ID: 1077568329

View in Genome Browser
Species Human (GRCh38)
Location 11:3318102-3318124
Sequence CAGGAGGAGAGGAGGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077568329_1077568341 27 Left 1077568329 11:3318102-3318124 CCCACCTCCCTCCTCTCCTCCTG No data
Right 1077568341 11:3318152-3318174 CTTCTGTGCTACCCAGAGAGCGG No data
1077568329_1077568342 28 Left 1077568329 11:3318102-3318124 CCCACCTCCCTCCTCTCCTCCTG No data
Right 1077568342 11:3318153-3318175 TTCTGTGCTACCCAGAGAGCGGG No data
1077568329_1077568343 29 Left 1077568329 11:3318102-3318124 CCCACCTCCCTCCTCTCCTCCTG No data
Right 1077568343 11:3318154-3318176 TCTGTGCTACCCAGAGAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077568329 Original CRISPR CAGGAGGAGAGGAGGGAGGT GGG (reversed) Intergenic
No off target data available for this crispr