ID: 1077561373

View in Genome Browser
Species Human (GRCh38)
Location 11:3263752-3263774
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077561370_1077561373 -5 Left 1077561370 11:3263734-3263756 CCCAAGCTGATGGAGAGGCAGAG No data
Right 1077561373 11:3263752-3263774 CAGAGCCTCAGTCCATCTCAGGG No data
1077561366_1077561373 26 Left 1077561366 11:3263703-3263725 CCACATGGGGTCTGCAAAGGGAA No data
Right 1077561373 11:3263752-3263774 CAGAGCCTCAGTCCATCTCAGGG No data
1077561368_1077561373 0 Left 1077561368 11:3263729-3263751 CCAAGCCCAAGCTGATGGAGAGG No data
Right 1077561373 11:3263752-3263774 CAGAGCCTCAGTCCATCTCAGGG No data
1077561371_1077561373 -6 Left 1077561371 11:3263735-3263757 CCAAGCTGATGGAGAGGCAGAGC No data
Right 1077561373 11:3263752-3263774 CAGAGCCTCAGTCCATCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077561373 Original CRISPR CAGAGCCTCAGTCCATCTCA GGG Intergenic