ID: 1077558865

View in Genome Browser
Species Human (GRCh38)
Location 11:3243268-3243290
Sequence CTAGTTTAGAGGCTATTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077558865_1077558869 -1 Left 1077558865 11:3243268-3243290 CCCTTAAATAGCCTCTAAACTAG No data
Right 1077558869 11:3243290-3243312 GGAAAAATTACATTTTCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077558865 Original CRISPR CTAGTTTAGAGGCTATTTAA GGG (reversed) Intergenic
No off target data available for this crispr