ID: 1077562435

View in Genome Browser
Species Human (GRCh38)
Location 11:3272282-3272304
Sequence CAGGAGGAGAGGAGGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077562435_1077562448 28 Left 1077562435 11:3272282-3272304 CCCACCTCCCTCCTCTCCTCCTG No data
Right 1077562448 11:3272333-3272355 TTCTGTGCTACCCAGAGAGCGGG No data
1077562435_1077562447 27 Left 1077562435 11:3272282-3272304 CCCACCTCCCTCCTCTCCTCCTG No data
Right 1077562447 11:3272332-3272354 CTTCTGTGCTACCCAGAGAGCGG No data
1077562435_1077562449 29 Left 1077562435 11:3272282-3272304 CCCACCTCCCTCCTCTCCTCCTG No data
Right 1077562449 11:3272334-3272356 TCTGTGCTACCCAGAGAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077562435 Original CRISPR CAGGAGGAGAGGAGGGAGGT GGG (reversed) Intergenic
No off target data available for this crispr