ID: 1077549232

View in Genome Browser
Species Human (GRCh38)
Location 11:3192693-3192715
Sequence CCTCCCTGAAGCCTCGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077549219_1077549232 18 Left 1077549219 11:3192652-3192674 CCTCCTGGAAGCCCTCCCAGATC No data
Right 1077549232 11:3192693-3192715 CCTCCCTGAAGCCTCGGGGTGGG No data
1077549218_1077549232 21 Left 1077549218 11:3192649-3192671 CCTCCTCCTGGAAGCCCTCCCAG No data
Right 1077549232 11:3192693-3192715 CCTCCCTGAAGCCTCGGGGTGGG No data
1077549220_1077549232 15 Left 1077549220 11:3192655-3192677 CCTGGAAGCCCTCCCAGATCTCC No data
Right 1077549232 11:3192693-3192715 CCTCCCTGAAGCCTCGGGGTGGG No data
1077549224_1077549232 2 Left 1077549224 11:3192668-3192690 CCAGATCTCCTCCTAGTTCAGCT No data
Right 1077549232 11:3192693-3192715 CCTCCCTGAAGCCTCGGGGTGGG No data
1077549225_1077549232 -6 Left 1077549225 11:3192676-3192698 CCTCCTAGTTCAGCTCACCTCCC No data
Right 1077549232 11:3192693-3192715 CCTCCCTGAAGCCTCGGGGTGGG No data
1077549217_1077549232 26 Left 1077549217 11:3192644-3192666 CCTCACCTCCTCCTGGAAGCCCT No data
Right 1077549232 11:3192693-3192715 CCTCCCTGAAGCCTCGGGGTGGG No data
1077549226_1077549232 -9 Left 1077549226 11:3192679-3192701 CCTAGTTCAGCTCACCTCCCTGA No data
Right 1077549232 11:3192693-3192715 CCTCCCTGAAGCCTCGGGGTGGG No data
1077549223_1077549232 3 Left 1077549223 11:3192667-3192689 CCCAGATCTCCTCCTAGTTCAGC No data
Right 1077549232 11:3192693-3192715 CCTCCCTGAAGCCTCGGGGTGGG No data
1077549221_1077549232 7 Left 1077549221 11:3192663-3192685 CCCTCCCAGATCTCCTCCTAGTT No data
Right 1077549232 11:3192693-3192715 CCTCCCTGAAGCCTCGGGGTGGG No data
1077549222_1077549232 6 Left 1077549222 11:3192664-3192686 CCTCCCAGATCTCCTCCTAGTTC No data
Right 1077549232 11:3192693-3192715 CCTCCCTGAAGCCTCGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077549232 Original CRISPR CCTCCCTGAAGCCTCGGGGT GGG Intergenic