ID: 1077545889

View in Genome Browser
Species Human (GRCh38)
Location 11:3169637-3169659
Sequence ACCCCTGTGGGATCCAGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077545889_1077545900 -2 Left 1077545889 11:3169637-3169659 CCGCTCCTGGATCCCACAGGGGT No data
Right 1077545900 11:3169658-3169680 GTGCAGGGGCTGGGGGCCTGAGG No data
1077545889_1077545898 -10 Left 1077545889 11:3169637-3169659 CCGCTCCTGGATCCCACAGGGGT No data
Right 1077545898 11:3169650-3169672 CCACAGGGGTGCAGGGGCTGGGG No data
1077545889_1077545906 18 Left 1077545889 11:3169637-3169659 CCGCTCCTGGATCCCACAGGGGT No data
Right 1077545906 11:3169678-3169700 AGGAGGAGCAGGGACGTACTGGG No data
1077545889_1077545905 17 Left 1077545889 11:3169637-3169659 CCGCTCCTGGATCCCACAGGGGT No data
Right 1077545905 11:3169677-3169699 GAGGAGGAGCAGGGACGTACTGG No data
1077545889_1077545903 8 Left 1077545889 11:3169637-3169659 CCGCTCCTGGATCCCACAGGGGT No data
Right 1077545903 11:3169668-3169690 TGGGGGCCTGAGGAGGAGCAGGG No data
1077545889_1077545901 1 Left 1077545889 11:3169637-3169659 CCGCTCCTGGATCCCACAGGGGT No data
Right 1077545901 11:3169661-3169683 CAGGGGCTGGGGGCCTGAGGAGG No data
1077545889_1077545899 -9 Left 1077545889 11:3169637-3169659 CCGCTCCTGGATCCCACAGGGGT No data
Right 1077545899 11:3169651-3169673 CACAGGGGTGCAGGGGCTGGGGG No data
1077545889_1077545902 7 Left 1077545889 11:3169637-3169659 CCGCTCCTGGATCCCACAGGGGT No data
Right 1077545902 11:3169667-3169689 CTGGGGGCCTGAGGAGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077545889 Original CRISPR ACCCCTGTGGGATCCAGGAG CGG (reversed) Intergenic
No off target data available for this crispr