ID: 1077567268

View in Genome Browser
Species Human (GRCh38)
Location 11:3309580-3309602
Sequence GCAGAGCCTCAGTCCATCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077567259_1077567268 30 Left 1077567259 11:3309527-3309549 CCTGTCCACATGGGGTCTGCAAA No data
Right 1077567268 11:3309580-3309602 GCAGAGCCTCAGTCCATCTCAGG No data
1077567262_1077567268 25 Left 1077567262 11:3309532-3309554 CCACATGGGGTCTGCAAAGGGAA No data
Right 1077567268 11:3309580-3309602 GCAGAGCCTCAGTCCATCTCAGG No data
1077567266_1077567268 -6 Left 1077567266 11:3309563-3309585 CCCAAGCTGATGGAGAGGCAGAG No data
Right 1077567268 11:3309580-3309602 GCAGAGCCTCAGTCCATCTCAGG No data
1077567267_1077567268 -7 Left 1077567267 11:3309564-3309586 CCAAGCTGATGGAGAGGCAGAGC No data
Right 1077567268 11:3309580-3309602 GCAGAGCCTCAGTCCATCTCAGG No data
1077567264_1077567268 -1 Left 1077567264 11:3309558-3309580 CCAAGCCCAAGCTGATGGAGAGG No data
Right 1077567268 11:3309580-3309602 GCAGAGCCTCAGTCCATCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077567268 Original CRISPR GCAGAGCCTCAGTCCATCTC AGG Intergenic