ID: 1077544374

View in Genome Browser
Species Human (GRCh38)
Location 11:3162906-3162928
Sequence GGGAGTGCACCAGTGTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 243}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077544374_1077544385 8 Left 1077544374 11:3162906-3162928 CCCCAGCACACTGGTGCACTCCC 0: 1
1: 0
2: 1
3: 19
4: 243
Right 1077544385 11:3162937-3162959 CCTGCCAACCCTGCAAGTGGTGG 0: 1
1: 0
2: 0
3: 15
4: 148
1077544374_1077544386 9 Left 1077544374 11:3162906-3162928 CCCCAGCACACTGGTGCACTCCC 0: 1
1: 0
2: 1
3: 19
4: 243
Right 1077544386 11:3162938-3162960 CTGCCAACCCTGCAAGTGGTGGG 0: 1
1: 0
2: 1
3: 6
4: 99
1077544374_1077544390 26 Left 1077544374 11:3162906-3162928 CCCCAGCACACTGGTGCACTCCC 0: 1
1: 0
2: 1
3: 19
4: 243
Right 1077544390 11:3162955-3162977 GGTGGGCACTTCTACCCACCTGG 0: 1
1: 0
2: 0
3: 11
4: 117
1077544374_1077544381 5 Left 1077544374 11:3162906-3162928 CCCCAGCACACTGGTGCACTCCC 0: 1
1: 0
2: 1
3: 19
4: 243
Right 1077544381 11:3162934-3162956 TCCCCTGCCAACCCTGCAAGTGG 0: 1
1: 0
2: 1
3: 26
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077544374 Original CRISPR GGGAGTGCACCAGTGTGCTG GGG (reversed) Intronic
900215039 1:1477058-1477080 TGGAGTGCAGCAGTGTGATCTGG + Intronic
900390863 1:2433222-2433244 CGGGGAGGACCAGTGTGCTGTGG + Intronic
900478044 1:2885260-2885282 GGGAGTGCCCCTGTTTTCTGAGG + Intergenic
901028723 1:6293650-6293672 GGGATTGCACCACTGTACTCCGG + Intronic
901033545 1:6322441-6322463 TGGAGTGTACCCGTGTGCTGGGG + Intronic
901142297 1:7043018-7043040 GGGTGTGCTGCAGTGTGCTCTGG + Intronic
901655820 1:10768607-10768629 GGACGGGCACCAGAGTGCTGGGG + Intronic
906136882 1:43506245-43506267 GGGAGGGGACGAGGGTGCTGTGG - Intergenic
906668653 1:47639165-47639187 TGGACTGCTCCTGTGTGCTGTGG + Intergenic
907467791 1:54651010-54651032 GGGAGTGCAGCTGGGTGCAGGGG - Intronic
909413508 1:75380048-75380070 GGGAATGCCCCAGTTTGTTGTGG - Intronic
909701958 1:78535048-78535070 GGCAGTGCCCTAGTGTTCTGGGG + Intronic
914195691 1:145446893-145446915 GGGAGAGCCCCCGTGTTCTGGGG - Intergenic
915402379 1:155632861-155632883 GGGAATGCCCCAGTTTGTTGTGG + Intergenic
915596366 1:156898530-156898552 TGGAGTGCAGCAGGCTGCTGGGG + Intronic
920629643 1:207639035-207639057 GGGAATGCCCCAGTTTGTTGCGG + Intronic
921922724 1:220686929-220686951 GGGTGTGTACCTGTGTGCAGTGG - Intergenic
923291559 1:232551224-232551246 GGGACTACACCAGTGTTTTGTGG - Intronic
924476834 1:244389704-244389726 GGGAGTCAACTAGTATGCTGGGG - Intergenic
1062826858 10:576297-576319 GTGAGTGCTCGAGTGTGATGTGG - Intronic
1063429645 10:5977503-5977525 GGGAGTCCAGCGGTGTCCTGTGG - Exonic
1063530933 10:6830657-6830679 GGGAATGCCCCAGTTTGTTGTGG + Intergenic
1064283424 10:13971061-13971083 GTGTGTGCACCTGTGTGTTGGGG - Intronic
1065384908 10:25125189-25125211 GGGAGTGCAGCTGTTTCCTGTGG - Intergenic
1065839279 10:29687556-29687578 GGTAGTGCACACTTGTGCTGAGG + Intronic
1067838863 10:49660109-49660131 GGGAGAGTAGAAGTGTGCTGGGG + Intronic
1068486412 10:57664970-57664992 GGGAGTGCAGCAAAGGGCTGTGG + Intergenic
1069599301 10:69693095-69693117 GGGAGAGCAACAGTGTGCAAAGG - Intergenic
1070237097 10:74639893-74639915 GTGAGTATGCCAGTGTGCTGGGG + Intronic
1071572752 10:86706897-86706919 GGGTGTGCACCACTGTGGCGGGG + Intronic
1072539095 10:96384821-96384843 GCAGGTGCAGCAGTGTGCTGGGG - Intronic
1072542082 10:96406153-96406175 GGTACAGCACCTGTGTGCTGAGG - Intronic
1072947774 10:99825942-99825964 GGGAATGCCCCAGTTTGTTGTGG + Intronic
1073203214 10:101753096-101753118 GGCAGCGTCCCAGTGTGCTGGGG - Intergenic
1075393130 10:122107537-122107559 TGGAGTGCAACAGTGTGATCTGG - Intronic
1076042450 10:127262278-127262300 GTGTGTGTACCTGTGTGCTGAGG + Intronic
1076529048 10:131132478-131132500 GGGAGTGCAGCCGGGTGATGAGG + Intronic
1076784662 10:132743802-132743824 TGGGGTGCACACGTGTGCTGAGG + Intronic
1076805683 10:132857548-132857570 GGGAGTGACCCAGTGTGCACAGG + Intronic
1077454376 11:2669587-2669609 GTGACTGCCCCAGTGTCCTGTGG - Intronic
1077544374 11:3162906-3162928 GGGAGTGCACCAGTGTGCTGGGG - Intronic
1078417078 11:11174644-11174666 GGCAGTGCCCCAGTTAGCTGGGG - Intergenic
1079469559 11:20765408-20765430 GGAAGCTCACCACTGTGCTGTGG - Intronic
1080595490 11:33770560-33770582 GGGAGAGCAGCAGTGGGCTAAGG + Intronic
1083902410 11:65650052-65650074 GTGAGGCCACCAGGGTGCTGCGG + Intronic
1083936958 11:65874197-65874219 TGGAGTGCAGCAGTGTGATCTGG - Intergenic
1085299433 11:75449740-75449762 GGGAGGACACCAGGGTCCTGAGG - Intronic
1085574583 11:77590523-77590545 GGAAGTGCAGCAGAGCGCTGTGG - Exonic
1087672691 11:101127327-101127349 GGGAGCGCAGCGGTGCGCTGGGG + Intronic
1087724050 11:101698025-101698047 GGGAATGCCCCAGTTTGTTGTGG - Intronic
1089461381 11:118656241-118656263 GGGTGGGCACCAGAGGGCTGGGG - Intronic
1089471789 11:118727195-118727217 GGGAATGCCCCAGTTTGTTGTGG + Intergenic
1090272810 11:125399784-125399806 GGGGGTGCACCAGGGTAGTGGGG + Intronic
1091681212 12:2528492-2528514 GGGTGTGCACAAGTGTGCAGAGG - Intronic
1094599946 12:31899922-31899944 TGGAGTGCACCAGTGTGATCTGG + Intergenic
1096688969 12:53307822-53307844 GTGAGTGCGCCAGGCTGCTGGGG - Intronic
1097331132 12:58333931-58333953 GGGAATGCCCCAGTTTGTTGTGG + Intergenic
1097787533 12:63778298-63778320 GGGAATGCAGCAGTGTGGAGGGG - Intergenic
1099709986 12:86211536-86211558 GAGATTGCTCCACTGTGCTGCGG + Intronic
1100528195 12:95439814-95439836 GGGAGTGCACCATTCTGGGGAGG + Intergenic
1102490019 12:113285028-113285050 AGGAGAGCAACAGTGTGCAGCGG - Intronic
1103615500 12:122149187-122149209 GTGCGTGCACCTGTGTGGTGGGG - Intergenic
1104225778 12:126831885-126831907 AGGAGAGCATCAGTGAGCTGTGG - Intergenic
1104319850 12:127740796-127740818 TGGAGTGCAGCAGCGTGCTTTGG - Intergenic
1104617644 12:130283873-130283895 GGGGGGGCTCCTGTGTGCTGTGG + Intergenic
1106493125 13:30247175-30247197 GGGTGTGCAGCAGTATGCTAGGG - Intronic
1106831255 13:33585643-33585665 GAGATTGCACCACTGTGCTCTGG + Intergenic
1110462795 13:75764440-75764462 AGGAGCTCTCCAGTGTGCTGTGG - Intronic
1113291545 13:108911967-108911989 AGGAGGGAACCAGGGTGCTGGGG + Intronic
1113335246 13:109370780-109370802 GAGAGTGCATCAGCCTGCTGGGG - Intergenic
1113467079 13:110520208-110520230 GGGAGGGAACCCGTGTGCTGGGG + Intergenic
1113467108 13:110520314-110520336 GGGAGAGAACCCGTGTGCTGGGG + Intergenic
1113467115 13:110520334-110520356 GGGAGGGAACCCGTGTGCTGGGG + Intergenic
1113467139 13:110520406-110520428 GGGAGGGAACCCGTGTGCTGGGG + Intergenic
1113467171 13:110520496-110520518 TGGGGGGCACCCGTGTGCTGGGG + Intergenic
1117615839 14:57532822-57532844 AGGAGTGCACCAGTGTGGAGTGG + Intergenic
1121122371 14:91384007-91384029 CGGGATGCACCAGTGTGCCGTGG - Intronic
1122286543 14:100655790-100655812 GGGAGAGCACCAGAGTGAGGAGG - Intergenic
1122587667 14:102820672-102820694 GTGATTGCACCACTGTGCTCTGG - Intronic
1122645166 14:103189254-103189276 GGGAGGGGACTAGTGTGCAGGGG + Intergenic
1122798305 14:104217358-104217380 GGCACTGCAGCAGTGTGGTGAGG + Intergenic
1122798315 14:104217397-104217419 GGCACTGCAGCAGTGTGGTGAGG + Intergenic
1122798323 14:104217436-104217458 GGCACTGCAGCAGTGTGGTGAGG + Intergenic
1122798343 14:104217514-104217536 GGCACTGCAGCAGTGTGGTGAGG + Intergenic
1122798353 14:104217553-104217575 GGCACTGCAGCAGTGTGGTGAGG + Intergenic
1122798361 14:104217592-104217614 GGCACTGCAGCAGTGTGGTGAGG + Intergenic
1122809372 14:104280453-104280475 GGGAGCGGAGCAGTGGGCTGGGG + Intergenic
1123064023 14:105607084-105607106 GGGAGTGCGTGTGTGTGCTGGGG + Intergenic
1123073337 14:105652727-105652749 GGGAGTGCGTGTGTGTGCTGGGG + Intergenic
1128153197 15:65376503-65376525 GGGAGGGCCCTAGTCTGCTGGGG - Intronic
1128238661 15:66084810-66084832 GGGAGGGCACGAATCTGCTGTGG + Intronic
1128874571 15:71191711-71191733 GAGATTGCAACAGTGGGCTGCGG - Intronic
1130154129 15:81334884-81334906 GGGTGTGCCCGAGTGCGCTGAGG + Exonic
1132243991 15:100280489-100280511 GGGAGGGGAGCAGTGTGCCGAGG - Intronic
1132825681 16:1904108-1904130 GGGAGACCACCAGTGGGATGGGG + Intergenic
1133014031 16:2930681-2930703 GGGAGAGCCCCAGGGTCCTGAGG + Exonic
1133451262 16:5905825-5905847 GGGAGTGTATCACTTTGCTGGGG - Intergenic
1133695950 16:8262702-8262724 GGAAGTCCATCAGTGTGCAGTGG - Intergenic
1134753829 16:16648727-16648749 AGGATTGCACCACTGTGCTCCGG - Intergenic
1134992230 16:18710317-18710339 AGGATTGCACCACTGTGCTCCGG + Intergenic
1135062310 16:19281280-19281302 GGGATTGCACCAGTGGCCTTTGG - Intergenic
1139355028 16:66362484-66362506 GGGTGTGTACCTGTGTTCTGTGG - Intergenic
1139948556 16:70658074-70658096 AGGTGTGCACCAGAGTCCTGAGG - Intronic
1141161732 16:81633601-81633623 GAAAGTGCACCAGGGTGCTCCGG - Intronic
1141706494 16:85668103-85668125 GGGCTTGCATCAGTGTGTTGGGG - Intronic
1141799371 16:86296558-86296580 GGGACTGCATCCGCGTGCTGTGG - Intergenic
1142405351 16:89885585-89885607 GTGAGCACACCAGTGTGATGTGG + Intronic
1142722960 17:1789335-1789357 TGGAGTGCAGCAGTGTGATCTGG - Intronic
1143029355 17:3959353-3959375 GGAAGTGTTCCAGTGTGGTGGGG - Intronic
1145813247 17:27777511-27777533 GGGAGGGGACCTGTGAGCTGTGG - Intronic
1146486633 17:33248471-33248493 GGGAGTGCATTAGTTTCCTGTGG + Intronic
1150809308 17:68344268-68344290 GGGAGTGCAGCAGTGAGGCGTGG - Intronic
1151766968 17:76137733-76137755 GGGTGGGCAGCAGGGTGCTGGGG + Exonic
1151944348 17:77311360-77311382 GGAGGTGCATCAGTGTCCTGTGG - Intronic
1152015791 17:77749497-77749519 GGGAGAGCACCAGTGTGGTAAGG + Intergenic
1152828309 17:82481225-82481247 GGGGGTGCACCTGGGCGCTGGGG + Intronic
1152937930 17:83151497-83151519 TGAAGTTCAACAGTGTGCTGTGG - Intergenic
1155279133 18:24220198-24220220 ACGAGGGCACCACTGTGCTGTGG - Intronic
1156590788 18:38485609-38485631 GGTAGTGCTCCAGTATGCTAAGG + Intergenic
1158561437 18:58517024-58517046 GGCCGTGCATCACTGTGCTGCGG + Exonic
1158670131 18:59467296-59467318 GTGAGTGCCCTACTGTGCTGGGG + Intronic
1159365883 18:67464913-67464935 GGGAGAGCACAATTCTGCTGGGG + Intergenic
1159384549 18:67707030-67707052 GGGAGTGCCCAAGTGTTCGGGGG - Intergenic
1159817328 18:73091707-73091729 GGGAGTGCAAGACTCTGCTGGGG - Intergenic
1160323166 18:77915165-77915187 GGGAGTTCACCACAGTGATGAGG + Intergenic
1160838157 19:1134138-1134160 GTGAGTCCACCCGTGAGCTGTGG - Intronic
1160838180 19:1134272-1134294 GTGAGTCCACCCGTGAGCTGTGG - Intronic
1161237779 19:3206351-3206373 GGTGGTGCTCCAGCGTGCTGAGG - Exonic
1161707087 19:5827284-5827306 GAGGATGCACCAGTGTCCTGGGG + Intronic
1164153996 19:22577886-22577908 GGGAATGCCCCAGTTTGTTGTGG - Intergenic
1164371024 19:27644437-27644459 GGGAATGCCCCAGTTTGTTGTGG + Intergenic
1164888903 19:31806304-31806326 AGGAGTGCCCCAGAATGCTGAGG + Intergenic
1165487084 19:36102648-36102670 GGGAGTGCCCCGCTGGGCTGTGG + Intronic
1165606845 19:37113082-37113104 GGGAATGCCCCAGTTTGTTGCGG + Intronic
1167713694 19:51127297-51127319 GTGAGTGCACCAGTATGCTGGGG + Intronic
925458289 2:4037912-4037934 GGGAGTGCAGCGGAGTGCTTGGG + Intergenic
925681608 2:6428035-6428057 CAGAGTCCACCAGTGGGCTGTGG + Intergenic
926999855 2:18783348-18783370 GGGAAAGCACCAGTGTGGTCAGG - Intergenic
927999077 2:27507342-27507364 GGGAGACCACTAGTGTGCTGAGG + Intronic
929829309 2:45334483-45334505 GGGAGCGCCCCAGGGTGCTTGGG + Intergenic
932575573 2:72960670-72960692 GGGAGTGCAGCAAGGTGATGTGG - Intronic
935087169 2:99859211-99859233 AGTAGTGCACCAGAGTGCTGAGG - Intronic
935661501 2:105470720-105470742 GAGATTGCACCACTGTGCTCCGG - Intergenic
938155377 2:128934142-128934164 GGAATTGAACCAGTGTGTTGAGG - Intergenic
938992856 2:136647281-136647303 GGGAATGCACCACTGGGCAGAGG + Intergenic
941964508 2:171287590-171287612 GGGAAAGCAGAAGTGTGCTGAGG - Intergenic
942353049 2:175074879-175074901 AAGAATGCACCAGTATGCTGAGG + Intronic
942711862 2:178845857-178845879 GGGAGTACACCAGTCTCTTGTGG - Intronic
942828654 2:180211617-180211639 GGAAGTGCAACAGTGTGATCGGG + Intergenic
944246248 2:197533238-197533260 GGGAGTGCTTGAGTGTGTTGGGG + Intronic
946475243 2:220000668-220000690 GGAAGTGCTCCAGTGTCCTGAGG + Intergenic
948742802 2:240058861-240058883 TGGAGTGCATCTGTATGCTGGGG + Intergenic
1169084138 20:2816448-2816470 AGGAGGGCACCAGTGTGCGTGGG - Intronic
1169506900 20:6220874-6220896 GGGTCTGAACCAATGTGCTGTGG + Intergenic
1170051951 20:12155832-12155854 GGGACAGCACCAGTGTGGTCGGG + Intergenic
1170775613 20:19372373-19372395 GTGAGAGCATCAGTGAGCTGTGG - Intronic
1172358581 20:34296600-34296622 GGAAGTGGACCAGTGTGGTAGGG - Intronic
1173149226 20:40551395-40551417 GGCATTGCACCAGAGGGCTGCGG + Intergenic
1173854515 20:46241438-46241460 GGGAGGGCCCCAGCGGGCTGAGG - Intronic
1175885442 20:62287995-62288017 GGGAGGGCATCTGAGTGCTGTGG + Intronic
1178686527 21:34715602-34715624 GGGACTGTACCAGTTTGCTAGGG - Intronic
1179217214 21:39377994-39378016 TGGAGTGCAACAGTGTGATCTGG + Intergenic
1179413480 21:41179568-41179590 GTGAGTGCACATGTGTGGTGAGG + Intronic
1179950842 21:44708107-44708129 GGGAGTGCAAGTGTGCGCTGGGG + Intronic
1180838059 22:18941636-18941658 GGGAATGCCCCAGTTTGTTGTGG - Intergenic
1181535513 22:23540870-23540892 GGGAATGCCCCAGTTTGTTGGGG - Intergenic
1181572155 22:23773432-23773454 GGGAGGGCAGCGCTGTGCTGCGG + Intronic
1182093916 22:27613798-27613820 GGGAGGGGACGAGTGTGCTCAGG - Intergenic
1185116753 22:48942261-48942283 GGGAGTGCTGCAGTGTCCTGAGG - Intergenic
1203309120 22_KI270736v1_random:130281-130303 TGGAGTGCAATAGAGTGCTGTGG + Intergenic
949775512 3:7628272-7628294 GGGAGTGCAGCACTGTCCTCAGG + Intronic
949876325 3:8628229-8628251 GGCAGTGCAGGAGTGAGCTGGGG + Intronic
950030765 3:9851614-9851636 GGGAATGCCCCAGTTTGTTGTGG + Intronic
950485909 3:13273894-13273916 GGGAGCGGACCAGTGTGCATGGG - Intergenic
952623981 3:35381718-35381740 GGAAATGCCCCAGTGTCCTGAGG - Intergenic
953547887 3:43877682-43877704 GGGGCTGAACCAGTGTGCTCTGG - Intergenic
953568313 3:44051795-44051817 GGGAGGGCAGCAGTGGGCAGAGG - Intergenic
953720047 3:45347316-45347338 GGTAGTGAACCAGTGTGGTGAGG + Intergenic
953989201 3:47470892-47470914 GGGAGCCCACTAGTATGCTGGGG - Intronic
954292209 3:49655601-49655623 AGGAGTGCTTCAGTGAGCTGAGG - Exonic
956065302 3:65391253-65391275 CGGGGAGCACCTGTGTGCTGTGG + Exonic
959070194 3:101694856-101694878 GGGAATGCCCCAGTTTGTTGGGG - Intergenic
960028019 3:113030459-113030481 GGGAATGCCCCAGTTTGTTGTGG + Intergenic
961204211 3:125067980-125068002 TGGAGTGCAGCAGTGTGATCTGG + Intergenic
961297032 3:125893256-125893278 GGGAATGCCCCAGTTTGTTGTGG - Intergenic
961548072 3:127649885-127649907 TGGAGTGCAGCAGTGTGATCTGG - Intronic
962929505 3:140023632-140023654 AGAGGTGCCCCAGTGTGCTGGGG - Intronic
963695884 3:148565593-148565615 GGGAATGCCCCAGTTTGTTGTGG + Intergenic
967026452 3:185568744-185568766 GGGAATGCCCCAGTTTGTTGTGG + Intergenic
967703316 3:192620074-192620096 GGGAGTGAACCTGTGTTGTGGGG - Intronic
968069967 3:195778699-195778721 GCGAATGCACCAGTGTTCTCAGG + Intronic
970323392 4:14897841-14897863 GGAAGTGCACTAGTTTGCTAGGG + Intergenic
971463717 4:26931147-26931169 GAGAGTGAAACAGTGGGCTGAGG - Intronic
972578140 4:40370840-40370862 GGGAGTGCAGCAATGTGATAAGG - Intergenic
976605864 4:86982287-86982309 GGGAGTACAACAGTTTGCTAAGG + Intronic
981490693 4:145336435-145336457 GGGGGTCCACCAGTTGGCTGGGG - Intergenic
982035376 4:151341074-151341096 GGGAGGGGACCAGTGGGCAGTGG - Intergenic
982260202 4:153488222-153488244 GTGAGTGCACCAGTGTGAGTGGG + Intronic
983354461 4:166637963-166637985 GGCAGTGCCCCACTGAGCTGTGG - Intergenic
985564912 5:610799-610821 GTGTGTGCAACAGTGTGCAGGGG - Intergenic
985891953 5:2723077-2723099 GGGGATGCACCTGTGTGTTGTGG - Intergenic
988380591 5:30493128-30493150 GGGAATGCCCCAGTTTGTTGTGG + Intergenic
988857671 5:35245066-35245088 GGGAGTGTACCAGAATGCTGAGG + Intergenic
993900160 5:93579593-93579615 GGGACTGCACCCGGGGGCTGGGG - Intergenic
995096255 5:108239376-108239398 GGGAGTGAATCTGTGTGCTTTGG + Intronic
995500971 5:112806624-112806646 GAGATTGCACCACTGTGCAGTGG - Intronic
998852393 5:146363680-146363702 GGGAGTGCAGCTGGGTGCGGTGG + Intergenic
999952284 5:156663901-156663923 GGGAATGCCCCAGTTTGTTGTGG + Intronic
1000041308 5:157487144-157487166 GAGAGTGTACTCGTGTGCTGAGG - Intronic
1001502572 5:172249575-172249597 GGGTGTGCACCACTGTGCATGGG - Intronic
1003276846 6:4660853-4660875 GGGAGGGCACAAGAGGGCTGAGG + Intergenic
1005685912 6:28252776-28252798 GGGAGTGGGACAGTGTGTTGAGG - Intergenic
1005969485 6:30749955-30749977 GGGACTGCACCAGGGTCCTGGGG + Intergenic
1007715030 6:43850954-43850976 GGGGGTCCAGCAGTGGGCTGAGG - Intergenic
1007767005 6:44166609-44166631 GGGAGGGCAGCAGGGTTCTGGGG - Intronic
1010318808 6:74482941-74482963 GGGAGTGCATGCGTGTGTTGCGG - Intergenic
1010592071 6:77723390-77723412 GGGAATGCCCCAGTTTGTTGTGG + Intronic
1013139450 6:107317402-107317424 GGGAGAGCCCCAGAGTGATGAGG + Intronic
1016748696 6:147609469-147609491 GGGAGTGCAGTAGTTTTCTGGGG - Intronic
1018468935 6:164079704-164079726 GTGGCTGCACCAGTTTGCTGTGG + Intergenic
1018632704 6:165834641-165834663 GGGAGGGATCCATTGTGCTGAGG - Intronic
1019278632 7:188912-188934 GGGAGAGCAGCTGTGTGGTGAGG - Intergenic
1019976746 7:4588913-4588935 GGGAATGCCCCAGTTTGTTGTGG + Intergenic
1019977682 7:4597416-4597438 GGGAATGCCCCAGTTTGTTGTGG + Intergenic
1021088457 7:16451977-16451999 GGGAGAGAAGCAGTGAGCTGTGG - Intergenic
1022230898 7:28410862-28410884 GCGATTGCACGAGTGTGTTGTGG - Intronic
1024076401 7:45820681-45820703 TGGAGTGCACCGGTGTGATCTGG - Intergenic
1026920433 7:74151549-74151571 TGGAGTGCAGCAGTGTGATCAGG + Intergenic
1029260371 7:99298279-99298301 GGGATTGCACCACTATACTGTGG - Intergenic
1029967033 7:104750804-104750826 GGGAATGCCCCAGTTTGTTGTGG + Intronic
1032810667 7:135412802-135412824 GGAAGTGCAGCATTGTGCTTTGG + Intronic
1035813400 8:2512795-2512817 GGGTGTACACCTGTGTGATGGGG + Intergenic
1036201532 8:6774715-6774737 GCGTGTGCACCTGTGTGCTGAGG - Intergenic
1036292288 8:7504361-7504383 GGGAATGCCCCAGTTTGTTGTGG + Intronic
1036454723 8:8896552-8896574 TGGAGTGAATAAGTGTGCTGGGG + Intergenic
1037719011 8:21426766-21426788 TGGAGTGCAGCAGTGTGATTTGG + Intergenic
1037879107 8:22564522-22564544 GTGAGTGCTGCAGGGTGCTGGGG + Intronic
1038215640 8:25559474-25559496 GAGACTGAACCAGTGTGCTTGGG - Intergenic
1039327782 8:36503918-36503940 GGGAGTACAACAGGGTGTTGTGG - Intergenic
1039578166 8:38642307-38642329 GGAGGGGCACTAGTGTGCTGGGG + Intergenic
1045035457 8:98173281-98173303 GGGAGTGCTGCAGGGTGCAGCGG + Intergenic
1048357643 8:133666740-133666762 GGGAGAGTGCCAGGGTGCTGGGG - Intergenic
1048829396 8:138461256-138461278 GGAAGTGGACCAGGGTGCTGGGG + Intronic
1049727044 8:144151873-144151895 GGCAGTGCAGCACGGTGCTGCGG - Intronic
1052476735 9:28970551-28970573 GAGAGTGTTTCAGTGTGCTGAGG + Intergenic
1060413339 9:123414072-123414094 GGCAGTGCACCAGAGCGCTCGGG + Intronic
1062434112 9:136538940-136538962 GGGACTGCACCCTTTTGCTGTGG - Intronic
1062591017 9:137274744-137274766 GGGAGAGCAGCCGTGTGCTCTGG + Intergenic
1062698975 9:137889457-137889479 GGGAGAGCCCCCGTGTTCTGGGG + Intronic
1203414489 Un_KI270589v1:42956-42978 TGGAGTGCATCAGAGTGCAGTGG - Intergenic
1190874315 X:54449032-54449054 GGGAGGCCACAAGTCTGCTGTGG - Intronic
1193836177 X:86347370-86347392 GCAAGTGCACCCATGTGCTGAGG - Intronic
1194233226 X:91349401-91349423 GGGAGAGCACCAGAGTGCAGTGG - Intergenic
1194253954 X:91613560-91613582 GGCAGTGCCCCAGTGTGTGGGGG + Intergenic
1196411551 X:115425180-115425202 CGGAGTGCTCCAGGGTGATGTGG + Intergenic
1197093800 X:122571165-122571187 TGGAGTGCACCAGTCTTCTCTGG - Intergenic
1197630444 X:128852369-128852391 GGGAGTGCCCCAGAATTCTGAGG - Intergenic
1197904072 X:131405183-131405205 GGGAGTGGACCAGGGTGGGGTGG + Intergenic
1198951576 X:142078156-142078178 GGGAGGGCAGCAGTGTATTGGGG + Intergenic
1199319664 X:146423191-146423213 GGGAGGGCAGCAGTGTATTGGGG + Intergenic
1200942976 Y:8804612-8804634 GAGAGAGCACCAATGTACTGGGG + Intergenic
1201102290 Y:10687037-10687059 TGGAGTGCATCAGAGTGCAGTGG - Intergenic
1201112573 Y:10811074-10811096 TGGAGTGCACCAGAGTGCAATGG - Intergenic
1201115059 Y:10829087-10829109 TGGAGTGGACCAGAGTGCAGAGG - Intergenic