ID: 1077567267

View in Genome Browser
Species Human (GRCh38)
Location 11:3309564-3309586
Sequence GCTCTGCCTCTCCATCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077567267_1077567268 -7 Left 1077567267 11:3309564-3309586 CCAAGCTGATGGAGAGGCAGAGC No data
Right 1077567268 11:3309580-3309602 GCAGAGCCTCAGTCCATCTCAGG No data
1077567267_1077567269 -6 Left 1077567267 11:3309564-3309586 CCAAGCTGATGGAGAGGCAGAGC No data
Right 1077567269 11:3309581-3309603 CAGAGCCTCAGTCCATCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077567267 Original CRISPR GCTCTGCCTCTCCATCAGCT TGG (reversed) Intergenic
No off target data available for this crispr