 CCCTTTGTGCAGAGGGTGGGTGG - Intronic
1074532551 10:114306945-114306967 TCTTGTGTTTTGAGGCTGGCAGG - Intronic
1075348561 10:121703258-121703280 CCTTGGGTTAAGAGGTGGGCTGG - Intergenic
1075787094 10:125057403-125057425 CCTGTTGTTTAGAGGGAGGCGGG - Intronic
1076216473 10:128697776-128697798 CCTTGTGCTGAGAGGGGGTCTGG - Intergenic
1076216658 10:128699949-128699971 CCTTGTGCTGAGAGGGGGTCTGG - Intergenic
1076685018 10:132194611-132194633 TTCTGTGCTCAGAGGGTGGCTGG + Intronic
1077543564 11:3159094-3159116 CCTTGTGTTCAGAGGGTGGCTGG - Intronic
1083923823 11:65794170-65794192 CCATGTCTTCAGAGGGCAGCTGG - Exonic
1086303815 11:85459042-85459064 CCTGGTGATGAGAGGGTGTCAGG + Intronic
1089652339 11:119922446-119922468 CTTTGTGAGCAGAGTGTGGCTGG + Intergenic
1089835323 11:121365424-121365446 CCCTGTGTTCAGAGATTGTCAGG - Intergenic
1090187379 11:124747200-124747222 CCAAGTGTTCAGAGGGTGCCGGG + Exonic
1091727070 12:2853773-2853795 CCGTGAGTTCCCAGGGTGGCCGG + Intronic
1095410112 12:41912158-41912180 CCTTCTGTCCAGAGGCTGACTGG - Intergenic
1096486243 12:51983521-51983543 GGCTGTGTTCAGAGGGTCGCTGG + Intronic
1097456841 12:59809322-59809344 CCTTGTGATCTGAGTGTGGATGG + Intergenic
1101735453 12:107459810-107459832 CCCTGTGTGCTGTGGGTGGCAGG + Intronic
1102446478 12:113006860-113006882 CCTTGCCTACAGAGGGTGGGTGG + Intronic
1104471424 12:129032889-129032911 CCTTGTGAGCAGAGGGATGCAGG - Intergenic
1105874620 13:24541137-24541159 CCCTGAATTCAGAGGGAGGCTGG + Intergenic
1106078325 13:26479712-26479734 GCTTGTGTTCAGAGTGGGGGAGG + Intergenic
1106430703 13:29677747-29677769 CCTTGTCTTCAAAGGGAGACTGG - Intergenic
1107028233 13:35825010-35825032 CTATGTGTTCAGAGGAAGGCAGG - Intronic
1107977903 13:45707224-45707246 GCTTGTGTGCAGGGGGTGGTGGG + Intronic
1108642525 13:52395923-52395945 ACTTGGGTGCAGTGGGTGGCTGG + Intronic
1108698997 13:52927709-52927731 GCTTGTGCTGAGAGGATGGCAGG + Intergenic
1108807806 13:54181413-54181435 ACTTGTGGGCAGAGGGTGGGAGG - Intergenic
1109197842 13:59398340-59398362 CCTTTTTTCCAGAGGCTGGCTGG - Intergenic
1113641360 13:111959607-111959629 CCTTGTGTTCAGAGGATTCCAGG + Intergenic
1115556190 14:34546656-34546678 CCGTGTGTTGAGAGTGTGGTGGG + Intergenic
1115557718 14:34556425-34556447 CCGTGTGTTGAGAGTGTGGTGGG - Intergenic
1118273072 14:64361544-64361566 CCTTGCTTTCAGAGTTTGGCTGG + Intergenic
1118786341 14:69048635-69048657 CCTTGTGATCAGTAGCTGGCTGG - Intergenic
1119562454 14:75602129-75602151 CCAGGTGCTGAGAGGGTGGCAGG - Intronic
1122564648 14:102644081-102644103 AGTTGTGTTCACATGGTGGCTGG + Intronic
1124201127 15:27679320-27679342 CGGTGTTTTAAGAGGGTGGCAGG + Intergenic
1126580822 15:50241148-50241170 CCCTGTGTTCAGGGGTTCGCTGG - Intergenic
1127211018 15:56774769-56774791 CTTCCTGTTCAGAGGGTGGAGGG - Intronic
1128541910 15:68541925-68541947 CCCTGGGTTGAGAGGGTGGAAGG - Intergenic
1129674073 15:77622915-77622937 CAGTGTGGGCAGAGGGTGGCCGG - Intronic
1131340524 15:91596476-91596498 ACTGGTGTTCTGAGGGTGGAGGG + Intergenic
1135349755 16:21718759-21718781 CCTGGTGTTCAGAACCTGGCAGG + Intronic
1135481835 16:22827170-22827192 CCCTGAGGACAGAGGGTGGCTGG + Intronic
1138724236 16:59118502-59118524 CCTTGTCTGCAGTGGGTGGGTGG + Intergenic
1139038089 16:62972319-62972341 ATTTGTGTTCAGAATGTGGCTGG + Intergenic
1141631468 16:85290277-85290299 CCTTGTGATGAGAAGATGGCAGG - Intergenic
1142965420 17:3577810-3577832 CCTTTTGTTCTGGGGGTGCCAGG - Intronic
1143124669 17:4634026-4634048 ACTTGTGGACAGAGGGTGGAAGG + Intronic
1143203773 17:5129526-5129548 CCTTGTGTTCAAAGGGGTCCAGG + Intronic
1144092651 17:11871892-11871914 CCTGGTGCTCAGGGGGTGGTGGG - Intronic
1144826695 17:18109184-18109206 CCTTGAGTTCACAGGGTGTCAGG + Intronic
1144874957 17:18392637-18392659 CCTTGTGTTCAAAGGGGTCCGGG + Intergenic
1145157267 17:20551784-20551806 CCTTGTGTTCAAAGGGGTCCGGG - Intergenic
1146844809 17:36175864-36175886 CCTTGTGTTCAAAGGGGTCCGGG - Intronic
1146857114 17:36263799-36263821 CCTTGTGTTCAAAGGGGTCCGGG - Intronic
1146863501 17:36324576-36324598 CCTTGTGTTCAAAGGGGTCCGGG + Intronic
1146873026 17:36387709-36387731 CCTTGTGTTCAAAGGGGTCCGGG - Intronic
1146880384 17:36438795-36438817 CCTTGTGTTCAAAGGGGTCCGGG - Intronic
1147066361 17:37925164-37925186 CCTTGTGTTCAAAGGGGTCCGGG + Intronic
1147075909 17:37988334-37988356 CCTTGTGTTCAAAGGGGTCCGGG - Intronic
1147077894 17:38004725-38004747 CCTTGTGTTCAAAGGGGTCCGGG + Intronic
1147087434 17:38067880-38067902 CCTTGTGTTCAAAGGGGTCCGGG - Intronic
1147093830 17:38128660-38128682 CCTTGTGTTCAAAGGGGTCCGGG + Intergenic
1147103378 17:38191843-38191865 CCTTGTGTTCAAAGGGGTCCGGG - Intergenic
1150474354 17:65463381-65463403 CAGTGTGCTCAGAGGCTGGCTGG - Intergenic
1151457264 17:74233472-74233494 CCTTGGGGTCAGCGGGAGGCTGG + Intronic
1152294142 17:79456861-79456883 CCCTGTGCTGAGTGGGTGGCTGG - Intronic
1152436491 17:80279336-80279358 CCTTGTGTTCAGGCAGAGGCTGG - Intronic
1152762792 17:82118186-82118208 ACTTCTGTTCTGAGGGTGGCTGG + Intronic
1156503249 18:37573020-37573042 GCTTGTGTTCCAAGGGTGGCAGG + Intergenic
1156619798 18:38836007-38836029 CCTTGTGTTAATATGGTGGTAGG - Intergenic
1158033472 18:52995726-52995748 CCTTATGTTCAGATGTTAGCTGG - Intronic
1160598565 18:79994885-79994907 CCTTCGGTTCAGTGAGTGGCAGG - Intronic
1161166874 19:2792464-2792486 CCGTGTGTTTAGAGGGGGGGTGG - Intronic
1161429654 19:4224264-4224286 CCTTCTGTACAGTGGGAGGCTGG + Intronic
1163103480 19:15110507-15110529 CCTTGTGTCCTCAGGGTGCCAGG + Exonic
1164719462 19:30421807-30421829 TCTCGTGTACAGAGGGAGGCTGG - Intronic
1165314680 19:35047354-35047376 CCTTGTGGTCTGTGTGTGGCTGG + Intronic
1165438082 19:35807606-35807628 CCTCGTGTTCAAAGAGTAGCAGG - Intronic
1165523437 19:36332092-36332114 CTTGGTGTTCACCGGGTGGCAGG - Intergenic
1166205399 19:41265585-41265607 CCTGGTGTCCAGAGGCTGGCGGG + Intronic
1166558750 19:43718531-43718553 CCAGTGGTTCAGAGGGTGGCGGG - Exonic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
926232942 2:11018694-11018716 GCATCTGTTCAGATGGTGGCTGG - Intergenic
926531306 2:14049665-14049687 CCTTGAGGGCAGAGGGTGGGAGG - Intergenic
930881933 2:56280071-56280093 CCTTGTGTTTAGAGGTGGGGGGG - Intronic
931627999 2:64274158-64274180 CCCAGTGATCAGAGGCTGGCTGG + Intergenic
931963286 2:67505145-67505167 CGCTGTCTTCACAGGGTGGCAGG - Intergenic
932303498 2:70685360-70685382 CCTTCTCTTCATAGGGTGACGGG - Intronic
935476701 2:103531275-103531297 ACTTGGGTTCAGAGGATTGCTGG - Intergenic
936754195 2:115685810-115685832 CCTTGTGTTCAAATTCTGGCAGG + Intronic
936766752 2:115859372-115859394 GCTTGTGTGCTGATGGTGGCAGG + Intergenic
937750721 2:125473539-125473561 CCCTGTGCTCAGAGGGTTTCAGG + Intergenic
938086581 2:128405932-128405954 ACTGGTGTTCAGAGGGAGGGAGG + Intergenic
938970040 2:136423616-136423638 CCTGGTGTCCACAAGGTGGCAGG + Intergenic
942111554 2:172687862-172687884 CTTTGTGTTCAGTGGGCAGCAGG - Intergenic
1172011713 20:31849553-31849575 GCGTGTGTTCAGCAGGTGGCAGG + Intronic
1172150807 20:32789062-32789084 CTTTGTCTTCAAAGGGAGGCAGG - Intronic
1172332448 20:34084788-34084810 CTTTGTTCTCAGACGGTGGCTGG - Intronic
1172977730 20:38919267-38919289 CGCTGTGTTCAGAGGGAGCCAGG + Exonic
1173498040 20:43533269-43533291 CCATGCTTTCAGAGGATGGCAGG + Intronic
1173697564 20:45032418-45032440 CCTTGAGGGCAGAGGGTGGGAGG - Intronic
1174132302 20:48354364-48354386 CCTGGAGCTCAGAGGGTGGGAGG + Intergenic
1174508738 20:51034938-51034960 CCTGGTGTGCAGAGGGCTGCTGG - Intergenic
1175279212 20:57791946-57791968 GATTGTGTGCACAGGGTGGCGGG - Intergenic
1175501218 20:59452596-59452618 TGTTGTTTTCAGAGGCTGGCAGG - Intergenic
1176131645 20:63498966-63498988 CCTGGGGGGCAGAGGGTGGCCGG - Intronic
1180091599 21:45536386-45536408 CCATCTGGTCAGTGGGTGGCAGG + Intronic
1180945258 22:19689024-19689046 GCCTGTGAGCAGAGGGTGGCAGG - Intergenic
1181777611 22:25170843-25170865 CCTTGGGTTCAGTGGGCTGCCGG - Exonic
1182653896 22:31874282-31874304 CCTTCTGTTCAGAGAGCAGCTGG - Exonic
1183177286 22:36233283-36233305 TCCTGTGTACAGAGGGAGGCTGG + Intronic
1183943543 22:41310466-41310488 CCTTGTGCTGACAGGGAGGCAGG - Intronic
1184157291 22:42676460-42676482 CCTTGTTTTCCCAGCGTGGCTGG + Intergenic
949581684 3:5394805-5394827 CCTTCCTTTAAGAGGGTGGCTGG + Intergenic
950273374 3:11638225-11638247 CCTTGTATTCCTAGGGTGCCTGG - Intronic
954590024 3:51775332-51775354 CTCCGTGTGCAGAGGGTGGCAGG - Intergenic
957521065 3:81319196-81319218 CATTGTGTTGAGAGGGATGCAGG - Intergenic
959016763 3:101143587-101143609 CCCAATGTTCAGAGGATGGCTGG + Intergenic
959170275 3:102835933-102835955 CCATGAGTACAGAGGGTAGCTGG + Intergenic
962014177 3:131423461-131423483 GTTTGTATTCAGATGGTGGCTGG - Intergenic
963835850 3:150057134-150057156 CCCTGTGTTCAGTTTGTGGCAGG - Intergenic
967282304 3:187834042-187834064 CCCTGTGTGAAGAAGGTGGCTGG + Intergenic
968528107 4:1074810-1074832 TCTGGTGTTCACAGGATGGCAGG - Intronic
969258590 4:6019849-6019871 CCTAGTGTTCAGTGGGAGGAAGG + Intergenic
969446729 4:7249151-7249173 GCTTGTGTTCAGATGGTGGCTGG + Intronic
970976500 4:22048239-22048261 CCTAGAGTTCAGAGGGTGTATGG - Intergenic
971614573 4:28771383-28771405 CCTTGTCTTCACATGGTGGAAGG + Intergenic
972694599 4:41433478-41433500 CCCTGTGTTCAGTTGGTGCCGGG + Intronic
977334058 4:95673685-95673707 CCTTGTGTCTAGAGTTTGGCTGG - Intergenic
979894647 4:126144976-126144998 CCTTCAGTTAAGAGGGAGGCAGG - Intergenic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
981388364 4:144158223-144158245 CCTTGTGGGTGGAGGGTGGCAGG - Intergenic
982446559 4:155497495-155497517 CCTTGTGTCCACATGGTGGAAGG + Intergenic
983523572 4:168736671-168736693 CCTGATGTTCAGATGGTGGATGG - Intronic
985164935 4:187082969-187082991 CCCTGTGATCACAGGCTGGCAGG + Intergenic
985495853 5:205140-205162 ACTTCTGCTCAGACGGTGGCGGG + Exonic
985588916 5:754898-754920 CCTCGTGTTGAAAGGGTGGAGGG - Intronic
989739642 5:44755616-44755638 GCTTGTGGTCAGATGGTGGCTGG - Intergenic
990923099 5:60989742-60989764 ACTTGAGGTCAGAGGGTGGGAGG + Intronic
991214322 5:64144759-64144781 GCTGGTGATCAGAGGGTGGAAGG - Intergenic
991958528 5:72019326-72019348 GCTTGTGGTGAGAGGGTGGCAGG - Intergenic
992089572 5:73304954-73304976 TCTTGAGTACAGAGGGAGGCAGG + Intergenic
996697790 5:126417981-126418003 AATTGTGTTCAGTGTGTGGCAGG + Intronic
996917319 5:128727806-128727828 GCTTTTGTTCAGAAGGTGACTGG - Intronic
998895723 5:146797877-146797899 CCTGGAGTTCAGAGGTTGGCAGG + Intronic
999275238 5:150325654-150325676 CTTGGTGTGCAGAGGGTGGAGGG - Intronic
999303071 5:150502915-150502937 CCCAGGGTTCTGAGGGTGGCAGG + Intronic
1000813339 5:165889792-165889814 TTTTGTGTTCAGTAGGTGGCAGG + Intergenic
1001454265 5:171848648-171848670 CACTGTGGTCAGAGGCTGGCGGG + Intergenic
1002102196 5:176863135-176863157 ACTTGGGCTCCGAGGGTGGCGGG - Intronic
1002212171 5:177605560-177605582 CCCTGTGCACAGAGGCTGGCAGG - Intronic
1004222000 6:13755108-13755130 CCTTGGGTCCTGAGGGTGTCAGG + Intergenic
1004863233 6:19827715-19827737 GCGTATGTTCAGAGAGTGGCTGG - Intergenic
1005923152 6:30418280-30418302 CCTGGAGTGCAGAGGGTGGGTGG + Intergenic
1007809136 6:44474102-44474124 CCTTGTGGTCAGAGGGATGGTGG + Intergenic
1007922959 6:45627231-45627253 CCGTGTGTACAGAGGAAGGCTGG - Intronic
1008513740 6:52300325-52300347 CCTTTATTTCAGAGAGTGGCTGG - Intergenic
1012566885 6:100667347-100667369 CATTCTGTTCAGAGGGTGTGGGG + Intronic
1013970502 6:116012300-116012322 GCTTGTGTCCAGATGGTGGAAGG - Intronic
1014374597 6:120657465-120657487 CCCAGTGTTCAGATGGTTGCTGG + Intergenic
1014688930 6:124537019-124537041 CCACGTGGTCACAGGGTGGCAGG - Intronic
1018229703 6:161663822-161663844 CCCTGTGGTGAGAGGGTGGCTGG + Intronic
1019434955 7:1017799-1017821 CCTTGTGTGCAGTGGGGGGCGGG - Intronic
1023866400 7:44240453-44240475 GCTCGTGTTCAGGGGGTGGAGGG + Intronic
1023873832 7:44276431-44276453 CCCTTTGTGCAGTGGGTGGCGGG - Intronic
1026227230 7:68453054-68453076 CATTGTGTACAGAGGGTGAGGGG + Intergenic
1026439289 7:70429877-70429899 CATTGTGTTGAGAGAGTGGTTGG + Intronic
1027793930 7:82668410-82668432 CCTCCTCTTCACAGGGTGGCAGG + Intergenic
1028489636 7:91396771-91396793 CCATGTGTCCATAGGTTGGCTGG - Intergenic
1029090600 7:98045134-98045156 CCTTGTGTGCAGAGTGCTGCAGG - Intergenic
1029156830 7:98523147-98523169 GGTTGTGTTCAGAGGGTGCAAGG - Intergenic
1031690885 7:124786285-124786307 GCATCTCTTCAGAGGGTGGCAGG - Intronic
1032670689 7:134079840-134079862 CCTTGTGCTCTGAGGCAGGCTGG - Intergenic
1033311282 7:140263922-140263944 CAGTGTGTTCAGAGGGTCCCTGG - Intergenic
1033991253 7:147290107-147290129 TATTGTGATCAGAGGCTGGCAGG - Intronic
1035589621 8:802597-802619 CTGTGGGTTCTGAGGGTGGCTGG - Intergenic
1035769123 8:2132914-2132936 CCTTATGTCCACAGGGTGGGAGG + Intronic
1036525180 8:9528401-9528423 CCTTGTGTCCAGAGGGCTGGAGG - Intergenic
1037607812 8:20452426-20452448 CCTTATTTTCAGAGGGTGATTGG + Intergenic
1041200992 8:55451916-55451938 CCTGGTCCTCAGAGGGCGGCTGG + Intronic
1042414931 8:68508614-68508636 TCATGTGTCCAGAGGTTGGCTGG + Intronic
1042463710 8:69101919-69101941 GCTTGTTTTCACAGGGTGGAGGG - Intergenic
1045810613 8:106216048-106216070 ACTTGTGTGCAGAGTATGGCTGG + Intergenic
1047798839 8:128287847-128287869 CCTTGAGTTCAGAGTCTAGCAGG - Intergenic
1048374304 8:133809284-133809306 CCTTTTGATCATAGGGTGGCTGG - Intergenic
1049204996 8:141359519-141359541 CCTTGTGTGGTGGGGGTGGCAGG - Intronic
1049586101 8:143433038-143433060 CCTTGGGTTGGGAGGCTGGCGGG - Intergenic
1052358275 9:27528505-27528527 CCTTGTGGTTAGAGGGCGGAGGG - Intronic
1055951956 9:81737728-81737750 GGTTGTGTTCAGATGGTGCCTGG + Intergenic
1057185575 9:93055847-93055869 ACTTGCCTTGAGAGGGTGGCAGG + Intergenic
1058633750 9:107016674-107016696 CCTGGTGTTCTGGGGATGGCAGG + Intergenic
1059736708 9:117107658-117107680 TCTTGTGTTCAGAGAGAGGGAGG - Intronic
1061334465 9:129922530-129922552 CCTGGGCTTCATAGGGTGGCTGG + Intronic
1061405289 9:130390432-130390454 CTTTGTGTTGAGAGGCTGGCTGG + Intronic
1061545053 9:131299586-131299608 CCCTGTGGTCTGAGGGTGGCAGG + Intronic
1061695052 9:132367157-132367179 TCTGGTGTTCAGAGGGAGGTCGG + Intergenic
1061806544 9:133140425-133140447 CTTTGTGTTCCGAGGGAGGAAGG - Intronic
1062145155 9:134984972-134984994 CCATGTGTGCAGAGGGTGTCTGG + Intergenic
1189267218 X:39726055-39726077 CCCTGTGTGCAGGGGCTGGCAGG + Intergenic
1189464646 X:41269173-41269195 CCCTCTGTTCTCAGGGTGGCAGG + Intergenic
1190065552 X:47239460-47239482 CCTTGCGTTCAATGGGTGGCTGG - Exonic
1190845125 X:54183699-54183721 CCTTGTGCTCACAGGGTCACAGG + Intergenic
1194609172 X:96019583-96019605 CACCTTGTTCAGAGGGTGGCAGG - Intergenic
1196681487 X:118474372-118474394 CCTTGTGTGAAGAGGGTACCAGG + Intergenic
1200361951 X:155616480-155616502 TCTTGTGCTCAGAGATTGGCTGG + Intronic