ID: 1077561371

View in Genome Browser
Species Human (GRCh38)
Location 11:3263735-3263757
Sequence GCTCTGCCTCTCCATCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077561371_1077561372 -7 Left 1077561371 11:3263735-3263757 CCAAGCTGATGGAGAGGCAGAGC No data
Right 1077561372 11:3263751-3263773 GCAGAGCCTCAGTCCATCTCAGG No data
1077561371_1077561373 -6 Left 1077561371 11:3263735-3263757 CCAAGCTGATGGAGAGGCAGAGC No data
Right 1077561373 11:3263752-3263774 CAGAGCCTCAGTCCATCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077561371 Original CRISPR GCTCTGCCTCTCCATCAGCT TGG (reversed) Intergenic