ID: 1077567269

View in Genome Browser
Species Human (GRCh38)
Location 11:3309581-3309603
Sequence CAGAGCCTCAGTCCATCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077567267_1077567269 -6 Left 1077567267 11:3309564-3309586 CCAAGCTGATGGAGAGGCAGAGC No data
Right 1077567269 11:3309581-3309603 CAGAGCCTCAGTCCATCTCAGGG No data
1077567266_1077567269 -5 Left 1077567266 11:3309563-3309585 CCCAAGCTGATGGAGAGGCAGAG No data
Right 1077567269 11:3309581-3309603 CAGAGCCTCAGTCCATCTCAGGG No data
1077567264_1077567269 0 Left 1077567264 11:3309558-3309580 CCAAGCCCAAGCTGATGGAGAGG No data
Right 1077567269 11:3309581-3309603 CAGAGCCTCAGTCCATCTCAGGG No data
1077567262_1077567269 26 Left 1077567262 11:3309532-3309554 CCACATGGGGTCTGCAAAGGGAA No data
Right 1077567269 11:3309581-3309603 CAGAGCCTCAGTCCATCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077567269 Original CRISPR CAGAGCCTCAGTCCATCTCA GGG Intergenic