ID: 1077544179

View in Genome Browser
Species Human (GRCh38)
Location 11:3161954-3161976
Sequence CTGTGAGCAAGGAGGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 735
Summary {0: 1, 1: 0, 2: 6, 3: 70, 4: 658}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077544169_1077544179 -3 Left 1077544169 11:3161934-3161956 CCGGGGCTGACGCCAGACCCCTG 0: 1
1: 0
2: 1
3: 44
4: 1466
Right 1077544179 11:3161954-3161976 CTGTGAGCAAGGAGGGGAGAGGG 0: 1
1: 0
2: 6
3: 70
4: 658
1077544167_1077544179 12 Left 1077544167 11:3161919-3161941 CCCTGGAGTAAGAAGCCGGGGCT 0: 1
1: 0
2: 0
3: 7
4: 128
Right 1077544179 11:3161954-3161976 CTGTGAGCAAGGAGGGGAGAGGG 0: 1
1: 0
2: 6
3: 70
4: 658
1077544168_1077544179 11 Left 1077544168 11:3161920-3161942 CCTGGAGTAAGAAGCCGGGGCTG 0: 1
1: 0
2: 1
3: 18
4: 142
Right 1077544179 11:3161954-3161976 CTGTGAGCAAGGAGGGGAGAGGG 0: 1
1: 0
2: 6
3: 70
4: 658

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077544179 Original CRISPR CTGTGAGCAAGGAGGGGAGA GGG Intronic
900129580 1:1081695-1081717 CTGGGGGCAAGGAGGTGGGACGG - Intergenic
900276566 1:1833436-1833458 CTGTGAGGAATAAGGGGAGCAGG + Intronic
900319655 1:2076272-2076294 ATGTGAGGGAGGTGGGGAGATGG - Intronic
900740409 1:4327569-4327591 CTGTGGGCAGTGTGGGGAGAAGG - Intergenic
901078776 1:6571906-6571928 CTCTGAGCCAGGAGGGAAGAAGG - Intronic
901167308 1:7229693-7229715 CTGTGAGCCAGGAGCACAGAGGG + Intronic
901672621 1:10865111-10865133 AGGGGAGCAGGGAGGGGAGAAGG + Intergenic
901879673 1:12186321-12186343 CTGTGAGGAAGGGGAGGAGGAGG + Intronic
902072572 1:13753101-13753123 CTGTGACGTAGGAGGGAAGAGGG - Intronic
902663532 1:17921786-17921808 CTCGGAGCCAGGAGGGGACAGGG - Intergenic
903773384 1:25778082-25778104 CTGGGAGCAAGGTGGGGATTGGG - Intronic
904030872 1:27532700-27532722 CTGTGTTTAGGGAGGGGAGAGGG - Intergenic
904037016 1:27564395-27564417 TTGTGAGGAAGCAGGGGAGCAGG - Intronic
905031044 1:34884924-34884946 CTGGGAGACAGGAGGAGAGAGGG - Intronic
905203037 1:36326651-36326673 CTGTGGGCAAGAAGGGGAGCAGG + Intronic
905400218 1:37696338-37696360 CTGGGAGGAAGGAGATGAGAGGG - Intronic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
905951850 1:41958620-41958642 TTGTGATCTAGGAGGGAAGAAGG - Intronic
906384534 1:45356289-45356311 CAGAGAGCAAGGAGAGGAGTAGG + Intronic
906646322 1:47478068-47478090 CTGGCAGCAAGGGGGTGAGAAGG - Intergenic
906661981 1:47589546-47589568 CGGTGAGGAAGGAGGGATGATGG - Intergenic
907651886 1:56303043-56303065 CTGTAGGCAATGAGGGGACACGG - Intergenic
908778863 1:67669831-67669853 TTATGAGCAAAGAGGGGAAAGGG - Intergenic
908792171 1:67793770-67793792 GTTTGAGGAAGGAGGGGACAGGG - Intronic
909012737 1:70353557-70353579 ATGTGAGCAATGAAGGGAGGAGG + Intronic
910274271 1:85431546-85431568 AGGTGAGGAAGGAGGGAAGAAGG - Intronic
910391186 1:86746304-86746326 CTGTCAGCATGGAGGTGAGTGGG - Intronic
911089648 1:94008338-94008360 GTGAGAGCAAGGAGGGGAAGAGG + Intronic
911258507 1:95660433-95660455 CTGTGGGCAAGTAGGAGAGTGGG - Intergenic
911871823 1:103108560-103108582 CTGGGAGCAGGGAGGGGAGTGGG - Intergenic
913082135 1:115398505-115398527 CTGTGAGCAAAGAGAGAAAAGGG - Intergenic
914224295 1:145707592-145707614 CAGAGAACAAGGAGGGGAGAGGG + Intronic
915455134 1:156035568-156035590 CTTTGAGGAAGGAGAGGAGAGGG - Exonic
915592585 1:156879099-156879121 CTGTGAACAAGAAAAGGAGAGGG - Intronic
915733775 1:158071947-158071969 CAGTTAGCAGGAAGGGGAGAGGG - Intronic
915847681 1:159285097-159285119 AGGTGAGTTAGGAGGGGAGATGG + Intergenic
916385994 1:164270990-164271012 CTGTATCCAAGGAGGGAAGAGGG - Intergenic
917058689 1:171013000-171013022 ATGAGAGAGAGGAGGGGAGAGGG - Intronic
917231984 1:172847157-172847179 CTGTGAAGAAGGAAAGGAGAGGG + Intergenic
917564928 1:176203867-176203889 CAGTTCTCAAGGAGGGGAGAAGG + Intronic
917734481 1:177907889-177907911 CTTAGAGCAGGGAGGGGAAATGG - Intergenic
917962917 1:180158577-180158599 CTGTCAGCAAGGAGGAAGGAAGG + Intronic
918224725 1:182471208-182471230 CAGTGTGCAAGGCTGGGAGAGGG + Intronic
918514435 1:185346924-185346946 CTCTGGGCAGGGAGGGGAGGTGG - Intergenic
919162795 1:193853397-193853419 CTCTCAGCAGGGAGGGGAGCAGG - Intergenic
919587487 1:199456864-199456886 CTGGGAGTAAGGAGGAGAGCAGG + Intergenic
919945589 1:202317219-202317241 CTGCCATCAAGGAGTGGAGAGGG - Intronic
920333454 1:205228444-205228466 TTATTAACAAGGAGGGGAGATGG - Exonic
920732769 1:208503386-208503408 CTGGGAGCAAGGAGGGGAGTTGG + Intergenic
921815970 1:219563789-219563811 CTTTGAGAAGAGAGGGGAGAAGG + Intergenic
922107783 1:222527328-222527350 CTGAGGGCAAGGAGGTGATAAGG - Intronic
922152397 1:223017371-223017393 TTGTGAGAAAGTAGGGGAGAGGG - Intergenic
922340033 1:224647740-224647762 CTGGGAGCCAGCAGGGCAGAGGG + Intronic
922808464 1:228402552-228402574 ATGTGAGCCAGCAGGTGAGAAGG - Intronic
922896233 1:229102647-229102669 AGGTGAGCGGGGAGGGGAGAAGG - Intergenic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
923263527 1:232290030-232290052 GTGGGAGCAGGGAGAGGAGAGGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924199623 1:241645507-241645529 CTGTGAGGGTGGAGGTGAGAAGG + Intronic
1062769621 10:88452-88474 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1063105410 10:2987822-2987844 CTGTGAGCCAGGAGCAGGGAGGG - Intergenic
1063595536 10:7431804-7431826 CTGTAAGGAAGGATGGGAAAAGG + Intergenic
1063985803 10:11500161-11500183 CTGTCAGCAAGGGGTGGAGGTGG + Intronic
1064102154 10:12473088-12473110 ATGTGGGGCAGGAGGGGAGAGGG + Intronic
1064547947 10:16469495-16469517 CTGTGAGAATGAAGGGGAAAAGG + Intronic
1064706332 10:18076172-18076194 CTGTGAACTCAGAGGGGAGACGG - Intergenic
1065169005 10:23009554-23009576 CAGTGAGCCAAGATGGGAGATGG - Intronic
1065380057 10:25081064-25081086 ACGGGAGCAAGGAGGGGATAAGG - Intergenic
1065806041 10:29394591-29394613 CTGGGAGCAAGGAGAGGCCAGGG - Intergenic
1065844664 10:29735361-29735383 CTGAGAGCATGGCGGGGAGGCGG - Intronic
1066494960 10:35933705-35933727 CTCTGAGCAAAGAAAGGAGAGGG - Intergenic
1066506384 10:36048939-36048961 CCTTGAACTAGGAGGGGAGAGGG + Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067266288 10:44748267-44748289 CTTTCAGCAAAGAGGGGAGCTGG + Intergenic
1067429977 10:46236497-46236519 GTGTGAGCTGGGAGGGAAGATGG - Intergenic
1067443668 10:46327314-46327336 GTGTGAGCTGGGAGGGAAGATGG + Intronic
1067701857 10:48579600-48579622 CTGCCAGCAAGATGGGGAGAGGG + Intronic
1068918334 10:62457471-62457493 ATGTGAGCTAAGAGTGGAGAAGG + Intronic
1069445730 10:68471770-68471792 CTGTGAGCGGAGAGGGGGGAGGG - Exonic
1069801767 10:71086057-71086079 CTGGGAGCAAGTTGGGGAGGGGG + Intergenic
1069876736 10:71567747-71567769 CTGGGAGCAAGGAGAGGGGGCGG - Intronic
1070642413 10:78179318-78179340 CTGGGGAGAAGGAGGGGAGAAGG + Intergenic
1071058238 10:81536172-81536194 TTGTCAGCAAGGGAGGGAGAGGG - Intergenic
1071856104 10:89626047-89626069 CTGTAGGCATGAAGGGGAGAAGG - Intronic
1072218030 10:93304300-93304322 CATTGAGAAAGGAGGGGACAAGG + Intergenic
1072474819 10:95750209-95750231 CTGTGGGAAAGGAGCGGGGATGG + Intronic
1072738598 10:97896132-97896154 CTGTTAGGAAGGATAGGAGATGG - Intronic
1073043571 10:100623243-100623265 ATGTCAACAAGGAGGGGAGGTGG + Intergenic
1073253268 10:102134653-102134675 CTCTGAGAAAGTAGGGGAGAAGG - Intronic
1073348664 10:102803234-102803256 CTGAGAGCAAGGAAGGGCCAGGG + Intronic
1073693952 10:105844521-105844543 CTGTGAGAAGGGAGAGGAGGGGG - Intergenic
1074653849 10:115559045-115559067 CTATAAGCAAGGTGGAGAGAGGG - Intronic
1074915423 10:117950713-117950735 CTGTGAGCCAGGAGAGCAGATGG + Intergenic
1075762929 10:124870363-124870385 CTCTGTGCAAGGAGCGGGGAAGG + Intergenic
1076085237 10:127621522-127621544 ATGTGTGCAAGGAGTGGAGGGGG + Intergenic
1076572295 10:131440807-131440829 CGGTCAGCAGGGAGGGAAGAGGG + Intergenic
1076594979 10:131619680-131619702 CTCTGAGCAGGGTGGGGAGGAGG + Intergenic
1076595202 10:131620788-131620810 CTCTGAGCAGGGTGGGGAGGAGG - Intergenic
1076622506 10:131801084-131801106 CTGTGAGCGAGTAGGGAAGCAGG + Intergenic
1076685011 10:132194602-132194624 CTCTGAGCACAGAAGGGAGAGGG - Intronic
1076714693 10:132357814-132357836 CTCTGAGCAGGGAGGGGACCAGG + Intronic
1076891858 10:133288615-133288637 CCCTGGGCAAGGAGGGGAGCTGG + Intronic
1077048986 11:558311-558333 CAGTGGCGAAGGAGGGGAGAAGG + Intronic
1077120346 11:904603-904625 CTGTGAGCCAGGAGGCTCGAGGG - Intronic
1077126764 11:942949-942971 CAGTGAGCGAGGAGAGGAGCTGG + Intronic
1077419105 11:2441307-2441329 GTGTGAGCAAGGAGGTGAGGAGG - Intergenic
1077544179 11:3161954-3161976 CTGTGAGCAAGGAGGGGAGAGGG + Intronic
1078047222 11:7926212-7926234 CTGTCAGCAGAGAGGGGATATGG - Intergenic
1079165733 11:18041113-18041135 TTGTGGGCAAGGTGGGGAGGAGG - Exonic
1079800281 11:24860208-24860230 CAGTGAGGAAGGATGGGACAGGG - Intronic
1079986803 11:27208359-27208381 ATGGGAGCAAGGAGGAGGGACGG + Intergenic
1080132665 11:28815096-28815118 GGGTGAGGAAAGAGGGGAGATGG - Intergenic
1080331319 11:31142903-31142925 CTGTGGGCAAGGAGGGTATTGGG + Intronic
1081739093 11:45425640-45425662 CTGGGAGAAATGAGGGGAGGAGG + Intergenic
1082804578 11:57439587-57439609 CTCTCAGCAAGGATGGGAGACGG + Intergenic
1083039079 11:59668911-59668933 CAGGGAGCGGGGAGGGGAGAGGG + Exonic
1083163354 11:60868974-60868996 CTGAGAGCAGAGAGGGGAGGGGG + Intronic
1083591575 11:63898420-63898442 CAGTGTGCCAGAAGGGGAGATGG - Intronic
1083708162 11:64530829-64530851 CTGAGAGCAAGGAGGGGCTCTGG - Intergenic
1083799555 11:65038651-65038673 CTGGGAGCCAGGAGGGCAGGAGG + Exonic
1083967029 11:66049261-66049283 CCACGAGCAAGTAGGGGAGAGGG + Intergenic
1084106461 11:66983993-66984015 CAGGGAGCAGGGAGAGGAGATGG - Intergenic
1084171044 11:67401296-67401318 CTGTGGGCAAGGAGGGGCCGAGG - Intronic
1084262222 11:67986457-67986479 CTAAGAGCCAGGGGGGGAGAGGG + Intergenic
1084554117 11:69865599-69865621 TTGTGGGCCAGCAGGGGAGATGG - Intergenic
1084609956 11:70195695-70195717 GTGTGAGGAAGAGGGGGAGAAGG - Intergenic
1084617720 11:70247511-70247533 ATGTGAGCAGAGTGGGGAGAGGG - Intergenic
1085046771 11:73358092-73358114 CTGTGAGCAAGAATGGGGCAGGG + Intronic
1085721215 11:78913932-78913954 CTGTTAGCCTGGAGAGGAGAAGG + Intronic
1086073622 11:82826121-82826143 CTGAGAGCAAGGCAGGAAGATGG - Intronic
1087793021 11:102427369-102427391 CTATGAGGAACAAGGGGAGAAGG + Intronic
1088116035 11:106315916-106315938 CAGAGAGGAAGGAGGGGAGTTGG - Intergenic
1088547834 11:110979493-110979515 CTGTGAGCAAGAAAGGAGGAAGG - Intergenic
1088821385 11:113460560-113460582 CTGGCAGCAAGGAGGGGCCAGGG - Intronic
1088842956 11:113642037-113642059 CTGTGAGCCAGGAAAGGAGGTGG - Intergenic
1089091757 11:115883915-115883937 CTGTAAGCAGGGAGGTGACATGG - Intergenic
1089195724 11:116693049-116693071 ATGGGAGCCAGGAGGGGAGCAGG - Intergenic
1089701173 11:120244939-120244961 CTGTGCACTAGGAGGGGAGGGGG + Intronic
1089759826 11:120715224-120715246 GTGTGATCAAGGGAGGGAGAAGG + Intronic
1090044224 11:123316866-123316888 CAGGGAGGAAGGCGGGGAGAGGG + Intergenic
1090396193 11:126420268-126420290 CTGTTAGCGAGGACGGGAGGAGG + Intronic
1090883117 11:130852029-130852051 CTGTGAGCACGAAGGGGAGCAGG + Intergenic
1090996349 11:131869219-131869241 CAGTCATCAAGGAAGGGAGAGGG - Intronic
1091078254 11:132641326-132641348 CTCTGGGCAAGGAGAGGAGGTGG - Intronic
1091308588 11:134557002-134557024 CTGAGAGACAGGAGGGGAGAAGG + Intergenic
1091393561 12:140155-140177 CTGTGACCACAGAGGTGAGAAGG + Intronic
1091403703 12:196262-196284 CTGTGGGCCAGGAGGGGAACTGG + Intronic
1091454728 12:598524-598546 CTGTGAGAAATGAGGAGAAAGGG + Intronic
1091797923 12:3307819-3307841 CTAGGAGCAAGGAGAGAAGAGGG + Intergenic
1091828666 12:3534035-3534057 AGGTGGGCAAGGAGGGAAGAAGG + Intronic
1091923120 12:4321386-4321408 GAGCGAGCAGGGAGGGGAGAGGG - Intronic
1092016913 12:5167231-5167253 CTGTGGGCAAGGGTGGGGGATGG + Intergenic
1092556347 12:9566363-9566385 CTGAGAGCCAGGAGGGGAAGAGG + Intergenic
1092720119 12:11433022-11433044 GTGTAAGCAGGGAGGGTAGAAGG + Intronic
1093827938 12:23717731-23717753 CTGTGGTCAAGGTGGAGAGAAGG + Intronic
1094058060 12:26286309-26286331 CTGAGAGCAGGGATGGCAGATGG + Intronic
1094472491 12:30816792-30816814 CTGGGAGCTGGGAGGGGAGCAGG + Intergenic
1094515746 12:31124293-31124315 CTGAGAGCCAGGAGGGGAAGAGG - Intergenic
1095838332 12:46663438-46663460 CTGAGAGCAGGGAGTGGAGGAGG + Intergenic
1095849837 12:46790340-46790362 CTGTGAGAAATATGGGGAGAAGG - Intronic
1096077716 12:48815475-48815497 CGGCGAGAAAGGAAGGGAGAGGG + Intronic
1096480073 12:51934247-51934269 ATGTGAGCAAGAAGGGGAGGAGG - Intergenic
1097119657 12:56721377-56721399 AGGAGAGCAAGGAGGGGGGAGGG + Exonic
1097197047 12:57248671-57248693 TGGAGAGCAAGGAGGGGACATGG - Intronic
1099738450 12:86600892-86600914 CTGGGAGCAGGGAGGGGCCAGGG - Intronic
1100445675 12:94657353-94657375 CTGTGACCAAATATGGGAGAGGG - Intergenic
1100721359 12:97362328-97362350 CTGTGAGCAGGAAGGAGGGATGG + Intergenic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1102237679 12:111304333-111304355 AAGTGAGCAGGGAGGGCAGAGGG + Intronic
1102547569 12:113667661-113667683 CAGAGAGAAAAGAGGGGAGATGG - Intergenic
1102729103 12:115092307-115092329 CTGTGAGCACGGAGGAGCCATGG + Intergenic
1102825125 12:115942585-115942607 CTGCCAGAAGGGAGGGGAGAGGG + Intergenic
1104649705 12:130522699-130522721 CTGTGCGCAGGGAGAGGAGGAGG + Intronic
1104820159 12:131672481-131672503 CTTTGAGCAGGGAAGGGACAAGG - Intergenic
1105008962 12:132741739-132741761 CTGTCTGCAAGGAGAGGAAAAGG + Intronic
1105283093 13:18981037-18981059 GTGAGAGAAAGGAAGGGAGATGG + Intergenic
1106578578 13:30998870-30998892 CTGTGGGCAGGGAGGAGAGCAGG + Intergenic
1107544941 13:41426355-41426377 CTAAGAGCCAGGAGGGGAGAAGG + Intergenic
1107639985 13:42432014-42432036 CTGTGAGCAAGGAAGAGGGGTGG + Intergenic
1107911118 13:45106638-45106660 CTCTCAGCAAAGAGGGGAGCCGG + Intergenic
1107940428 13:45377412-45377434 CTGAGAGCCAGTGGGGGAGAGGG + Intergenic
1107940457 13:45377490-45377512 CTGAGAGCCAGGGGGGAAGAGGG + Intergenic
1107940595 13:45377886-45377908 CTGAGAGCCAGGGGGGAAGAGGG + Intergenic
1107941070 13:45380116-45380138 CTGAGAGCCAGGGGGGAAGAGGG + Intergenic
1107941184 13:45380429-45380451 CTGAGAGCCAGGGGGGAAGAGGG + Intergenic
1107941572 13:45381812-45381834 CTGAGAGCCAGGGGGGAAGAGGG + Intergenic
1107941714 13:45382208-45382230 CTGAGAGCCAGGGGGGAAGAGGG + Intergenic
1108053045 13:46464221-46464243 CTGAGAGCCAGGGGGGAAGAGGG - Intergenic
1108053103 13:46464377-46464399 CTCAGAGCCAGGGGGGGAGAGGG - Intergenic
1108214886 13:48174468-48174490 GTGTGAGCAAGGATGGTAGCAGG - Intergenic
1108526936 13:51293471-51293493 CTGTGGGCAAAGAAAGGAGAAGG - Intergenic
1109053869 13:57520264-57520286 TTGTAAGCAAGGAGGAGACAGGG + Intergenic
1109449686 13:62494493-62494515 CTGTGAGAAAAGGGGAGAGAAGG - Intergenic
1109536204 13:63722979-63723001 GTGAGAGGAAGGAGGGGAGATGG + Intergenic
1109539896 13:63763307-63763329 GTGAGAGGAAGGAGGGGAGATGG - Intergenic
1109932619 13:69235315-69235337 CTGTGTGCCAGCACGGGAGATGG - Intergenic
1110788998 13:79566861-79566883 GTGAGAGGGAGGAGGGGAGAAGG - Intergenic
1112262091 13:97886229-97886251 CTGTGAGGCAGGGAGGGAGAAGG + Intergenic
1112693840 13:101925924-101925946 CTGTGAGCCAGGAAGGCAGGTGG - Intronic
1113049094 13:106188641-106188663 CAGTCAGGAAGGAGGGGAGGAGG - Intergenic
1113426616 13:110213659-110213681 GTGTGAGCTGGGAGAGGAGATGG + Intronic
1113521977 13:110947744-110947766 GTGTGAACAGGGAGTGGAGAAGG + Intergenic
1113705915 13:112432952-112432974 GTGTGAACAGGGAGTGGAGAAGG - Intronic
1113801278 13:113087684-113087706 CTGCGAGCAGAGAGTGGAGATGG - Intronic
1114466861 14:22929245-22929267 CTGTGGCCAAGCAGGGGTGAGGG - Exonic
1114664967 14:24372354-24372376 CTGTGAGGGAGGAGGGGGTATGG - Intronic
1115430369 14:33310398-33310420 CTGTGAGGAAAGAGGGGATGGGG + Intronic
1115739698 14:36375115-36375137 GTGTGAGCAAATAGGAGAGAGGG + Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1118109158 14:62696500-62696522 CTATAAGCAGGGAGAGGAGAAGG - Intergenic
1118401250 14:65381574-65381596 CTGAGAGCAAAGAAGGTAGAAGG - Intergenic
1118589690 14:67392294-67392316 CTATGAGCAGGGAAGAGAGATGG - Intronic
1119481905 14:74963253-74963275 CTGTGAAAAGGGAGAGGAGATGG + Intergenic
1119858712 14:77921460-77921482 CTGTGAGCAAGTAGAGCAGGTGG + Intronic
1120858405 14:89232983-89233005 CTGAAAGGAAGGAGGGGAGGTGG - Intronic
1120860926 14:89254394-89254416 CTGTAAGGGAGGTGGGGAGAAGG + Intronic
1121261078 14:92566586-92566608 CTGTTAGCAAGGAGGGGGAGAGG + Intronic
1121310560 14:92933158-92933180 CTGGGGGCCAGGAGGGGACACGG - Intronic
1121566117 14:94910445-94910467 CTGGGAGCCTGAAGGGGAGAGGG - Intergenic
1121638186 14:95467741-95467763 CAGTGGGCAAGGAGGGTAAATGG + Intronic
1121802834 14:96789144-96789166 CAGGGAGCAGGGAGGGGACACGG + Intergenic
1122802723 14:104239630-104239652 CTATGAGAAAGGACGGCAGAAGG + Intergenic
1122925744 14:104898955-104898977 CTGTGAGCAAGGCGGGCGGTCGG - Intergenic
1124346386 15:28924167-28924189 TTGAGAACAAGGAGGGGAGAGGG - Intronic
1125716451 15:41822462-41822484 AGGTAGGCAAGGAGGGGAGAAGG - Intronic
1125814967 15:42576065-42576087 CTTTGAGAAAGGCTGGGAGAGGG + Intronic
1126167604 15:45666929-45666951 ATGGGAGAAAGGAGAGGAGAGGG - Intronic
1126353232 15:47767159-47767181 CTGCGCAAAAGGAGGGGAGAAGG - Intronic
1126540516 15:49817293-49817315 CTGAGGTCAAGGAGGGGAGAGGG + Intergenic
1126663352 15:51053585-51053607 CTGAGGGCAAGGTGGGGAGAAGG - Intergenic
1126693027 15:51302611-51302633 CTGTGAGGACAGTGGGGAGAGGG - Intronic
1127334314 15:57968451-57968473 CTGGGAGGAAGGAAGGGAGAAGG - Intronic
1127469017 15:59273854-59273876 CAGTGAGCAGGGAGGGGGCAGGG - Intronic
1127484089 15:59403442-59403464 CTGTCTGCAAGCAGGGGAGAGGG + Intronic
1127500908 15:59553447-59553469 CTGAGAGGGAGGAGAGGAGATGG + Intergenic
1127658379 15:61076913-61076935 CTTTGAACAAGCAAGGGAGAGGG - Intronic
1127698966 15:61478534-61478556 CTGATAGCAAGGAGGTGAGGTGG - Intergenic
1127756187 15:62094601-62094623 ATGAGAGAATGGAGGGGAGAGGG + Intergenic
1127841315 15:62834630-62834652 TTGTGTGCCAGGTGGGGAGACGG - Intronic
1128637088 15:69309586-69309608 CTCTGAGGAGGGAGGGGACAGGG - Intronic
1129233652 15:74210663-74210685 CTGTGAGTAAGGAGCTGTGAAGG + Intronic
1129525701 15:76212732-76212754 CTGTGGGCAAGGCTGGCAGAGGG - Intronic
1129906286 15:79189936-79189958 TTGTGAGCCAGGAGAGAAGATGG + Intergenic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1131094571 15:89647358-89647380 GTGTGAGCTTGGACGGGAGAGGG - Intronic
1132120245 15:99169579-99169601 CAGTGAGCAGGGAGTGGGGAGGG + Intronic
1132143435 15:99412915-99412937 CCATGACCAGGGAGGGGAGAGGG - Intergenic
1132156133 15:99496361-99496383 GTGTGGGCAGGGAGGGCAGAAGG + Intergenic
1132458753 16:38998-39020 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1132847240 16:2006265-2006287 CTGTGAGCAAGGTGGGCCCAAGG + Intronic
1132903242 16:2269548-2269570 GTGGCAGCAAGGAAGGGAGAAGG + Intergenic
1133332312 16:4982234-4982256 CTGGGAGCCAGGAGGGAAGGGGG + Intronic
1133467202 16:6039090-6039112 CTGTGTGCATAGCGGGGAGAAGG + Intronic
1134073275 16:11273614-11273636 CTCTGGGCAAGGAGGTGAGGCGG + Intronic
1134618504 16:15670088-15670110 CTCAGAGCAAGGCGGGGAGATGG - Intronic
1134841561 16:17405828-17405850 CTGAGGGCAGGGAGGGGAAATGG - Intronic
1135647922 16:24179489-24179511 CAGTGAGCAAGGCTGAGAGATGG - Intronic
1135826995 16:25737801-25737823 CTATTAGCAAAGATGGGAGAAGG - Intronic
1136474669 16:30505294-30505316 CTGGGAGGTAAGAGGGGAGAAGG + Exonic
1137515285 16:49138150-49138172 CTGTCAGCAAGCAAGGGAGGAGG - Intergenic
1137658828 16:50185439-50185461 CTGTGAGGAGGGAGGAGGGAAGG + Intronic
1140324785 16:73991206-73991228 CTCTCAGCAAGAAGGGGAGTTGG + Intergenic
1140781989 16:78305340-78305362 TTGTGAGCAAGGAGGCCGGAGGG - Intronic
1140808129 16:78552312-78552334 TTGGGATCCAGGAGGGGAGAAGG + Intronic
1141137459 16:81475627-81475649 CTGTGAGCAAATGGGGCAGAGGG + Intronic
1141240256 16:82259314-82259336 CTTTGAGCAAGGGGGCAAGAGGG + Intergenic
1141261279 16:82455997-82456019 CTCTCAGCAAGGAGAGGAAACGG - Intergenic
1141376849 16:83539176-83539198 CTGTGGGCAAGGGTGGGGGATGG + Intronic
1141821534 16:86449533-86449555 CTGTGGCCAAGGAGGAGGGACGG + Intergenic
1141892387 16:86935046-86935068 CTGTGAGCAAAGACAGGAAATGG + Intergenic
1141909219 16:87047186-87047208 CGCAGAGCCAGGAGGGGAGAGGG - Intergenic
1141993721 16:87623990-87624012 CTGTCAGCTGGGAGGGGACAGGG + Intronic
1142301752 16:89262707-89262729 CTGTCAGCAGGAAGGGGAGCTGG + Intergenic
1142621114 17:1166246-1166268 CTGTGAGCAGGGACGGGGGCAGG + Intronic
1142854903 17:2724098-2724120 CTGTGAGACAGGAGGGGCGGGGG - Intergenic
1143026131 17:3942968-3942990 CTTGGAGAAAAGAGGGGAGAAGG - Intronic
1143163622 17:4886715-4886737 CTGGGGCCAAGGAGGGGAGCAGG - Intronic
1143476637 17:7207060-7207082 CTGTGAGCAGAGAGGAGAAAGGG + Intronic
1143654518 17:8286014-8286036 CTGGCAGCAAGGAGGAGAGAGGG + Intergenic
1143659912 17:8318451-8318473 CTGTCAGCAAGGTGGGCAGTGGG + Exonic
1143765235 17:9133397-9133419 CTGGGAGCAAGGAGGAGAGATGG - Intronic
1144274802 17:13656069-13656091 GTGGGAGCAAGGGAGGGAGAAGG - Intergenic
1145279636 17:21458027-21458049 AAGGGAGCATGGAGGGGAGATGG + Intergenic
1145398242 17:22512455-22512477 AAGGGAGCATGGAGGGGAGATGG - Intergenic
1146299097 17:31674263-31674285 CAGTAGGCAAGGAGGGAAGAAGG + Intergenic
1146530283 17:33602688-33602710 CAGTGAGCAAGGACAGGGGAAGG - Intronic
1146668284 17:34719578-34719600 CTGCGAGCGGGGAGGGGACAGGG - Intergenic
1147036303 17:37684021-37684043 CAGTGAGCAAGGAAGAGTGAGGG - Intergenic
1147240307 17:39086436-39086458 CTGAGAGCAGGGGGTGGAGAAGG - Intronic
1147304978 17:39556873-39556895 CTGAGAGCCAGGAGGGCAGCAGG - Intronic
1147770912 17:42867347-42867369 GAGTGAGAAAGGAGGTGAGAGGG + Intergenic
1147817515 17:43220867-43220889 CTGAGAGCCAGGAAGGGAGAGGG + Intergenic
1148144713 17:45355875-45355897 CTCAGAGCCAGGAGGTGAGAGGG - Intergenic
1148209184 17:45798001-45798023 GCGGGAGCAAGGAGAGGAGAGGG + Intronic
1148775610 17:50094018-50094040 CTGTGAGCAAGGAAGTAATAAGG + Intergenic
1149302022 17:55314030-55314052 CAGTGAGGAAGAGGGGGAGATGG + Intronic
1149461622 17:56834014-56834036 GTGTGAGGTGGGAGGGGAGACGG - Intronic
1149478683 17:56984549-56984571 CTGTGAGCATCCATGGGAGAGGG - Intronic
1150947790 17:69765895-69765917 AGGGGAGCAGGGAGGGGAGAAGG - Intergenic
1151319313 17:73343081-73343103 CTGGAAGCAAGGTGGGGAGTGGG + Intronic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1151618273 17:75228975-75228997 CTGTAAGCCAGGAGGGAAGAAGG - Intronic
1151969576 17:77450826-77450848 CTGGGACCATGGAAGGGAGAAGG - Intronic
1152066151 17:78113497-78113519 CTCTGAGCCTGGAGGGGAGAGGG - Intronic
1152494388 17:80660829-80660851 CTGAGAGAAGGGTGGGGAGATGG - Intronic
1152962686 18:89242-89264 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1153168001 18:2283898-2283920 CTTTGGGCGAGGAAGGGAGAAGG - Intergenic
1153539561 18:6139622-6139644 CTGAGAGCTGGGAGGGGAGAAGG - Intronic
1153586886 18:6631041-6631063 CTGTTTGCTAGGAGGGGAGGGGG + Intergenic
1154325866 18:13389930-13389952 CTGTGAGCAAGTGGGGAGGAAGG - Intronic
1155156701 18:23163551-23163573 CTGAGAGAAAGGATGGAAGAGGG + Intronic
1155323018 18:24637435-24637457 CTGTGGACAAGGAGGGGATGGGG + Intergenic
1155541036 18:26868522-26868544 CTGAGGGCAAGGATGGGAGAAGG - Intergenic
1156435427 18:37122714-37122736 CTGTGAATCAGGAGGTGAGATGG + Intronic
1157300080 18:46472941-46472963 CTCAGAGCCAGGAGGGGAAAAGG + Intergenic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1158908559 18:62037567-62037589 CTGTGAGCACTGAGGGCAGCGGG + Intergenic
1159444328 18:68522020-68522042 TTGTGAGCAGTGAGGGGTGATGG - Intergenic
1160443999 18:78913367-78913389 CTGTGAGCAGGGGTGGGAGTGGG - Intergenic
1160706200 19:531450-531472 CTGTGCGCAAGGAGGCGGGCAGG - Intergenic
1160758691 19:771829-771851 CAGGGAGGAAGGAGAGGAGAGGG - Intergenic
1160758731 19:771948-771970 CAGGGAGGAAGGAGAGGAGAGGG - Intergenic
1160965548 19:1745580-1745602 CTGGGCGCCAGGAGGTGAGAGGG - Intergenic
1161398876 19:4058977-4058999 CTGGGAGCAGGGAGGGTAGGAGG + Intronic
1161414746 19:4139709-4139731 GAGTGAGCAAGGGGGAGAGAAGG + Intergenic
1161458196 19:4380458-4380480 CTGGGAGCACGCAGGAGAGAGGG + Intronic
1161488305 19:4547804-4547826 CAGTGAGCAAGGGGGAGTGAGGG - Intronic
1161731856 19:5965514-5965536 GAGGCAGCAAGGAGGGGAGAGGG + Intronic
1161760579 19:6168165-6168187 GAGTGAGCAAGGGGGAGAGAGGG - Intronic
1161777372 19:6270937-6270959 GTGGGAGTACGGAGGGGAGAAGG - Intronic
1161852824 19:6746433-6746455 CTGTCTGCAAGGTGGGTAGAGGG - Exonic
1162053850 19:8051159-8051181 ATGTTAGCCAGGATGGGAGAAGG - Intronic
1162068234 19:8138363-8138385 CTGTGGGTGAGGAGGGGACAGGG - Intronic
1162085617 19:8247261-8247283 CAGTGAGCAAGGGGGAGAGAGGG - Intronic
1162301860 19:9849067-9849089 CTGGGAGCCAGGAGGGGCGGTGG - Intronic
1162774922 19:12973671-12973693 CTTGGAGAAATGAGGGGAGATGG + Exonic
1162791738 19:13066535-13066557 CTGTGAGCAGGGAGGGAATGAGG + Intronic
1163011715 19:14430789-14430811 GAGTGAGCAAGGGGGAGAGATGG + Intergenic
1163013570 19:14440415-14440437 TTGGGAACAAGGAGAGGAGATGG + Intronic
1163103684 19:15111452-15111474 GGGTGAGCAGGCAGGGGAGAGGG - Intronic
1164629801 19:29754768-29754790 CTGTGAGCACAGTGGGGAGAGGG - Intergenic
1165747816 19:38240722-38240744 TTGTGAGCAAGGATGGGGAAAGG + Intergenic
1165993206 19:39827426-39827448 CTGTGAGCAGGCAGGGGTCAAGG + Intronic
1165998852 19:39865424-39865446 CTGGAAGGAAGGAGGGGAAAAGG + Intronic
1166104563 19:40590876-40590898 TTCTGTGCAATGAGGGGAGAGGG + Intronic
1166198335 19:41220621-41220643 CTGCGTGCCTGGAGGGGAGATGG - Exonic
1166728200 19:45041672-45041694 CTCTGAGCAACGAAGGGACAGGG - Intronic
1166728300 19:45042255-45042277 CTCTGAGCAATGAAGGGACAGGG + Intronic
1167214597 19:48156116-48156138 TGGTGAGCAATGAGGTGAGAAGG - Intronic
1167291144 19:48625868-48625890 CTGTGGGAAGGGAGGAGAGAAGG - Intronic
1167429920 19:49448284-49448306 CTGTGAGCAGGGAAGGGATAGGG - Intronic
1167539242 19:50074798-50074820 CTGTGAGCAAGGAAGGGGAGGGG - Intergenic
1167607017 19:50486881-50486903 CTGGGTGGAAGGAGGGGAGAGGG - Exonic
1167630465 19:50623060-50623082 CTGTGAGCAAGGAAGGGGAGGGG + Intronic
1167767959 19:51496834-51496856 CTGGGAGAAAGCAGGGGAGAAGG + Intronic
1167852719 19:52214225-52214247 CTGAGAGAAAGCAGGAGAGAGGG + Intronic
1167995202 19:53396072-53396094 CAGAGAGCAAGGTAGGGAGAGGG + Intronic
1168145557 19:54418646-54418668 CAGTGAGCAGGGAGGAGAGGGGG + Intronic
1168311855 19:55464613-55464635 CTGTGAGCAGGGAGGGGCAGGGG + Intergenic
1168592866 19:57651624-57651646 CTGAGAGCAAGGAAGGGAGAAGG - Intergenic
925248234 2:2403844-2403866 GTGTGAGCAAAGATGGCAGAAGG + Intergenic
925281833 2:2690419-2690441 GTGTGAGTAGGGAGGAGAGAGGG - Intergenic
925310543 2:2878560-2878582 CTCTCAGCAAAGAGGGGAGCTGG + Intergenic
925546755 2:5024719-5024741 CTGTGAGGAGTGAGGGGTGAGGG - Intergenic
925700610 2:6633624-6633646 CAGTGAGCAAGCAGGGGAGCTGG + Intergenic
925841494 2:7996036-7996058 CTGTCAGCAGGGAGGGGACCTGG + Intergenic
925917026 2:8614189-8614211 CTGTTGGCAAAGAGGGGACAAGG + Intergenic
926124343 2:10262738-10262760 GTGTGTCCAAGGAGAGGAGATGG + Intergenic
926147585 2:10406059-10406081 ATGACAGCAAGGAGGGGTGAAGG - Intronic
926301930 2:11611035-11611057 CTGTGCGCAGGGAGGGGCGGAGG + Intronic
926699843 2:15796341-15796363 CTGAGATCCAGGAGGGGACAGGG + Intergenic
926913707 2:17874230-17874252 CAGTGAGCATAGAGGAGAGATGG + Intergenic
927135954 2:20096689-20096711 CTATGAGAATGGAGGGCAGAGGG - Intergenic
927201876 2:20583089-20583111 TCCTGAGCAAGGAGGGGCGATGG + Intronic
927351907 2:22125738-22125760 CTGTGAGGAGGGAGCAGAGAAGG - Intergenic
927394182 2:22630671-22630693 TGGTGAACAAGGAGAGGAGAGGG - Intergenic
927655625 2:24943070-24943092 CTGTGACCAGGGAGGAAAGATGG + Intergenic
927798618 2:26075576-26075598 CTGAAAGCTAGAAGGGGAGAAGG + Intronic
927971754 2:27310024-27310046 CAGTGAGCAAGGGCTGGAGATGG + Intronic
928129247 2:28637761-28637783 GAGTGGGCAAGGAGGTGAGAAGG - Intronic
929677187 2:43948200-43948222 CTGTGAGAAGGGAAGGGAGGGGG + Intronic
929888371 2:45898778-45898800 CTCTGAGGAGGGAGTGGAGAAGG + Intronic
929947511 2:46381952-46381974 CTGGGAGTAAGAAGGGCAGATGG - Intronic
930934637 2:56933039-56933061 CTGTAAGCAAGGAGGGTGAAAGG - Intergenic
931681659 2:64754249-64754271 CTGTGTGCAAGCAGTGTAGAAGG - Intergenic
931899208 2:66769371-66769393 AGGTGAACAAGGAAGGGAGAGGG - Intergenic
932745200 2:74328281-74328303 ATGTGACCAAGGTGGGGGGAGGG + Intronic
933103299 2:78287667-78287689 CTCTCAGCAAAGAGGGGACATGG - Intergenic
933457229 2:82531036-82531058 CTAAGAGCCAGGGGGGGAGAGGG + Intergenic
933792421 2:85893727-85893749 CTGTGAGGCAGGAGGGGTGAGGG + Intergenic
934563317 2:95324102-95324124 CTGTGGGGAATGAGGAGAGATGG + Intronic
934708981 2:96503093-96503115 CTGGGGGCAAGGAGGGGTGGAGG + Intronic
935074890 2:99731511-99731533 CTGTGAGCGGGGAGGTGGGAGGG - Intronic
935225269 2:101047249-101047271 CTGGGAGCAGGGAGGGTAGGGGG - Intronic
935979619 2:108613883-108613905 CTGACAGCAGGGAGGGGAGCAGG - Intronic
936126039 2:109789828-109789850 CTGGGAGCATGGAGGTGAAAAGG + Intergenic
936218654 2:110581640-110581662 CTGGGAGCATGGAGGTGAAAAGG - Intergenic
936562358 2:113552096-113552118 GGGTGGGCATGGAGGGGAGAGGG - Intergenic
936692753 2:114912489-114912511 CTGTGAGAAGGGAGGCAAGATGG + Intronic
937539507 2:122931259-122931281 CAGTGAAAAAGGAGGGCAGAAGG + Intergenic
937788312 2:125928627-125928649 GTGTGAGCAAGGTGGGGGAAAGG - Intergenic
937812090 2:126210657-126210679 CTGGGAGGAAGAAGAGGAGAGGG + Intergenic
937880372 2:126859863-126859885 CTGTATGCATGGAGGGGAGGTGG + Intergenic
938192080 2:129292671-129292693 GTGTGACCAAGCTGGGGAGAGGG - Intergenic
939378960 2:141409489-141409511 CTCTGTGGAAGGAGAGGAGAAGG - Intronic
939879656 2:147615535-147615557 CTTTGAGAAGGGAGGGGAAAGGG + Intergenic
940168762 2:150803899-150803921 CTCTCAGCAAAGAGGGGACATGG + Intergenic
940285271 2:152027485-152027507 GTGTGAGTCAGGAGGGGAGGTGG - Intronic
944237909 2:197456839-197456861 CTGGGAGAAAGGAAGGGATAGGG + Intronic
944560860 2:200936194-200936216 CTGTTAGCAAGGAAGAGGGAAGG - Intronic
945081164 2:206087303-206087325 CTGTTAGCACAGAGGTGAGAGGG + Intergenic
946016325 2:216606858-216606880 CTGTGAGGAAGGAAGGCAGGTGG - Intergenic
946060617 2:216937908-216937930 CTGTGTGCAAGGGAGAGAGAGGG - Intergenic
946471795 2:219967343-219967365 CTGGGAGGAAGCAGGGGAGCTGG - Intergenic
946680547 2:222210540-222210562 CTAGGAGCAGGGAGGGGAGAGGG - Intronic
947227748 2:227856712-227856734 CTGTGAGAAAGAATGGGAGCAGG - Intergenic
947718026 2:232351591-232351613 ATGTGTGCAGGGAGGGGACAGGG - Intergenic
947741491 2:232486937-232486959 GTGTGTGCAGGGAGGGGACAGGG - Intronic
947963918 2:234262866-234262888 CTGGGGGCAAGGAGTGGAGGCGG + Intergenic
948244147 2:236464060-236464082 CTCTGAGCCAGCAAGGGAGAAGG + Intronic
948264816 2:236628700-236628722 CTGTCAGCAAAGAAGGGAGGTGG + Intergenic
948416555 2:237810623-237810645 CATTGAGCAAGGAGGAGGGAGGG + Intronic
948843514 2:240672101-240672123 CCCTGAGCAGGGAGGGGAGGTGG + Intergenic
948917011 2:241039528-241039550 CGGTGAGGAGGGAGGGCAGAGGG + Intronic
1168845467 20:941447-941469 ATGAGAGAAAGGAAGGGAGAGGG - Intergenic
1169027089 20:2380469-2380491 CTCTCACCCAGGAGGGGAGAGGG + Intergenic
1169074278 20:2751828-2751850 CTGTGGGCAAGGGGGTGAGGAGG + Intronic
1169291747 20:4359004-4359026 GTGGGAGCCAGAAGGGGAGAGGG + Intergenic
1170857867 20:20074092-20074114 TTGTGAGTAAGGAGGACAGAAGG + Intronic
1171010135 20:21505167-21505189 GTCTGAGGAGGGAGGGGAGAAGG + Intergenic
1171115311 20:22520361-22520383 CTGTGAGGAAGAAGGGAAGCAGG + Intergenic
1171296695 20:24023244-24023266 CTGAGAGCAAGAAGGAGACAAGG + Intergenic
1171422249 20:25025051-25025073 CTATGGGCGAGGAAGGGAGATGG + Intronic
1171934107 20:31257347-31257369 CTGTGAGAATGTAGGGGAGGGGG + Intergenic
1171970250 20:31560155-31560177 CAGTGAGCACGAGGGGGAGAAGG + Intronic
1172042046 20:32052587-32052609 CTGGGGGCAGCGAGGGGAGACGG + Intronic
1172588301 20:36100328-36100350 CTGGGGACAAGGTGGGGAGAGGG - Intronic
1172618343 20:36304966-36304988 GTGTCAGCAAGGAGGAGAGTGGG - Intergenic
1172893359 20:38282789-38282811 CTGAGAGCTAGGAGGGCAGGAGG - Intronic
1174040276 20:47694458-47694480 CTGTGAGCAGGAGGGTGAGATGG + Intronic
1174332645 20:49832148-49832170 ATGAGAGGAAGGTGGGGAGAAGG - Intronic
1174481276 20:50833170-50833192 CTCTGAGCAAGGAGGAGATTGGG + Intronic
1174643153 20:52062705-52062727 CAGTGAACAAAGAGAGGAGAGGG + Intronic
1174882175 20:54292014-54292036 CTGTGGGTTAGGTGGGGAGAGGG - Intergenic
1175763088 20:61574177-61574199 ATGTGTGCAAGGTGTGGAGATGG - Intronic
1176002639 20:62839853-62839875 GTGTGTGCGTGGAGGGGAGAAGG - Intronic
1176024323 20:62978101-62978123 AAGTGCGCCAGGAGGGGAGATGG - Intergenic
1176127038 20:63480205-63480227 CTGTGAGAAACCAGGGAAGAGGG - Intergenic
1176283238 20:64327398-64327420 GAGTGAGCGGGGAGGGGAGATGG - Intergenic
1177089058 21:16743398-16743420 CTATGAGAAAAGAGGGCAGATGG - Intergenic
1177175030 21:17693923-17693945 ATGTGGGGAAGGATGGGAGAAGG + Intergenic
1177418765 21:20828042-20828064 CTGTGAGCAAGTGGGGTAGAGGG + Intergenic
1178794030 21:35727001-35727023 CTGTGGGCAAGGAGGAGGGTAGG - Intronic
1178965698 21:37115029-37115051 TTGTGAGGTGGGAGGGGAGAGGG + Intronic
1179021827 21:37647755-37647777 CTGTCAGCCAGGAGGGAACAAGG - Intronic
1179049160 21:37874104-37874126 CAGGGAGCAGGGAAGGGAGAGGG - Intronic
1179562237 21:42222954-42222976 CTGTGAGCCAGGTGGGGTGATGG - Intronic
1180177327 21:46097349-46097371 CTGTGACCAGGGTGGGGAGTGGG + Intergenic
1180246887 21:46554482-46554504 CTGCGAGAGAGGAGGGGAGGTGG - Intronic
1180319596 22:11308132-11308154 TGGTGTGCAAGGAGGGGAGCCGG + Intergenic
1181161164 22:20960748-20960770 GTGTGGGCAAGGAGGTAAGATGG - Intergenic
1181387714 22:22557900-22557922 GGGTGGGGAAGGAGGGGAGATGG + Intronic
1181434522 22:22902616-22902638 CTGTGACCAAGGGAGGGCGAAGG - Intergenic
1182011650 22:27006297-27006319 CTGTGAGCAAGGACAGCAGAGGG - Intergenic
1182021684 22:27086903-27086925 CTGTGAGAAAGGAGGCGTGCCGG + Intergenic
1182255032 22:29031797-29031819 CTGTGGTCAGGGAGGGGAAAAGG - Intronic
1183116331 22:35695261-35695283 CTAAGAGCAAGGGGGGGAGAGGG + Intergenic
1183354545 22:37351162-37351184 CTGGGAGGAGAGAGGGGAGAAGG - Intergenic
1183913570 22:41098140-41098162 TTTTTAGCAGGGAGGGGAGAGGG - Intronic
1184073743 22:42163084-42163106 CTCTGCTCAAGGAGGGGACAGGG + Intronic
1184252942 22:43271206-43271228 CTATGAGCAAGGAGGGAGCAGGG - Intronic
1184257919 22:43297472-43297494 CTGTGAGGACCGAGTGGAGATGG - Intronic
1184880168 22:47299581-47299603 CTGTGAGCACAGAGGAGAGCAGG - Intergenic
1185098316 22:48823572-48823594 CTCTGAGCTAGGAGAGAAGAGGG - Intronic
1185208391 22:49553210-49553232 CTGTGGGCAGGGAGGGGAGGAGG + Intronic
949745891 3:7291763-7291785 CTATCAGCAAAGATGGGAGAGGG + Intronic
949916876 3:8971965-8971987 CAGTGAGAAAGGAGGGAAGCTGG + Intergenic
950023804 3:9807118-9807140 GTGTGTGAAAGGAGGGGAGGTGG + Intronic
951630001 3:24709325-24709347 CTGTGAAAAAAGTGGGGAGAGGG + Intergenic
952083997 3:29795711-29795733 CTGGGAGGAAGGAGGGAAGAGGG + Intronic
952531460 3:34266450-34266472 TTGGGAGAAAGGAGGGAAGAAGG - Intergenic
952976356 3:38699524-38699546 CAAAGAGCAAGTAGGGGAGAGGG - Intronic
953026740 3:39149705-39149727 AAGAGAGCAAGGTGGGGAGAGGG - Intronic
953369859 3:42378202-42378224 CTGGGAGAAACTAGGGGAGATGG - Intergenic
953927408 3:46989439-46989461 CTGGGCCCAAGGAGGGGTGACGG + Intronic
954285675 3:49617431-49617453 GTGTAAGCAAGGAGGGGAGAGGG - Intronic
954392504 3:50274989-50275011 CTGAGAGGGAGGAGGGGCGACGG - Intronic
954609249 3:51935571-51935593 CTGTGAGTGTGGATGGGAGAGGG - Exonic
954677416 3:52323556-52323578 CTCAGATCAAGGAGGGGAGCTGG + Intronic
954967279 3:54622953-54622975 CTGTGATTAAGAAGGGGAGGAGG + Intronic
955771280 3:62387137-62387159 TTATGAGCAAGGAGGGGGGCAGG - Intergenic
955968609 3:64414079-64414101 CAGTGTTCAAAGAGGGGAGAAGG - Intronic
956911880 3:73826630-73826652 GTATGAGCGAGGCGGGGAGACGG - Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
959380031 3:105630605-105630627 GTGATAGGAAGGAGGGGAGAGGG - Intergenic
961243473 3:125432231-125432253 CTGTGGGCAAGGAGGTGTGAGGG - Intergenic
961569041 3:127785185-127785207 GTGTGGGGAAGGAGGGGGGAAGG - Intronic
961581603 3:127887857-127887879 CTGAGAACCAGGAGGGCAGATGG + Intergenic
961624853 3:128254771-128254793 CTGAGAGTGGGGAGGGGAGAGGG + Intronic
962897346 3:139728312-139728334 CTGTGAGAAAGCAGGGAAAATGG + Intergenic
963074635 3:141334509-141334531 CAGAGAGAAAGGAAGGGAGAAGG - Intronic
963335681 3:143971786-143971808 CTGAGACCAAGAAGGGGAGCCGG - Exonic
963378828 3:144503834-144503856 CTCTCAGCAGAGAGGGGAGATGG + Intergenic
963732045 3:148984451-148984473 CTTTGAGGAAGGAGAGGAGAGGG - Intergenic
964268530 3:154929529-154929551 CTGTGAGCCAGGAGGCAAGAGGG + Intergenic
965694396 3:171392342-171392364 CTATGAGAAAGGGGAGGAGAGGG + Intronic
967049059 3:185765443-185765465 CTGAGATTAAGGAGGGGAGGTGG - Intronic
968441551 4:626916-626938 CTCTGAGGAAGAAGGGGAGGGGG + Intronic
968657557 4:1785260-1785282 CTGGGAGCAGGGAGGGGAGCTGG + Intergenic
969940440 4:10726013-10726035 CTGTGAGCAAGGTGTGGGCAGGG + Intergenic
970515806 4:16829057-16829079 CAGTGAGGGAGGAGGGGAGTGGG - Intronic
970747824 4:19320507-19320529 GTGTGAGCAGGGAAGGGAGGGGG + Intergenic
970993220 4:22236744-22236766 CAGTGAGCAAGAAGGGGAAGAGG - Intergenic
971376034 4:26056443-26056465 CTGGCAGAAAAGAGGGGAGAGGG - Intergenic
971451755 4:26807313-26807335 CTCTGTCCAAGGAGGGAAGAAGG + Intergenic
971509232 4:27403460-27403482 CTGGGAGAAAGGATGGGAGGGGG + Intergenic
972340631 4:38149560-38149582 CTGAGAGCAAGGAGGGGTGGGGG - Intergenic
972805689 4:42527919-42527941 CTCTGGGGAAGGATGGGAGAAGG - Intronic
973001832 4:44961404-44961426 GCGTGAGCATGGAAGGGAGAAGG + Intergenic
974817690 4:67026532-67026554 CTGCAAGCAAGGAGGGGTAAAGG - Intergenic
975371991 4:73599758-73599780 TTCTGAGCAAAGAGGAGAGATGG - Intronic
975572057 4:75827902-75827924 CTGAGAGACAGGAGGGCAGAAGG - Intergenic
975670918 4:76779891-76779913 GTGTGAGACAGGAGGGGAGCAGG - Exonic
975837627 4:78441328-78441350 TTGAGAGAAGGGAGGGGAGAGGG + Intronic
976281889 4:83334381-83334403 CTGAGAGTAAGGGAGGGAGAGGG + Intronic
976998784 4:91468353-91468375 TGGTGTGCAGGGAGGGGAGAGGG + Intronic
977003890 4:91541369-91541391 TGGTGTGCAGGGAGGGGAGAGGG - Intronic
978147997 4:105399707-105399729 CTGTTAGGAGGCAGGGGAGAGGG + Intronic
978228322 4:106366011-106366033 CTGTGAATAAGGAGAGGAGCTGG - Intergenic
978730997 4:112026116-112026138 CTGTCAGCAGGGAGGGGAAAGGG + Intergenic
980729136 4:136804668-136804690 CTTTCAGCAGAGAGGGGAGATGG - Intergenic
981467383 4:145088884-145088906 CAGTGAGTAAGGAGGAGAAATGG - Intronic
981563040 4:146067692-146067714 CTGTGAGAAGGAAGGAGAGAAGG - Intergenic
982106846 4:152018659-152018681 CTTTCAGCAGGGAAGGGAGAAGG - Intergenic
982193937 4:152890267-152890289 CACTGAGCAGGGAGGGAAGAAGG + Intronic
984092117 4:175387473-175387495 CTGTGAGGAAGGATGGGTCAGGG - Intergenic
984853664 4:184175070-184175092 CTGGGAGCCAAGAGGAGAGACGG - Intronic
985379921 4:189382817-189382839 TTGTGTGAAAGGAGAGGAGAGGG - Intergenic
985565587 5:613959-613981 CTCTGAGGAAGCAGGTGAGAGGG + Intronic
985570810 5:643788-643810 CTGTCATCGAGGAGGGGAAAGGG - Intronic
985721139 5:1489859-1489881 CTGGAAGAGAGGAGGGGAGACGG + Intronic
985783140 5:1881270-1881292 ATGGAAGCCAGGAGGGGAGAAGG + Intronic
987097285 5:14561095-14561117 TTGTGAGCTAAGAGGGGAGATGG + Intergenic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987264175 5:16235195-16235217 CTGAAAGCAAGGAGGAGAAAGGG - Intergenic
988414264 5:30926213-30926235 TTGTGAGGAAGTAGGGAAGAGGG - Intergenic
988838374 5:35057166-35057188 CTGAGAAAAATGAGGGGAGATGG - Exonic
989351362 5:40490760-40490782 TTTTGAGCAAGAAGGGGAAAAGG - Intergenic
991030525 5:62077642-62077664 ATGAGAGCAACCAGGGGAGAAGG + Intergenic
991486867 5:67145985-67146007 CTGGGACTAAGGAGGGGAAAGGG + Intronic
991955557 5:71991794-71991816 CTGTCAGAATGGAGAGGAGAAGG + Intergenic
992170947 5:74101533-74101555 GTGTGAGAAAGAAAGGGAGAGGG + Intergenic
993010835 5:82480503-82480525 CAGGGAGAAAGGATGGGAGAGGG + Intergenic
994615620 5:102100580-102100602 GTGGGAACATGGAGGGGAGAAGG - Intergenic
994985357 5:106926526-106926548 CTGAGAGACAGGAGGGCAGAAGG - Intergenic
996464037 5:123779201-123779223 CTGCAAGCAAGGAGATGAGAAGG - Intergenic
996551882 5:124739467-124739489 CTGGAGGCAAGGAGGGGAAAAGG - Intronic
996767254 5:127046878-127046900 CTGTGAGCCAGGAGAGAACAAGG + Exonic
997158631 5:131584016-131584038 CTGGGACCAAGGAAGGGAGCAGG + Intronic
997474483 5:134134651-134134673 CTGTGACCAATGAGGTGAGTAGG + Intronic
997744096 5:136283644-136283666 TTGTGAGAAAGGAGGTGAAAAGG + Intronic
998490114 5:142539472-142539494 GGGGAAGCAAGGAGGGGAGAGGG - Intergenic
998658083 5:144204984-144205006 CCGTGAACGAGGAGGGGGGAGGG + Intronic
999320733 5:150613542-150613564 CTGTGAGCAATGAGGAGCCATGG + Intronic
1000107967 5:158078815-158078837 CTGGGAGCAAGCAGGGTAGGAGG - Intergenic
1000724248 5:164749317-164749339 CTCTGAGTAAGGAGGAGAGAAGG - Intergenic
1001295505 5:170496086-170496108 AAGTGAGCAGGGAGGGGAGGAGG - Intronic
1001560813 5:172667877-172667899 GTGGGAGCAAGGAGGGAAGCGGG - Intronic
1001684344 5:173582271-173582293 TGGTGAGAAAGGAAGGGAGAAGG + Intergenic
1002826365 6:777713-777735 CTGTGTGGAGGGATGGGAGAGGG + Intergenic
1003096669 6:3147798-3147820 CTGACAGCCAGGAGAGGAGATGG + Intronic
1003327080 6:5100218-5100240 GCGTCAGCAAGGAGGGGAGTTGG + Intergenic
1003535202 6:6970231-6970253 CTGTTAGCAATGGAGGGAGAAGG + Intergenic
1004610568 6:17235845-17235867 CTGAGAGGAAAGAGGAGAGATGG + Intergenic
1004720687 6:18265188-18265210 GTGTGAGAGAGGAGAGGAGAAGG - Intergenic
1005531684 6:26713504-26713526 CTGTGAGGAGGGAGGAGAAAAGG - Intergenic
1005539111 6:26788161-26788183 CTGTGAGGAGGGAGGAGAAAAGG + Intergenic
1005940164 6:30554973-30554995 CTGTGAGGAAGGAGGGGTCTGGG - Intronic
1006169117 6:32082952-32082974 ATGAGAGCAAAGAGGGAAGATGG - Intronic
1006187325 6:32188860-32188882 CTGAGAACAAGGAGGGAGGAGGG + Intronic
1006303497 6:33206352-33206374 CTATGAGAATGGTGGGGAGAGGG - Intronic
1006450964 6:34105499-34105521 CTGAGAGGAAGGAGGGGACAAGG - Intronic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1007373062 6:41439513-41439535 ATGGGAGCTAGGAGAGGAGATGG - Intergenic
1007378749 6:41473209-41473231 AGGGGAGCAAGTAGGGGAGAAGG - Intergenic
1007556204 6:42768661-42768683 CACTGGGCATGGAGGGGAGAAGG - Intronic
1007744622 6:44035857-44035879 TTGTGAGCAAGGAGGGTGCACGG + Intergenic
1009009945 6:57830387-57830409 CTGTGAGGAGGGAGGAGAAAAGG + Intergenic
1010590419 6:77706052-77706074 GTGGGAGAAAGAAGGGGAGAAGG - Intronic
1012247043 6:96937717-96937739 CTGTGAGGATGGAGGGTAGAGGG - Intronic
1012426629 6:99122066-99122088 CTGTCAGTGAGGAAGGGAGAAGG - Intergenic
1012950982 6:105517605-105517627 CTGTGAGGGAGGCGGGGAAATGG + Intergenic
1012986219 6:105878796-105878818 CTCTGAGCAAGGGGTGGTGACGG + Intergenic
1016426320 6:143939467-143939489 CTGAGAACAAAGAGGGGATATGG + Intergenic
1017115932 6:150976243-150976265 CTGGGAGCTGGGAGGGGAGCTGG + Intronic
1017912460 6:158805859-158805881 CTGTGGGCAGGGATGGGGGAAGG - Intronic
1018033860 6:159865619-159865641 CACTGGGCAAGGAGGGGAAAGGG + Intergenic
1018205609 6:161434918-161434940 CTGGGAGGAAGGAGAGGGGAGGG + Intronic
1018274247 6:162113501-162113523 CTGTGGTCAATGAAGGGAGAGGG + Intronic
1018291455 6:162296100-162296122 AAGAGAACAAGGAGGGGAGAGGG + Intronic
1018964476 6:168473841-168473863 GTGTGAGGAAGGAGGGCAGGGGG + Intronic
1018972252 6:168537814-168537836 CTGTCAGCACGAAGGGGAAAGGG + Intronic
1019345123 7:526010-526032 CTGTGGGCACGGTGGAGAGACGG - Intergenic
1019856883 7:3617947-3617969 GTGTGAGCAGAGAGGGGAGGAGG + Intronic
1019999099 7:4744772-4744794 CTGGGCGGAAGGAGGGGAAAGGG - Intronic
1020429626 7:8105682-8105704 CTCTGAGCAACCAGGGCAGAGGG - Intergenic
1020684067 7:11271886-11271908 CAGTAAACAAGGAGGTGAGATGG - Intergenic
1020991014 7:15196046-15196068 CTGTCAAAAAGGAGAGGAGAGGG - Intergenic
1021653470 7:22853639-22853661 CTGTGAGGAGGAAGGGGAGAAGG - Intergenic
1021867158 7:24969869-24969891 CAGTGAACAAGGAGGTGACACGG - Intronic
1022385009 7:29891616-29891638 AACTGAGCAAGGATGGGAGATGG - Intronic
1022417366 7:30189777-30189799 CTGAGAGACAGGAGGGCAGAAGG - Intergenic
1023294461 7:38700481-38700503 CTGTGACCCAGAAGCGGAGAGGG + Intergenic
1023674716 7:42617470-42617492 CTGTGTGCAAGCAGGAGAGAGGG - Intergenic
1023875699 7:44285139-44285161 CTATGAGGCAGGAGGGGAGGGGG + Intronic
1023878762 7:44307024-44307046 GTGTGAGCAGGGAGAGGAGGCGG + Intronic
1024226199 7:47328309-47328331 CAGTGAGCAAGGCGGGGCCAGGG - Intronic
1024288345 7:47780250-47780272 CGGTGAGGAAGGAAGGAAGAAGG - Intronic
1026571455 7:71534879-71534901 AAGTGAGCAAGAAAGGGAGATGG - Intronic
1026853516 7:73738824-73738846 CTGCGAGCTAGGGCGGGAGAAGG - Exonic
1026873900 7:73869129-73869151 CTGTGAGCATGGAGGGGCCCTGG + Intergenic
1027231221 7:76273846-76273868 AGGTGAAGAAGGAGGGGAGATGG - Intronic
1028407059 7:90486595-90486617 CAGTGAGCAGTGTGGGGAGAGGG + Intronic
1028842103 7:95439811-95439833 CTGGGAGAAAAGAGGGGAGCAGG + Intergenic
1029078937 7:97957076-97957098 CTAAGAGCCAGGAGGGGAGAGGG + Intergenic
1029489224 7:100861369-100861391 CTGCGGGCATGGAGGGGAGGAGG - Intronic
1029601118 7:101563959-101563981 CTGTGAGCCAGGAGGGGACCTGG - Intergenic
1029930533 7:104365843-104365865 GTGTGGGCGGGGAGGGGAGATGG + Intronic
1029956880 7:104649544-104649566 CTGGGACAAAGGAGGGGAGCAGG + Intronic
1030153158 7:106426341-106426363 CTTTGAGCTAGAAGGGAAGAGGG - Intergenic
1030949645 7:115774092-115774114 CAGGGAACAAGAAGGGGAGAAGG - Intergenic
1031085735 7:117299960-117299982 CTGTTAGCAAGGAAGGGAGGAGG - Intronic
1031150689 7:118050555-118050577 GAGTAAGCAAGGAGAGGAGAGGG - Intergenic
1031188605 7:118516729-118516751 CTGTGAGAAAAGAGGGTACAAGG - Intergenic
1031632411 7:124060470-124060492 CTGTGATCATGGAGCAGAGAAGG - Intergenic
1031934443 7:127721717-127721739 CTGTGAATAAGGAGAGGAGAAGG + Intronic
1031976247 7:128095410-128095432 CTGTGAGCAGGTGGGGAAGAAGG + Intergenic
1032959557 7:137015684-137015706 CTGTGTTCAGGGAGAGGAGAAGG + Exonic
1033459029 7:141528734-141528756 CTGTTGGAGAGGAGGGGAGATGG - Intergenic
1033659100 7:143391536-143391558 CTGTGGGCAAGGAAGGGTGGGGG + Intronic
1033760800 7:144434741-144434763 CTGAGAGCAAATAGGGTAGAGGG + Intergenic
1034391883 7:150793507-150793529 CAGTGAACAAGGTGGAGAGAGGG + Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1034988973 7:155535612-155535634 GTGTAGGCAAGGAAGGGAGAAGG - Intergenic
1034999934 7:155604399-155604421 CTCTGAGGATGGAGGTGAGAGGG + Intergenic
1035343144 7:158177536-158177558 CTGTGGACAGGGATGGGAGAGGG - Intronic
1036562741 8:9910998-9911020 TTCGGAACAAGGAGGGGAGAGGG - Intergenic
1037025810 8:14035803-14035825 CTGTTAGCAATGATAGGAGAAGG + Intergenic
1037178349 8:15973612-15973634 CAGTGAGTAAGGGGAGGAGAGGG + Intergenic
1038483066 8:27914916-27914938 CTGGGATCAGGGAAGGGAGAAGG - Intronic
1038761037 8:30384470-30384492 CGGAGAGGAGGGAGGGGAGAGGG + Intronic
1039129182 8:34242280-34242302 GTGTGAGCAAGAAGGAGAGGAGG + Intergenic
1039412768 8:37369349-37369371 CTGTGAGCCAGGAGGGCTTAGGG - Intergenic
1039547145 8:38418396-38418418 CCTAGAGCAAGGAGGGGGGACGG + Intronic
1039868989 8:41529448-41529470 CTGAGAGGGAGGAGGGGAGGGGG + Intronic
1039899248 8:41739651-41739673 TTGTCAGCATGGAGGTGAGAAGG + Intronic
1040604867 8:48921682-48921704 CTGGGAGCTAGGAGGGGCGCAGG + Exonic
1040879380 8:52189116-52189138 TTGGGGGCAAGGAGGGGAGATGG - Intronic
1041403356 8:57468306-57468328 AGGAGAGAAAGGAGGGGAGAAGG + Intergenic
1042856189 8:73270540-73270562 CTTTCAGGAAGGAGGGGAGATGG + Intergenic
1043426501 8:80153459-80153481 CTGGGACCTAGGAGGGGAGAGGG - Intronic
1045485197 8:102625777-102625799 CTGTGAGGAGGGAGAGGACAGGG + Intergenic
1045494117 8:102693883-102693905 GTGTGAGCAAGCCGGGCAGAAGG + Intergenic
1045520465 8:102898659-102898681 CTGGGAGGAAGGAGAGAAGAGGG + Intronic
1045650310 8:104336187-104336209 CTGACTGCAAGGAAGGGAGAGGG + Intronic
1046190617 8:110790084-110790106 CCCTGAGCAAGGAGGGGATTAGG + Intergenic
1046320194 8:112564338-112564360 AGGGGAGAAAGGAGGGGAGAAGG - Intronic
1046406244 8:113776140-113776162 CTCTTAGCAAAGAGGGGACATGG - Intergenic
1047497999 8:125422275-125422297 ATGTGAGGAGGGAGGAGAGAGGG + Intergenic
1048445092 8:134487387-134487409 CTGTGAGGAAGGCAGGGTGAGGG + Intronic
1049036279 8:140078785-140078807 CTGGGGGCAGGGAGGGGAGGTGG - Intronic
1049192866 8:141298472-141298494 CTGTGAGCTAGCAGGGGACTGGG - Intronic
1049288288 8:141788361-141788383 CGTGGAGCACGGAGGGGAGAGGG - Intergenic
1049890326 9:63236-63258 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1050602582 9:7267662-7267684 CTGTGAGAAAGGACAGGAAAGGG - Intergenic
1050902905 9:10967831-10967853 CTAAGAGCCAGGCGGGGAGAGGG - Intergenic
1050939709 9:11443343-11443365 CTGTCAGCAGAGAGGGGAGCTGG - Intergenic
1050999301 9:12260318-12260340 CTGTGATCAAAGAAGGTAGAAGG + Intergenic
1051547266 9:18290717-18290739 CTGTGATCAAGTAGGGTAAAGGG - Intergenic
1052228647 9:26120359-26120381 TGGTGAACAAGGAGGAGAGAAGG + Intergenic
1053178029 9:35943432-35943454 CTCAGATCAAGGAGGGGAAATGG - Intergenic
1053494184 9:38537731-38537753 CTGGGTGCAAGGACAGGAGAAGG + Intergenic
1053583887 9:39436187-39436209 CTCTGAGCAGGAAGGGGAGCTGG + Intergenic
1053584070 9:39437821-39437843 CTCTGAGCAAGCTGGGGTGAAGG - Intergenic
1053731791 9:41064421-41064443 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1054105468 9:60994931-60994953 CTCTGAGCAGGAAGGGGAGCTGG + Intergenic
1054105651 9:60996565-60996587 CTCTGAGCAAGCTGGGGTGAAGG - Intergenic
1054849423 9:69831560-69831582 CTGTGAGATAGGAGTGGGGAGGG + Intronic
1056591377 9:87968445-87968467 CTGAGTGCAGGGAGGGGACAGGG + Intronic
1056601934 9:88053389-88053411 CTCTGCGCAAGGAGGGGAGGAGG - Intergenic
1057006922 9:91568829-91568851 TTGTGAGCACAGAAGGGAGAGGG - Intronic
1057034911 9:91804974-91804996 CTGTGAGAAAGGAGGGCTAAGGG - Intronic
1057483449 9:95463356-95463378 GGGTGAGCGTGGAGGGGAGACGG + Intronic
1057553453 9:96068866-96068888 ATGTGAGTGGGGAGGGGAGAGGG - Intergenic
1058317462 9:103586536-103586558 CTGTTAGCAGAGAGGGGAGCTGG - Intergenic
1058763611 9:108160497-108160519 ATGTGAGCAGGGAGTGGAGAGGG - Intergenic
1058801733 9:108551216-108551238 CTGTGAGCAAAAATGGGATATGG - Intergenic
1058987837 9:110225138-110225160 GTGAGAGCAAGCAGGGGAAATGG - Intergenic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059465481 9:114466599-114466621 CTGTGACCAAGAGGGGGTGAGGG - Intronic
1059852585 9:118361195-118361217 CTGAGATCAAGTAGGGGACATGG + Intergenic
1060056029 9:120413800-120413822 CAGTGAGCGAGGAGGGAGGAGGG + Intronic
1060595749 9:124847639-124847661 ATGTGGGGAAGTAGGGGAGAGGG - Intergenic
1060799076 9:126532309-126532331 CTCTGGGCTGGGAGGGGAGAGGG - Intergenic
1060861614 9:126959508-126959530 TCATGAGCAAGGAGAGGAGACGG - Intronic
1061187908 9:129065763-129065785 AAGTGACCAAGGAAGGGAGAGGG - Intronic
1061375292 9:130220411-130220433 CTGCAGGCAAGGAGGAGAGAGGG + Intronic
1061483410 9:130908489-130908511 GTGGGTGGAAGGAGGGGAGATGG - Intronic
1061561938 9:131410235-131410257 CTGTGAGCTAGATGAGGAGAGGG + Intronic
1062289825 9:135789503-135789525 CTGTGAGGAAGGCGTGAAGAGGG - Intronic
1062356861 9:136169201-136169223 CTGTGGCCAAGGAGGGGGCAAGG + Intergenic
1062520262 9:136954681-136954703 TTGTGAGCAGGGATGGGTGAGGG - Intronic
1062735454 9:138134875-138134897 CTGTGGCCAAGGATGGGGGAAGG + Intergenic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1186753039 X:12641389-12641411 CTGAGAGCATGGAGGGGAGGGGG - Intronic
1187512843 X:19937895-19937917 CTGTCAGCAAGAAGGGGAGGGGG - Intronic
1187636675 X:21237398-21237420 CTGTGTGCTAGGAGGAGGGAGGG + Intergenic
1188593808 X:31872085-31872107 CTGTGTTCAAGGTGGGGGGAGGG - Intronic
1189185059 X:39047642-39047664 ATGAGAGCAGGGAGGAGAGAAGG - Intergenic
1191131839 X:57022253-57022275 CTGTAGGCAAGGAGGAGGGAAGG - Intergenic
1191780807 X:64863200-64863222 CTGTGGGGGAGGTGGGGAGAGGG - Intergenic
1192503827 X:71669152-71669174 CTGTGAGCAAGGGATAGAGAGGG - Intergenic
1192522589 X:71815196-71815218 CTGTGAGCAAGGGATAGAGAGGG - Intergenic
1192917281 X:75666224-75666246 CTCTGGGCATGGAGTGGAGAGGG + Intergenic
1193359924 X:80569976-80569998 CTGGGAGCACAGAGGGGAGAGGG - Intergenic
1195222797 X:102762533-102762555 CAGTGAGCTATGAGGGGAAATGG - Intergenic
1195594819 X:106675627-106675649 CTGTGACCAAAGAGAGGAAATGG + Intronic
1196889502 X:120278192-120278214 CTGTGAGCACAGAGGGGAAGTGG + Intronic
1196918777 X:120565100-120565122 CTGTGATCAAAAAGGGGAAATGG - Intronic
1197716113 X:129707109-129707131 CAGTGTGCAATGAGAGGAGAAGG - Intergenic
1197795077 X:130289801-130289823 CTGTCAGGGAGCAGGGGAGAGGG + Intergenic
1199433766 X:147789687-147789709 CTGAGAGAAGGGAGGGGAGTGGG - Intergenic
1200397671 X:156000723-156000745 CTGTGGTCAAGGATGGGGGAAGG + Intronic
1201696216 Y:16829337-16829359 TTGTGAGCAAAGAGTGGAGAAGG - Intergenic