ID: 1077574084

View in Genome Browser
Species Human (GRCh38)
Location 11:3366510-3366532
Sequence TTTGATTTAAAAATAGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 958
Summary {0: 1, 1: 0, 2: 5, 3: 104, 4: 848}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077574084 Original CRISPR TTTGATTTAAAAATAGATGA AGG Intronic
904019242 1:27449747-27449769 TTTGTTTTAGAAATAGATTCTGG + Intronic
904518603 1:31076628-31076650 TCTAATTTAAAAATATATGTAGG + Intergenic
904877386 1:33666700-33666722 TTTGATTTGAAAAGAGGAGAAGG + Intronic
905160959 1:36033468-36033490 TTTTATTTAAGTAGAGATGAGGG - Intronic
905932275 1:41797501-41797523 TCTTATTTAAAAAAAAATGATGG + Intronic
907217209 1:52874550-52874572 TTTAATTTAAAAATATTTTATGG - Intronic
908069853 1:60447987-60448009 TTTGCTTTAAAAATACTTGTTGG - Intergenic
908135094 1:61123783-61123805 TTTGTTTAAAACAAAGATGATGG - Intronic
908278215 1:62499353-62499375 TTTCATGTAAAAATAAAAGATGG + Intronic
908704166 1:66932128-66932150 TTTGTTTTAAAAATTAAAGATGG + Intronic
908735312 1:67270365-67270387 CTTGAGTTCAAAATAGATGTTGG - Intergenic
909247483 1:73305621-73305643 TTGGATTTAAATATAAAAGAAGG + Intergenic
909911965 1:81271580-81271602 TTTGAATTAAAAAATAATGATGG - Intergenic
910326200 1:86010800-86010822 TTTTATTTAAAAATATATCCTGG - Intronic
910335289 1:86121612-86121634 TATAATTTAAAAATCAATGAAGG + Intronic
910364121 1:86445767-86445789 TTTAATTTATAAAAAAATGAGGG + Intronic
910553392 1:88501964-88501986 TTTGTTTTAAATATTGATGTTGG + Intergenic
910853837 1:91674109-91674131 CTTGACTTAAAAAGAAATGAGGG - Intergenic
911033853 1:93517644-93517666 TTTGTTTTAAAAATAGGTAGTGG + Intronic
911381065 1:97115486-97115508 TTTCACTTAAAAATATATTATGG - Intronic
911578920 1:99612761-99612783 TTTAATTAAAAAATAGACAATGG + Intergenic
911793669 1:102050503-102050525 TTTTACTTAAAAATAGTTGGTGG - Intergenic
911862014 1:102963470-102963492 TTTCATGTATAAATAGAGGATGG + Intronic
911987250 1:104642922-104642944 TTAGATTTAAAAAGTGAAGAAGG + Intergenic
913378264 1:118179761-118179783 TCTGATTTAAAAATAGGCAAAGG + Intronic
914700731 1:150130495-150130517 TTTTATTTAAAAATATATGTGGG - Intronic
915012109 1:152697432-152697454 TTTTATTTAAAAATATAGGTAGG - Intergenic
915024390 1:152813602-152813624 TTTGAATTAAAAACTTATGAAGG + Intergenic
915494074 1:156268708-156268730 CTATGTTTAAAAATAGATGAAGG - Intronic
916337142 1:163685694-163685716 AATGACTTAAAAATAGGTGATGG - Intergenic
916369896 1:164080415-164080437 CATGATTAAAAAATCGATGATGG + Intergenic
916599634 1:166279575-166279597 CTTGATTTAAAAATAGGCAAAGG - Intergenic
917350156 1:174069088-174069110 TTTGACTTAAAACTATATTATGG + Intergenic
918116404 1:181501908-181501930 TTTGTTTTAAAAAAAGAAAAGGG + Intronic
918149526 1:181786039-181786061 TTTGAATGAACAATAGAAGAAGG + Intronic
918355315 1:183702389-183702411 CTTCATTTTAAAATAGAAGAAGG - Intronic
918799095 1:188948599-188948621 ATTAACTTAAAAATGGATGATGG - Intergenic
919034446 1:192288649-192288671 TCTGATTTAAAAATGGGTAAAGG + Intergenic
919108042 1:193178982-193179004 CTTGATTTTAAAATTCATGATGG + Intronic
919364517 1:196640313-196640335 GTTGATTTAAAAATTAATTAGGG + Intergenic
919411819 1:197254674-197254696 TTTCATTTAAAGACAGATAAAGG - Intergenic
919466849 1:197930768-197930790 TATTTTTTAAAAAAAGATGATGG + Exonic
921230835 1:213068712-213068734 TTTGATTTAAATTTAAATTAAGG + Intronic
922656872 1:227392821-227392843 TTTGCTTTAAAAATAAATATCGG + Intergenic
923006810 1:230056804-230056826 TCTAATTTAAGAATAAATGAAGG - Intergenic
923376173 1:233365444-233365466 TTTGATTTAAAATTGGACAAAGG + Intronic
923489269 1:234468928-234468950 TTTGATTGTAAGATATATGAGGG - Intronic
923574632 1:235146919-235146941 TTTAATTTAAAATTTAATGATGG - Intronic
923598368 1:235378885-235378907 TTTTATTTAGACAAAGATGAAGG + Intronic
923693373 1:236220015-236220037 TTTTTTTTTAAAAGAGATGAGGG - Intronic
923879783 1:238091160-238091182 TTTAAGATAGAAATAGATGATGG + Intergenic
924561360 1:245158277-245158299 TCTCATTTAAAAAAAGAGGAGGG + Intronic
924575030 1:245272393-245272415 TTTGTTTTTTAAAGAGATGAAGG - Intronic
924643305 1:245854127-245854149 TTTGATGAAAGAAGAGATGAAGG + Intronic
924664536 1:246057449-246057471 TTTGCATTAAAAATGTATGATGG + Intronic
924761916 1:246995527-246995549 TCTGATTTTAAAATACATTATGG + Intronic
924785611 1:247195497-247195519 TTTGTTTTAATAATAGAGGCAGG - Intergenic
924785653 1:247196119-247196141 TTTGATTTAAAAACAGACAAAGG + Intergenic
1063261687 10:4396379-4396401 TTAAATTTAATAATACATGATGG + Intergenic
1063401257 10:5748282-5748304 GGTGATTTGAAAACAGATGAAGG + Exonic
1063413991 10:5858288-5858310 TGTGATTTAATATTAGATGGAGG - Intergenic
1064296697 10:14085108-14085130 CTTGATTTATAAACAGATGGAGG - Intronic
1064334013 10:14422253-14422275 TTTGCTCTCAAAATAGATGCTGG - Intronic
1064361757 10:14671905-14671927 TTTGATTTAAAAAGAAATAGAGG - Intronic
1064669120 10:17690808-17690830 TTTGATGTAAAGATAGAAGTAGG + Intronic
1065067213 10:21982246-21982268 ATTGACTTAAAAATAGATCAAGG + Intronic
1065300071 10:24313080-24313102 TTTTATTTAATAAGACATGAAGG + Intronic
1065359642 10:24877491-24877513 TTTGCTTTAAAAATACACAAAGG - Intronic
1065463946 10:25999563-25999585 TTTGATTTAAAAATAAAATGAGG - Intronic
1065635765 10:27731673-27731695 TTTTATTTAAAAATAGAATTTGG + Intronic
1065664898 10:28048460-28048482 TTGGATTTACAAATTTATGATGG - Intergenic
1065666873 10:28072470-28072492 TTTGATGTCAAAATGGCTGATGG - Intronic
1065671991 10:28129340-28129362 TTTGTTTTAAAAACAGAGTATGG + Intronic
1066172539 10:32866415-32866437 ATCAATTTAAAAATAGTTGAGGG + Intronic
1068134482 10:52938317-52938339 TTTCATTGAAAAATAGTTGCAGG - Intergenic
1068183901 10:53560370-53560392 AATGAATTAAAAATATATGATGG + Intergenic
1068192969 10:53677284-53677306 TTTTATTTAAAAATATTTTAAGG + Intergenic
1068216340 10:53987517-53987539 TTTTATTTAAAAATAATTTATGG - Intronic
1068501853 10:57849276-57849298 TTTTATTTAAAAATATTTGTAGG - Intergenic
1068706352 10:60080300-60080322 TCTAATTTAAAAATAGTTAATGG + Intronic
1069252474 10:66286988-66287010 TCTGATTTCAAATTACATGAAGG - Intronic
1069557882 10:69409213-69409235 TTTGATTTAAACAAAAATAAAGG + Intronic
1069825382 10:71252080-71252102 TGTGCTTTAAAAATGGGTGAAGG + Intronic
1070172234 10:73941416-73941438 TTTGAGATAAAAATAGCTTATGG + Intergenic
1070450168 10:76550170-76550192 TTGTATTTAAAAATTGATTAAGG + Intronic
1070471663 10:76786428-76786450 TTTGTTTTAAAGATCAATGAAGG - Intergenic
1070597927 10:77845718-77845740 TCTGCTTTAAAAATAAATAAAGG - Intronic
1070907710 10:80088629-80088651 TTTTTTTTAAAAAAAGATGGAGG + Intronic
1071379684 10:85045731-85045753 TTTAATTTAAGAAGAAATGATGG - Intergenic
1071547738 10:86541054-86541076 TTTAATTTAAAAACTGTTGAAGG - Intergenic
1071578955 10:86753005-86753027 TATGATTGAAAGATAGATGATGG - Intergenic
1071749889 10:88462940-88462962 CTTTATTTAAAAGTACATGATGG + Intronic
1072241504 10:93499423-93499445 TTTGGTTTAAAAAACAATGAAGG - Intronic
1072409613 10:95188058-95188080 TTTGATTTAAAAAGACATGTAGG - Intergenic
1072716984 10:97758964-97758986 TTTTATTTAAAAATTTTTGAAGG + Intronic
1072793399 10:98335885-98335907 TTTGGTATAAAAATAGATCCAGG - Intergenic
1072889600 10:99310918-99310940 TCTGTTTTTAAAATGGATGATGG - Intergenic
1073662343 10:105490446-105490468 TTTGGTTTGAAAGGAGATGAAGG + Intergenic
1073748640 10:106498852-106498874 TTTGATTTAAAAAAAAAAAATGG + Intergenic
1073856179 10:107675934-107675956 TTTCATTTAAAAATAAATTTTGG - Intergenic
1074142543 10:110686727-110686749 TTTACTGTAAAAATAAATGATGG - Intronic
1074328140 10:112473408-112473430 TTTTATTTAAAAAAAAATGTGGG - Intronic
1074352419 10:112750724-112750746 TTTCATTAAAAAATAAATGAGGG - Intronic
1074502383 10:114038181-114038203 TTTTTTTTAAAAAAAGAAGAGGG + Intergenic
1074620861 10:115119306-115119328 TTTTATCTAAAAGTAGATAATGG + Intronic
1075286386 10:121190516-121190538 TTTTAAGTAAAAATAGATGGTGG - Intergenic
1075478157 10:122754574-122754596 TCTGATTTTAAAACAAATGAAGG + Intergenic
1075838367 10:125475556-125475578 ATTTCTTTAAAAACAGATGAAGG + Intergenic
1076378375 10:130008164-130008186 TTTAATATCAAGATAGATGAGGG + Intergenic
1076929657 10:133522335-133522357 TTTAAATTAAAAATAATTGATGG + Intronic
1077400138 11:2351401-2351423 TTTGATTTTAAAGTTGATGCTGG - Intergenic
1077574084 11:3366510-3366532 TTTGATTTAAAAATAGATGAAGG + Intronic
1077828158 11:5832787-5832809 TTTGATTTACAAATCCATGGTGG - Intronic
1077828372 11:5835556-5835578 TATAATTTAAAAAAAGATGGGGG - Intronic
1077874246 11:6290332-6290354 TTTGTTTTAAAGAGAGAGGAAGG + Intergenic
1077925342 11:6676708-6676730 TCTGATTTGAAAATAGGTAAAGG + Intergenic
1078901669 11:15648389-15648411 GCTGATTTAAAAATAAAAGATGG - Intergenic
1079060375 11:17243524-17243546 ATTGAGTTAAAAAAAAATGAGGG + Intronic
1079165560 11:18038790-18038812 TTAAATTTAAAAAAAGCTGATGG + Intronic
1079509111 11:21190050-21190072 TTAGATTTAAGAAAAGATGCAGG + Intronic
1079706568 11:23627982-23628004 TTAGATTTAAAAATATTTCATGG - Intergenic
1079790432 11:24731190-24731212 TTAGATTAAAAAATGTATGAAGG + Intronic
1080013995 11:27485993-27486015 TTTGAATTAAAAAGAAAAGATGG + Intergenic
1080239622 11:30111734-30111756 TTTGATTTAAAAATATATAAAGG + Intergenic
1081158473 11:39724251-39724273 TTTGATTAAAAAATAGGTGGAGG - Intergenic
1081292341 11:41342399-41342421 TTTGATTTAACTTTAGTTGAGGG - Intronic
1081425719 11:42924555-42924577 TTGAATGTAAACATAGATGAAGG - Intergenic
1081856086 11:46304857-46304879 ATTGCTTTAAAAATAGACGTGGG - Intronic
1082141870 11:48618291-48618313 TTTGATATAAAATGAAATGATGG - Intergenic
1082569023 11:54715101-54715123 TTTGATATAAAATGAAATGATGG - Intergenic
1082769852 11:57199245-57199267 TTTGATGAATAAATAGATAAGGG + Intergenic
1083028021 11:59566671-59566693 TTTCATTTAAAAACATATTATGG + Intergenic
1084781633 11:71413559-71413581 TTTAATTTAAAAATAAATTCTGG - Intergenic
1084862264 11:72027155-72027177 TTTGACTTCAAAATAGATCAAGG - Intronic
1085919039 11:80929497-80929519 TAGAATTTAAAAATAGATCAGGG - Intergenic
1086245293 11:84744583-84744605 TTCAATTTTAAAATAGATTAAGG - Intronic
1086302147 11:85438406-85438428 TTTAATTTTAAAATATATCAGGG - Intronic
1087549079 11:99623812-99623834 TTTGATTTATAAATTGATATTGG + Intronic
1087896352 11:103590666-103590688 TTTGATGTAAAAATGGATCCAGG + Intergenic
1088192411 11:107240579-107240601 TTTGATATGAAAGTAGATGTAGG - Intergenic
1088497264 11:110443344-110443366 TTTGGTATAAAAAAAGATGATGG + Intronic
1088586187 11:111361944-111361966 TGTCATTTAGAAATAGCTGAAGG - Intronic
1091075603 11:132613030-132613052 TGTGATTTAAAATTAGATAGGGG + Intronic
1091248563 11:134121688-134121710 TTTAATTTAAAAGAAAATGAGGG + Intronic
1091969935 12:4778722-4778744 TTTTATTAAAAAATACCTGAAGG - Intronic
1092460018 12:8678185-8678207 TTTAATTTAAAAATAGAGACAGG + Intergenic
1093535944 12:20223311-20223333 ATTGATTAAAAAATTGAAGAGGG + Intergenic
1093563341 12:20570560-20570582 ATTGATTTAAAAATAAAATAAGG + Intronic
1093817266 12:23564588-23564610 TTTGTTCTAAAAATGGATTAGGG - Intronic
1093900838 12:24630246-24630268 TTTTATATAAAATTAGAAGAGGG - Intergenic
1093946300 12:25113598-25113620 TTGCTTTTAAAACTAGATGAGGG - Intronic
1094247830 12:28321997-28322019 TTTAATTTATAAATATATGGAGG + Intronic
1094456185 12:30636468-30636490 TGTGATTTAAATATAAATTAAGG - Intronic
1095251823 12:39988464-39988486 TTATATTTAAAAAAAGAGGAAGG + Intronic
1095818111 12:46447232-46447254 TTTGATTTAACACTTTATGATGG + Intergenic
1096441423 12:51646781-51646803 TTTGAAGAAAAAATAGGTGATGG + Intronic
1097421014 12:59379317-59379339 TTTGGTTTAATATTAAATGAGGG + Intergenic
1097567109 12:61284817-61284839 TTTAATTTAAAAATTGTTGCAGG - Intergenic
1098081416 12:66789570-66789592 TTTGCTGTACAAATAGATAATGG + Intronic
1098142110 12:67460486-67460508 TTGGATTTAGAAATAAAGGACGG + Intergenic
1098209972 12:68153135-68153157 TTTGATGTATAAACAGATGAAGG - Intergenic
1098560979 12:71872188-71872210 TTTTATTTAATAATAGTTTATGG + Intronic
1098570663 12:71984049-71984071 TTTGATTTGAAAAGTGATGCCGG - Intronic
1098985870 12:77011410-77011432 TGTAATTTAAAAATAGCTGATGG - Intergenic
1099679621 12:85808795-85808817 TTTTATTTTAAAATAAATAATGG + Intronic
1099698555 12:86054675-86054697 TTTAATTGATAAATAAATGATGG - Intronic
1099868249 12:88312272-88312294 TTAAATTAATAAATAGATGAAGG - Intergenic
1100104871 12:91157926-91157948 TTTGCTTTAAAAATATGTTATGG - Intronic
1100225574 12:92552547-92552569 GTTGGTTTAGAAATAGATGGTGG - Intergenic
1100239299 12:92694782-92694804 TTTCATTTAACAATATATCATGG - Intergenic
1101166565 12:102041413-102041435 ATTGATTTGAGAATAAATGAAGG - Intronic
1101361343 12:104030706-104030728 CTTGATTTAAAAATAGGCAAAGG + Intronic
1101669772 12:106857918-106857940 TTTGCTTTCAAAGTAGATAAAGG - Intronic
1101846961 12:108370372-108370394 TTTTATTAAAATAGAGATGAGGG - Intergenic
1102333661 12:112058274-112058296 TTTGAGTAAAACTTAGATGAGGG + Intronic
1102938778 12:116919922-116919944 TTTAACTTAAAAACAGAAGAAGG - Intronic
1104696173 12:130865555-130865577 TTTAATTTAAAAATAAAGGCTGG - Intergenic
1104836073 12:131791773-131791795 CTTTTTTAAAAAATAGATGAAGG + Intronic
1104956378 12:132468262-132468284 AATGATTTAAAATTAGATGGTGG + Intergenic
1105310179 13:19199764-19199786 TATGAATAAAATATAGATGACGG + Intergenic
1105359924 13:19701307-19701329 TATGAATAAAATATAGATGACGG + Intronic
1105698768 13:22917399-22917421 TTTTAAATAAAAATAGTTGATGG - Intergenic
1105850519 13:24330263-24330285 TTTTAAATAAAAATAGTTGATGG - Intergenic
1105973494 13:25452789-25452811 TTTGAATTAAAAATAACTTAGGG + Intronic
1105984329 13:25550405-25550427 TTTTATTAAAAAATATCTGAAGG - Intronic
1106058055 13:26256689-26256711 TTGAATTTAAAGATAGTTGAAGG + Intronic
1106375204 13:29179830-29179852 TTTCATTTTAAAATATCTGAAGG + Intronic
1106692861 13:32137268-32137290 AATGATTTAAAAATAGAATAAGG + Intronic
1106825513 13:33516392-33516414 TTTGAATTAAAATATGATGATGG - Intergenic
1107170615 13:37338538-37338560 ATTGCTTTATAAATAAATGATGG - Intergenic
1107367151 13:39693548-39693570 CTTGATTTAAAAATAAATCATGG + Intronic
1108380908 13:49853260-49853282 CTGGATATAAAAATAGAGGATGG - Intergenic
1108487976 13:50946597-50946619 TTTGTTTTAAAAGTAGGAGAAGG + Intronic
1108718630 13:53106994-53107016 TTTCATTTAATAATAGGTGGTGG + Intergenic
1108916490 13:55619782-55619804 TTTGATTTAACAACATATAAAGG + Intergenic
1108974156 13:56417174-56417196 TATAATTTAAATATTGATGAAGG + Intergenic
1109050941 13:57480425-57480447 TTGGATTTAAAAAAATATAAAGG - Intergenic
1109174088 13:59133972-59133994 TTTGACTTTAAACTAGATGAAGG - Intergenic
1109174156 13:59134842-59134864 TCTGCTTTAAAAATAAATGATGG - Intergenic
1109548954 13:63867330-63867352 TTTACAATAAAAATAGATGATGG - Intergenic
1109774537 13:67022716-67022738 CTTGTTTTTAAAATAGGTGAGGG - Intronic
1109920321 13:69049306-69049328 TTTGGTTTACAAATATAAGAAGG + Intergenic
1110153210 13:72280488-72280510 TTTGATTTAATATTTGAAGATGG - Intergenic
1110293270 13:73832844-73832866 TTTGATTTAAAAGCTGATAATGG - Intronic
1110513138 13:76377006-76377028 TCTGATTTAAAAATAGGCAAAGG - Intergenic
1110535167 13:76642885-76642907 TTTGATTTGAAAATATCTGGTGG - Intergenic
1110605172 13:77423788-77423810 TTTGCTTTAACAATAGATACTGG + Intergenic
1110942987 13:81374667-81374689 TTTGATTTGAGAATTGATGATGG + Intergenic
1111012814 13:82333285-82333307 TTTTATTTAAAAATATATAAAGG - Intergenic
1111399569 13:87716458-87716480 TTTGTTTTAAAAATCCAAGATGG - Intergenic
1111632097 13:90854635-90854657 TTTGTTCTAAATATAGTTGAGGG + Intergenic
1112032427 13:95469949-95469971 ATTGTTTTAAAAATAGAATACGG - Intronic
1112062153 13:95751623-95751645 TTTGATTAAAAACTACAAGATGG + Intronic
1112131179 13:96525237-96525259 TTCTATTTAAAAATAGATGGGGG + Intronic
1112856606 13:103778266-103778288 TTTAATTTAAAAATAAATTATGG + Intergenic
1113033616 13:106023773-106023795 TTTTATTTAATAATATATCATGG - Intergenic
1113089395 13:106601223-106601245 TTATATTTAAAAATATATGTGGG - Intergenic
1113222281 13:108118811-108118833 TGTAATTTAAAAAGAGATAATGG - Intergenic
1113418032 13:110146148-110146170 TCTGATTTAGAACTAGATGCAGG + Intergenic
1114058153 14:18993207-18993229 TTTTATTTAAAAAAATATTAGGG + Intronic
1114104394 14:19408547-19408569 TTTTATTTAAAAAAATATTAGGG - Intronic
1114894253 14:26966372-26966394 TTGCATTTAACAAAAGATGAGGG - Intergenic
1115126431 14:30000101-30000123 TTTGATATATACATAGAGGATGG + Intronic
1115173668 14:30537308-30537330 TTCAATTTAAAAATAGACAAGGG - Intergenic
1115476562 14:33820172-33820194 TTTGATGTAGAAATAAATAAAGG + Intergenic
1115637635 14:35305909-35305931 TTTTAGTTAAAAATAGATATGGG - Intronic
1115783548 14:36798732-36798754 TTTGATATAGAAGGAGATGAAGG - Intronic
1116196275 14:41730261-41730283 TATTATTTAAAAATAAATAAAGG + Intronic
1116228653 14:42186390-42186412 TTTGATTTTAATATAGATCACGG - Intergenic
1116316343 14:43399146-43399168 TTTCTTTTAAAAAAACATGAAGG + Intergenic
1116882604 14:50186606-50186628 TTTTTTTTAAATATAGATGGGGG - Intronic
1117059360 14:51946282-51946304 ATGGATTGAAAAATAGATGTGGG + Intronic
1117408231 14:55425963-55425985 TTTGAATTAAAAATTAAAGAGGG + Intronic
1117862944 14:60111838-60111860 TCTTCTTTAAAAATAGATGTGGG - Intronic
1117871636 14:60207187-60207209 TTTAATTAGAAAATAGTTGAAGG - Intergenic
1117926418 14:60784349-60784371 TTTTTTTTAAATAGAGATGAGGG + Intronic
1118083029 14:62383580-62383602 TTTGATTCAAAAATAATTGATGG + Intergenic
1118290889 14:64521164-64521186 ATTAATTTAAAAATACTTGAAGG - Intronic
1118511284 14:66476745-66476767 TTTGATTTGAAGATAGATGTTGG + Intergenic
1118566754 14:67149511-67149533 TTTAATTTAAGAATATGTGAAGG + Intronic
1119289476 14:73483687-73483709 TTTATTTTTAAAATGGATGATGG + Intronic
1119298842 14:73554438-73554460 TTTCAAATAAAAATAGTTGATGG - Intronic
1119301954 14:73578653-73578675 ATTGATTTTAAAATAGAGGCCGG + Intergenic
1119329275 14:73782057-73782079 TTTTATTTAAAAATAGAATCTGG - Intronic
1119572169 14:75684455-75684477 TTTGTTTTTAAAATAATTGAAGG + Intronic
1119993562 14:79227116-79227138 TTTCATTTTAAAATGGATGTAGG - Intronic
1120195661 14:81479570-81479592 TTTCATTAAAATATAAATGATGG - Intronic
1120279943 14:82426587-82426609 TTTTATAAGAAAATAGATGATGG - Intergenic
1120281861 14:82449227-82449249 TATGTTTTAAAAAGAGAAGATGG + Intergenic
1120450184 14:84656856-84656878 TTTTTTTTAAAAATAGATAATGG + Intergenic
1120466921 14:84870026-84870048 TTTGATTTCAAAATTGTAGAAGG + Intergenic
1120568156 14:86084963-86084985 TTTGAATTAAAAAAAGATTTAGG - Intergenic
1120603824 14:86546511-86546533 TTGGATGGGAAAATAGATGAAGG + Intergenic
1120855051 14:89205144-89205166 TTTGATTTAAAAAAAAAAAAAGG + Intronic
1120992123 14:90386290-90386312 TTTAATTTAAAAATAAAAAATGG - Intergenic
1121334943 14:93071649-93071671 TGTAATTTAAAAATGGATGATGG - Intronic
1121944532 14:98106592-98106614 TTTCTTTAAAAAATTGATGATGG + Intergenic
1122023167 14:98856137-98856159 CTTGTTTGAAAAACAGATGAGGG - Intergenic
1122404794 14:101493675-101493697 CTTGATTCAAAAATGGGTGAAGG + Intergenic
1123497304 15:20841137-20841159 TTTTATTTAAAAAAAAATTAGGG - Intronic
1123554539 15:21414776-21414798 TTTTATTTAAAAAAAAATTAGGG - Intronic
1123590783 15:21852090-21852112 TTTTATTTAAAAAAAAATTAGGG - Intergenic
1124477900 15:30051312-30051334 TGTGTTTTAAAAATAGATTTAGG + Intergenic
1124548055 15:30651201-30651223 TTTAATTAAAAAATTAATGATGG - Intronic
1124817399 15:33009012-33009034 TTTAATTTAAAAATGGAAGAAGG + Intronic
1125053808 15:35334119-35334141 TTGTATTTAAAAATGGAAGAGGG + Intronic
1125088243 15:35757644-35757666 TTTGATTTATAAACTGCTGAGGG - Intergenic
1125558809 15:40610394-40610416 ATTGCTTAAAAAATATATGATGG + Intronic
1125792764 15:42381836-42381858 GTAGATTTAAAATTACATGATGG - Intronic
1126702090 15:51377586-51377608 TTTGTTATAAAAATACATGTTGG + Intronic
1126876523 15:53047774-53047796 TTTGATATAAAACCAGATGCAGG + Intergenic
1126915540 15:53462054-53462076 TTACATTTAAAAATACGTGAAGG - Intergenic
1126950863 15:53879462-53879484 TTTGATATAAAAATTGAAAAAGG - Intergenic
1127013915 15:54661289-54661311 TTTCATTTATAAATATAAGAGGG + Intergenic
1127161654 15:56193351-56193373 TTTTATTCAAAAATAGAAAATGG - Intronic
1127355929 15:58199711-58199733 GTTGCTTTAGAAATAGAAGAGGG + Intronic
1127512122 15:59653195-59653217 CGTGATTTAGAAACAGATGAGGG + Intronic
1128295818 15:66518503-66518525 TTTCTTTTAAAAAGATATGAGGG - Intronic
1128480603 15:68034566-68034588 TTGGAGTTAAAAATAGATCCTGG - Intergenic
1130451708 15:84060879-84060901 TTTTATTTAAAAATAAAATATGG - Intergenic
1130734521 15:86534251-86534273 TTTGATAGGAACATAGATGAAGG + Intronic
1130804331 15:87302772-87302794 TGTAATTGAAATATAGATGAAGG - Intergenic
1132050455 15:98603596-98603618 TATGCTTTAAAATTAGATCATGG + Intergenic
1132094259 15:98970344-98970366 TTTCATTTAAAAAAAGATGCAGG - Intronic
1132103301 15:99043650-99043672 ATTGATTGATAGATAGATGATGG - Intergenic
1133186057 16:4099435-4099457 TTTCTTTTCAAAAAAGATGAGGG + Intronic
1133636125 16:7667487-7667509 TTCGTTTTTAAAAGAGATGATGG + Intronic
1133895620 16:9925858-9925880 TTTGCTTTAAAAATAAATTTGGG - Intronic
1134034501 16:11019258-11019280 CTTGAATTAAAGATGGATGAGGG - Intronic
1134395646 16:13860502-13860524 TTTGGTTTAAAAATATGAGAAGG + Intergenic
1134657898 16:15961016-15961038 TTTTTTTTTAAAATAGATGGGGG + Intronic
1134763659 16:16736705-16736727 TTTGTATTAAAAATATATGAGGG + Intergenic
1134911803 16:18034048-18034070 CATGATTTAAAAATGGATGAAGG - Intergenic
1134982395 16:18622452-18622474 TTTGTATTAAAAATATATGAGGG - Intergenic
1135433120 16:22404028-22404050 TTTGCATTAAAAATAAAAGAGGG - Intronic
1135528843 16:23235087-23235109 ATTGATGTAAAAATGGATAAGGG - Intergenic
1135825777 16:25727441-25727463 CTTCAATTAAAAATAGATAATGG + Intronic
1135935832 16:26779262-26779284 TTTGGTTTAAAAAAAGAAGGTGG + Intergenic
1136097748 16:27970273-27970295 ATTAATTTAAAAATAGAGGCTGG + Intronic
1138172225 16:54863180-54863202 TTTGATTAAAAAATAAATATTGG + Intergenic
1138731581 16:59201190-59201212 TTTGATTTAGAACTTGAAGAGGG + Intergenic
1138810650 16:60145934-60145956 TTTGAATTAAATATATGTGAAGG - Intergenic
1138999871 16:62496501-62496523 TTTTTTTAAATAATAGATGATGG - Intergenic
1140420984 16:74818458-74818480 ATTAATTTAAAAAAAGATGAAGG - Intergenic
1140878706 16:79177567-79177589 TTTTATTTGAAAATGGGTGATGG + Intronic
1140902587 16:79383402-79383424 CTTGGTTTAAAAAAAAATGAAGG + Intergenic
1143279380 17:5740690-5740712 ATTGATTTAAAAAAACATTAGGG + Intergenic
1143847267 17:9781952-9781974 TTTGATTTGAAAAAACATGGTGG - Intronic
1144546796 17:16204433-16204455 TTTGTTTTAAAAATACAAAAAGG + Intronic
1144660518 17:17065617-17065639 TTTAATTTAAAAAAAAAAGAGGG - Intronic
1144886049 17:18462957-18462979 TTTGATTTTTAAATCCATGAAGG - Intergenic
1145146160 17:20481412-20481434 TTTGATTTTTAAATCCATGAAGG + Intergenic
1146584138 17:34067764-34067786 TTTCATTTAAAAACATATCATGG - Intronic
1146753587 17:35405680-35405702 TTGGATTTAAAAACAAATTAGGG - Intergenic
1146833885 17:36094337-36094359 TTTGCTTTAAAAAGAAAGGAAGG + Intergenic
1148565779 17:48632103-48632125 TTTGATTTCAAAAGAAATGCAGG - Intronic
1148660265 17:49325181-49325203 TTTGATTTAAAATTAGAGAGGGG + Intronic
1149214849 17:54342205-54342227 TTTCATTTAAAGATAAATTATGG - Intergenic
1149920213 17:60650950-60650972 TTTTATTTTTAAAGAGATGAGGG - Intronic
1149952507 17:61004969-61004991 TTTGATAAAACCATAGATGAGGG + Intronic
1149978749 17:61292347-61292369 TTTGATTTGAAAAGAAATGAGGG + Intronic
1150057393 17:62030736-62030758 TTTGTTTTAAAGGTAGATGGAGG + Intronic
1150230549 17:63547491-63547513 TGTGTTTTTAAAATAGATGGTGG - Intronic
1150502270 17:65662452-65662474 TGTGATTTAAAAAAAGATCTGGG - Intronic
1150694124 17:67389564-67389586 TGCCATTTAAAAATAGATGATGG + Intronic
1150730042 17:67684659-67684681 TTTTATTTAACAATAGATTAAGG + Intronic
1150973556 17:70058307-70058329 TTTTATTTAAAAAAACATGAGGG - Intronic
1151127278 17:71858764-71858786 TTTGATCTAAAAATATTAGAGGG - Intergenic
1151563817 17:74885850-74885872 TTTGTTTAAAAACTAAATGAGGG + Intronic
1151630634 17:75308715-75308737 TTTGATTTTTAAACAGATGAAGG + Intergenic
1152765548 17:82135885-82135907 TTTCTTTTAAAAATAGAGGTGGG - Intronic
1153005373 18:493693-493715 TTTGTTTAAAGAATAAATGAAGG + Intronic
1153069715 18:1091234-1091256 TTTGCTTTAAAAATCGCTGCTGG - Intergenic
1153123380 18:1759907-1759929 ATTGAATAAAAAATAAATGAGGG + Intergenic
1153316966 18:3732581-3732603 ATAGATTTAAAAATATTTGATGG + Intronic
1153490454 18:5641864-5641886 TTTGATAGAAAAATAGAAGAAGG + Intergenic
1154058784 18:11038348-11038370 TTTGAGTTAAAAATTAAGGAAGG - Intronic
1154400046 18:14027988-14028010 TTTTATTCTAAAATAGATCAAGG + Intergenic
1155352691 18:24922400-24922422 TTTTATTTAAAAAAAGAACAGGG - Intergenic
1155627244 18:27848662-27848684 TTTGATTTTAAAATTTATGAAGG - Intergenic
1155772291 18:29717042-29717064 TTTGATTTTAAAATAAATCAGGG - Intergenic
1155864608 18:30949688-30949710 TTAGAATTAAATATAAATGACGG - Intergenic
1155973997 18:32108674-32108696 TTTGGTTTTTAAATAGATGCAGG + Intronic
1157090456 18:44630751-44630773 TTTTATTACAAAATAGAAGATGG + Intergenic
1157320949 18:46633788-46633810 CTTAATTTAAAAATGGATGAAGG + Intronic
1158174618 18:54640725-54640747 TTGGATTTAAGAACAAATGATGG - Intergenic
1158282590 18:55843598-55843620 TTTTATTTAAAAATATATTATGG - Intergenic
1158585585 18:58730927-58730949 CTTGATTTAAAAATAGGCAAAGG - Intronic
1158866930 18:61646861-61646883 TTTTTTTTAAACATAGATCATGG - Intergenic
1158978402 18:62734733-62734755 TGTTATTTAATAATAGATGGTGG - Intronic
1159308544 18:66677696-66677718 TTTGATTTAAGCTGAGATGAGGG - Intergenic
1159345560 18:67199036-67199058 TTTGATATAAAAATAAATTTAGG + Intergenic
1159615686 18:70576915-70576937 TTTGATTTAATTATATATGATGG + Intergenic
1159668299 18:71191481-71191503 GATGCTTTAAAAAAAGATGATGG - Intergenic
1161146851 19:2684016-2684038 ATGGGTTTAAAAATAAATGATGG + Intronic
1163885690 19:19962831-19962853 TTTGCTATAAAACTAGATGCTGG + Intergenic
1165088621 19:33369999-33370021 TTTAAATTAAATAGAGATGAGGG + Intergenic
1165377547 19:35453468-35453490 TATGATTTAGAAATAGAGGCTGG - Intergenic
1165498989 19:36172474-36172496 TTTGATTTAAAAATCCATTGAGG - Intergenic
1165604719 19:37091987-37092009 TTTTATTGTAAAATAGTTGAGGG + Intronic
1166615326 19:44239210-44239232 ATTTATTTAAAAATACATGATGG - Intronic
1167279745 19:48559945-48559967 TTTTTTTTAAAGAGAGATGAGGG - Intronic
1168592126 19:57645777-57645799 TTTGATTCCAAAATAAATGTTGG - Intergenic
926176795 2:10600756-10600778 TTTACTTTAAAAATACATGTAGG - Intronic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
927375842 2:22412566-22412588 TTTGACTATAAACTAGATGAGGG + Intergenic
928323133 2:30299654-30299676 AGTGAATTAAAAATAGATCATGG - Intronic
928553563 2:32398683-32398705 TTAGATTTTAAAATTGATGTGGG + Intronic
929067927 2:37998864-37998886 TTTGATTTAAATATAAGTGAAGG + Intronic
929182811 2:39061686-39061708 TTCTTTTTAAAAATACATGAAGG - Intronic
929362278 2:41107327-41107349 TTTGATTTATCAATAATTGATGG - Intergenic
929720079 2:44359428-44359450 TTTAATTTAAAAATAAAGAATGG - Intronic
930024020 2:47019360-47019382 TTTTTTTTAAAAATAGAAAATGG - Intronic
930337384 2:50066594-50066616 ATTTATTTAAAAATAGATGTTGG - Intronic
930692467 2:54378737-54378759 TTTGATTTAAACAGAGTAGAGGG - Intronic
931003538 2:57819864-57819886 TTTGGCTTAAAAATATATTATGG + Intergenic
931723902 2:65090124-65090146 TTTCATTTAAAAATATTTCACGG + Intronic
931808688 2:65833097-65833119 TATAATTTATAAATAGATGGAGG + Intergenic
931959239 2:67463752-67463774 TTTATTTTACAAATAGAGGAAGG - Intergenic
932290807 2:70577443-70577465 TTTTATTTAAATATATATTAAGG - Intergenic
932813612 2:74844297-74844319 TGTGTTTTAAAAAAACATGATGG - Intronic
933454039 2:82498960-82498982 ATTGATAAAGAAATAGATGAGGG + Intergenic
933725105 2:85422322-85422344 TTTAATTTAAAAACAGATATGGG - Intronic
934549612 2:95248892-95248914 TTTGATTTTAAAAAGAATGAAGG - Intronic
934632865 2:95949031-95949053 TTTGAATCAGAAATAGATAATGG - Intronic
934633227 2:95954439-95954461 TTTGAATCAGAAATAGATAATGG - Intronic
934800273 2:97148839-97148861 TTTGAATCAGAAATAGATAATGG + Intronic
934800635 2:97154218-97154240 TTTGAATCAGAAATAGATAATGG + Intronic
935098738 2:99971950-99971972 TCTGTTTTAAAAATAAAAGAAGG + Intronic
935680232 2:105629539-105629561 TTTTATTTGAAAAGTGATGATGG - Intergenic
936158437 2:110065255-110065277 TTCCATTAAAAAGTAGATGAAGG - Intergenic
936186224 2:110306067-110306089 TTCCATTAAAAAGTAGATGAAGG + Intergenic
936575382 2:113649032-113649054 TTTAATTTAAAAAATGATGAAGG + Intergenic
936633000 2:114224871-114224893 GTTGATTTAAAAATACAATATGG + Intergenic
936686351 2:114831087-114831109 TTGTATTAAAAAACAGATGATGG + Intronic
936752009 2:115654672-115654694 ATTCATTTAAAAATAGATGTAGG - Intronic
936969802 2:118165940-118165962 CCTGATTAAAAAATAGCTGAAGG + Intergenic
937187411 2:120057334-120057356 TTAGATTTTAAAATAGACGATGG - Intronic
938607014 2:132905005-132905027 TTTGATTACAAAATCAATGAAGG - Intronic
939672312 2:145027846-145027868 TTTAATTTAAAAATTGATGTTGG - Intergenic
939709639 2:145501518-145501540 TAGGATTTAAAAATTGAGGATGG + Intergenic
939855326 2:147352237-147352259 TTTGAATTAAAAAAAAATTAAGG + Intergenic
939951908 2:148485430-148485452 TAAAATCTAAAAATAGATGAAGG + Intronic
940990296 2:160089148-160089170 TTTGATTTTAAAATGGAGGATGG + Intergenic
941004720 2:160236189-160236211 TTTTACTTAAAAATAGAGAAAGG - Intronic
941048033 2:160698476-160698498 TTTAATTTAAAAACAGAAAACGG - Intergenic
941196638 2:162460410-162460432 TTTGCTTTAAAAAAATAAGAAGG + Intronic
941213446 2:162672994-162673016 ATTGATTTAAGAATAAATGGAGG + Intronic
941222531 2:162801573-162801595 TTTTCATTACAAATAGATGAAGG + Intronic
941404055 2:165067164-165067186 TTTTTTTAAAAAATAGATGATGG - Intergenic
941490084 2:166132801-166132823 TATGATATAAAAATATCTGAGGG + Intergenic
941578112 2:167261337-167261359 TTTTTTTTAAAAAAAGATGAGGG - Intergenic
942225551 2:173811975-173811997 CTTGATTTAAAAAAAGGTTAAGG + Intergenic
942436455 2:175982693-175982715 TTTTATTTAAAAATATAAAAGGG - Intronic
942518467 2:176778119-176778141 TTTGGTTTAAAAAAAGTTGAGGG - Intergenic
942583264 2:177444994-177445016 TTTGAATTAAAAATAAAGTAGGG + Intronic
942710540 2:178830291-178830313 TTGAATTTAAAAATAGATGCTGG - Exonic
943065543 2:183082350-183082372 GTTGTTATAAAAATGGATGATGG + Intronic
943253616 2:185565046-185565068 TCTGATTTAAAAATAAAATAAGG + Intergenic
943395999 2:187335322-187335344 TTTGATATAAAAATACACAATGG + Intergenic
943402534 2:187432621-187432643 TATGTTTTAAAAACACATGAAGG - Intronic
945149650 2:206776053-206776075 TATGATTTAAAAATAGGCAAAGG - Intronic
945327073 2:208494492-208494514 TTTGTTTTAAAAATACATTTTGG + Exonic
945402060 2:209395085-209395107 TTTAATTTGCAAATAGATAATGG - Intergenic
945504986 2:210628942-210628964 GATGATTTAAACAAAGATGATGG + Intronic
945690588 2:213030006-213030028 CATAATTTAAAAATAGGTGAAGG - Intronic
946535106 2:220619217-220619239 TTTGATTTAAAAACAAATGGTGG + Intergenic
947012888 2:225585221-225585243 TTTTATTTAAAAATACATAATGG + Intronic
947020880 2:225674334-225674356 ATTAATTTCAAAATAGCTGAGGG + Intergenic
947167520 2:227277383-227277405 TTTCTTTTAAAATAAGATGAAGG + Intronic
947316080 2:228860221-228860243 TTTGTTTTAAAAATATATAATGG - Intronic
947374007 2:229476768-229476790 GTTGATTTAAAAACAGAAGCAGG + Intronic
947454993 2:230245874-230245896 CTTGCTATACAAATAGATGAAGG + Exonic
947609583 2:231515496-231515518 TTTCATTTAAGAACAGATGCAGG + Intergenic
948285356 2:236780289-236780311 TTTTCTTTAAAAATGTATGATGG - Intergenic
1169298867 20:4424818-4424840 TTGGAATTAGATATAGATGATGG - Intergenic
1169733677 20:8813527-8813549 TTTGTTGTAAAAATGAATGAGGG + Intronic
1170335739 20:15268349-15268371 TTTTATTTAAAAATAGATTGAGG + Intronic
1171538830 20:25926789-25926811 CTGGATTTGAAAATAGAGGAAGG + Intergenic
1171560954 20:26125327-26125349 TTTGTTTTAAAAATACAAAAAGG + Intergenic
1172202427 20:33135956-33135978 TTTTCATTAAAAATAGATGTAGG - Intergenic
1174590710 20:51642456-51642478 TTTCATTTTAAAACAGATGCTGG - Intronic
1174798386 20:53541491-53541513 TCTGATATAAAAATAGGTGGGGG + Intergenic
1174943920 20:54963867-54963889 TTTGATTTAAAACTGAAAGATGG + Intergenic
1175156072 20:56972610-56972632 TTTGCTTTAAAAACAGATCCAGG - Intergenic
1176699458 21:10025795-10025817 CTTGTATTAAAAATAAATGAAGG + Intergenic
1176879577 21:14174508-14174530 TTTTATTTAAAAAAAAATGATGG - Intronic
1176931784 21:14821041-14821063 TTTTATGCAAACATAGATGAGGG + Intergenic
1177087103 21:16719236-16719258 TTTGATTTAAAAAATCATGGTGG + Intergenic
1177284520 21:19032460-19032482 TATAATTTAAAAATACGTGAAGG - Intergenic
1177693702 21:24543682-24543704 CTTCATTTAAAATTAGATTATGG + Intergenic
1177698404 21:24603898-24603920 TTTCATTTAAAAATATTTTAGGG + Intergenic
1177918333 21:27119503-27119525 TTTAATTTAAAAATGACTGAAGG - Intergenic
1178189854 21:30267860-30267882 TTTGGTTCAAAAATTGCTGAGGG + Intergenic
1178513200 21:33224748-33224770 GTGGATTTAAAAATAAATCAAGG - Intergenic
1178706836 21:34882628-34882650 TTTGTTTTAAAAAGATATCACGG + Intronic
1178966265 21:37121442-37121464 TATGTTTTAAAAATATTTGAAGG - Intronic
1180138599 21:45877167-45877189 TTTGGCATGAAAATAGATGATGG + Intronic
1180178268 21:46101231-46101253 CTTGATTCAAAAATAGGTCAAGG - Intronic
1180223986 21:46378315-46378337 TTTCAGTTAAAAGTTGATGACGG - Intronic
1180476640 22:15715823-15715845 TTTTATTTAAAAAAATATTAGGG + Intronic
1181840589 22:25656220-25656242 CTAGATTTAAAAATAAATAATGG + Intronic
1182788405 22:32927644-32927666 ATGGATTTAAAAATATATGAAGG - Intronic
1183245607 22:36691094-36691116 TTTGTTGAAGAAATAGATGAGGG + Intronic
1183572150 22:38661533-38661555 TGTAATTTATAAATAAATGAAGG - Intronic
1183814060 22:40284303-40284325 AATGATTAAAAAATAGATTAAGG - Intronic
1184096102 22:42317413-42317435 TTCGATTTAAACACAGATGACGG + Intronic
1185424800 22:50761862-50761884 TTTAATTTAAAAAATGATGAAGG - Intergenic
949162679 3:900163-900185 TTTAATTTAGAAATAGAACAGGG + Intergenic
949199458 3:1356771-1356793 TTTGATTTAAAAATTAGTGATGG + Intronic
950370784 3:12528415-12528437 TGGATTTTAAAAATAGATGATGG + Intronic
950694357 3:14686650-14686672 CTTGATTTAAAAATGGATTAAGG - Intronic
950938030 3:16863004-16863026 TTTGAGTTAAAAAAAAATCAAGG + Intronic
951090092 3:18562270-18562292 TTTGATGGAAAATTAGATTAGGG + Intergenic
951160490 3:19413786-19413808 TTTGTTTTTAAAACAGAGGAGGG - Intronic
951888392 3:27546769-27546791 TTTCTTTTAAAAATAGAAGTGGG + Intergenic
951960756 3:28317192-28317214 TTTTATTTAAAAAAAAATGTAGG - Intronic
952033242 3:29170112-29170134 TTTCATTTAGAAAGAGAGGAAGG + Intergenic
953312452 3:41891989-41892011 TTTAATTAAAAAATTTATGATGG + Intronic
953336673 3:42099466-42099488 TTTGATTTTGACCTAGATGATGG + Intronic
953735977 3:45494348-45494370 TTTAATTTAAGAATAAAAGAAGG - Intronic
953786960 3:45918238-45918260 TCTGATTTAAAAAAAGAAAAAGG - Exonic
954360034 3:50116971-50116993 TCAGATTTAAAAATACTTGAGGG + Intronic
954776064 3:53019638-53019660 TTTGATTTCAAAATTCATGGTGG - Intronic
955304474 3:57816025-57816047 CTTGATTTAAATATAGGTAAAGG + Intronic
955915058 3:63899468-63899490 TTTGATTTAAAAAAACAAAAAGG + Intronic
956368055 3:68527170-68527192 TTTGATTTACAAATAGAATCAGG + Intronic
956453103 3:69393246-69393268 TTTGATAAAATAACAGATGAGGG - Intronic
956566236 3:70641458-70641480 ATTGATTTATAAGTTGATGAGGG + Intergenic
956686905 3:71837974-71837996 TTTCATTTAAAAGAAGATGCTGG + Intergenic
956955335 3:74332051-74332073 TATGTTTTAAAAATAGGTTAGGG - Intronic
957004135 3:74924030-74924052 TTTTTTTTAAAAAAAAATGAAGG + Intergenic
957175295 3:76800540-76800562 TCTGATTTAAAAATAGGGAAAGG + Intronic
957190104 3:76996644-76996666 TTTGAATTTAAAATGGCTGATGG - Intronic
957193964 3:77043838-77043860 TTTCATTTAAGAATAGTTAAAGG - Intronic
957523596 3:81351986-81352008 TTTTCTTTAAAAATAGAGCATGG + Intergenic
957660827 3:83149940-83149962 ACTGATTTAAAAATAATTGATGG + Intergenic
957748350 3:84375410-84375432 TTTTATTAAAAAATAAAGGAGGG - Intergenic
957858861 3:85917038-85917060 TTTGAGTTAATTATAGATTATGG + Intronic
957883891 3:86257496-86257518 TTTGCTTTAAAAATAGAGCAGGG + Intergenic
957885107 3:86277314-86277336 TGTGATTTTAAAATACATGCTGG + Intergenic
958189503 3:90166856-90166878 ACTGATGAAAAAATAGATGAAGG + Intergenic
958670113 3:97192857-97192879 TTTTATTTAATAATTGATGCTGG - Intronic
959012972 3:101099608-101099630 TTTGGTTTAAAAATAGTATATGG + Intergenic
959228187 3:103613711-103613733 TAAGATATAAAAATATATGATGG + Intergenic
959415995 3:106076253-106076275 ATTTATTTAAAAATATTTGAGGG + Intergenic
959637813 3:108594792-108594814 TTTTATTTAAAAATATACTAAGG - Intronic
960100838 3:113741465-113741487 CTGCATTTAAAAAAAGATGAAGG + Intronic
960113255 3:113866659-113866681 TTTGATTTAAAATTTTTTGAGGG + Intronic
960121139 3:113949184-113949206 TTTCGTTTAAAGAGAGATGAGGG + Intronic
960216354 3:115043256-115043278 TTTGTTTAAAAAGTAGTTGAAGG + Intronic
960312686 3:116135740-116135762 ATTGCTTTTAAAATAAATGAAGG - Intronic
960707744 3:120496535-120496557 CTTGAGTTACAAATGGATGATGG + Intergenic
960795021 3:121476337-121476359 TTTAATTTACAAATAAAGGAAGG - Intronic
960912011 3:122658690-122658712 TTTGGTTTTAAAATATAAGAAGG + Intergenic
961088019 3:124085980-124086002 TTTCATTCAATAATAGATCATGG + Intronic
961398791 3:126618887-126618909 TTTGATTTAAAAATGGGCAAAGG + Intronic
961500931 3:127335115-127335137 CTTGATTTAAAAATGGTTGGAGG + Intergenic
961615651 3:128177835-128177857 ATTGATTTGCAAAGAGATGAAGG + Intronic
961987406 3:131152458-131152480 ATTGTTTTAAAAATTGTTGAAGG + Exonic
962473802 3:135738384-135738406 TTTCACTTAAAAATAGATGCTGG + Intergenic
962508543 3:136074326-136074348 TTTGCTGTACAAATAGCTGATGG - Intronic
962520459 3:136193999-136194021 CTTTATTTAAAAGTAGATAAAGG - Intronic
963000480 3:140677018-140677040 TTTGCCTTAAAAAAAGATAAAGG + Intergenic
963098000 3:141566042-141566064 ATTCATTTAAAAATAGAAGGAGG - Intronic
963162644 3:142167387-142167409 TTTTAATTAAAAATAAATAAAGG + Intronic
963394048 3:144709179-144709201 TTTTATTTAAAATCAGAAGATGG + Intergenic
963497889 3:146091681-146091703 TTTGATTTTATGATAGATAATGG - Intronic
963671217 3:148254311-148254333 TCTGCTTTAAGAAGAGATGAAGG - Intergenic
964194671 3:154048721-154048743 TGTTATGTAATAATAGATGAAGG + Intergenic
964320585 3:155492529-155492551 TATGCCTTCAAAATAGATGATGG + Intronic
964771035 3:160225027-160225049 TTCCGATTAAAAATAGATGATGG - Intergenic
965046035 3:163578043-163578065 TTTGATTTAATAATACATTCAGG + Intergenic
965423185 3:168488118-168488140 TTTAATTGACAAGTAGATGAGGG + Intergenic
965436132 3:168653978-168654000 CATTATTTAAAAATTGATGAAGG - Intergenic
965724429 3:171699063-171699085 TTTAAATTAAAAATAGATCTGGG - Intronic
966043076 3:175515979-175516001 TTTTATTTTAAAATAAATAAAGG + Intronic
966268645 3:178078356-178078378 TATGATTGAATCATAGATGAGGG - Intergenic
966347791 3:178998103-178998125 TTTATTTTAAAAATAGAATATGG + Intergenic
966562392 3:181337490-181337512 TTTATTTTAAAAATATATAATGG + Intergenic
966614479 3:181898677-181898699 TTTATTTCAAAAGTAGATGATGG - Intergenic
967071995 3:185970384-185970406 TTAGATTTAAAAAAATATAATGG + Intergenic
967085634 3:186092740-186092762 CTGGGTTTTAAAATAGATGACGG + Intronic
967210775 3:187166556-187166578 ATTTATTTAAGAATAGGTGAGGG - Intronic
967448859 3:189599147-189599169 TTTGAATTAAAGGTGGATGAAGG - Intergenic
967568743 3:191002521-191002543 GTCAATTTAAAAATAGATTAAGG - Intergenic
967733063 3:192924086-192924108 TTTGATTAAAAAGTAAATGCAGG + Intergenic
970135402 4:12916758-12916780 AATGATTTAAAATTAGAAGATGG - Intergenic
970146021 4:13036690-13036712 TTAGTTTTAAAAATCTATGAAGG + Intergenic
970152391 4:13103285-13103307 TTCCAATTAAAAATAGATAAAGG - Intergenic
970403316 4:15738534-15738556 TTTGATTTAAAAATATATGTTGG + Intergenic
970677217 4:18464717-18464739 TCTGGTTTAAAAATGGAAGAAGG - Intergenic
971575076 4:28262794-28262816 TTTGTTTTAAGAATGGAGGAAGG - Intergenic
972420823 4:38884532-38884554 TTTGCTTTTTAAATAGATTATGG + Intronic
972757707 4:42066143-42066165 TTAATTTTAAAAATAGATGAAGG - Intronic
972779335 4:42272514-42272536 TTTTATTTACAAATAATTGATGG + Intergenic
972796252 4:42423071-42423093 ATAGTTTTAAAAATAAATGATGG + Intronic
972997833 4:44904453-44904475 TAAGATTTAAAAATAGATATAGG - Intergenic
973039429 4:45452038-45452060 AATGATTTAAAACTAGATGGTGG + Intergenic
973933875 4:55822150-55822172 TTAATTTTAAAAATACATGATGG - Intergenic
974225028 4:59030149-59030171 TTTTATTTAAAAATATATTCTGG + Intergenic
974313967 4:60252812-60252834 TTTGATATAAAAACATATTACGG + Intergenic
974417483 4:61628546-61628568 TTTAATTTAATTATAAATGAAGG + Intronic
974577435 4:63744939-63744961 TTTAATTTAAAAAAAACTGAAGG + Intergenic
974675443 4:65081880-65081902 TATGTTTTAAAAAGAGATGTAGG - Intergenic
975057734 4:69956454-69956476 TTTGCTGTAAATATATATGAAGG - Intronic
975411231 4:74053388-74053410 GTAGAATAAAAAATAGATGATGG - Intergenic
975454096 4:74569104-74569126 TCTGATTTAAAAATACGTGAAGG + Intergenic
975534186 4:75432098-75432120 TTTATTTTATAGATAGATGAAGG - Intergenic
975643732 4:76526065-76526087 TGTGATATAAAAATAAATGTCGG + Intronic
975900638 4:79147658-79147680 ATAGAATTAAAAATAGATTATGG - Intergenic
975988011 4:80222830-80222852 TTTTATTCAATAATAGATGTTGG + Intergenic
976029133 4:80729902-80729924 TTAAATTTAAAAATAGATGCTGG - Intronic
976288128 4:83389878-83389900 TATGTTTTAAAAATAGATACAGG + Intergenic
976440553 4:85068545-85068567 TTTCATTTAGAATTAGATCATGG + Intergenic
976568018 4:86574890-86574912 TATGATTTAACAAAATATGATGG + Intronic
976758851 4:88526832-88526854 TTTGTTTTTAAAATAAATGTTGG - Intronic
976759871 4:88537190-88537212 TTTGCTATAAAAATACATTAAGG - Intronic
977013791 4:91666803-91666825 CTTGACTTCAAAATATATGAAGG - Intergenic
977441270 4:97070769-97070791 TTTGTTTTTATAATAGATGTGGG + Intergenic
977467998 4:97405797-97405819 TTTTATTTCAAGATAGATGCTGG - Intronic
977519478 4:98062714-98062736 TTTGAATTAAAAGAAGATGATGG + Intronic
978036068 4:103996438-103996460 TTTGAATAAAGAATAGATAAAGG + Intergenic
978630510 4:110738649-110738671 TTTAGTTTAGAAATAGATCAGGG - Intergenic
978715805 4:111841054-111841076 TATGAATTAAAGAGAGATGATGG + Intergenic
978965735 4:114738945-114738967 TGTGATTGAAAAATAGTTAAGGG + Intergenic
979355509 4:119698849-119698871 TTTGATTTTAAAATATTTGGGGG - Intergenic
979401830 4:120258382-120258404 TATCATTTAAAAATAGAAAATGG - Intergenic
979784372 4:124697314-124697336 TTTGATTTTGAAATACATCAGGG - Intronic
980293314 4:130873100-130873122 CTTGATATAAAAATATATAAAGG + Intergenic
980307599 4:131083193-131083215 TATGATTTCAAAATAGTTAAAGG - Intergenic
980373630 4:131912984-131913006 TTTAATTAAAAAATATATAAGGG + Intergenic
980690013 4:136283418-136283440 TTTATTTTAAAAATATATAATGG - Intergenic
981156710 4:141446011-141446033 TAAGCTTTAAATATAGATGAAGG + Intergenic
981298422 4:143159459-143159481 TTTGATTTAAAATTATATTTAGG + Intergenic
981365693 4:143900111-143900133 ATAGATTTAAAAATGGGTGAAGG + Intronic
981907146 4:149934480-149934502 TTTTAATTAAAAATAAATCAAGG + Intergenic
981967638 4:150624679-150624701 TTTTAATTAAAACTAGATAAAGG + Intronic
982001965 4:151029137-151029159 TTTGATTTAGAAATAAACTATGG - Intergenic
982642807 4:157984289-157984311 TTGGGTTTTATAATAGATGAAGG - Intergenic
983033423 4:162832389-162832411 TTCAATTTAAAAATATATGGTGG + Intergenic
983093121 4:163529492-163529514 TTACATTTTAAAATAAATGAGGG - Intronic
983391941 4:167143033-167143055 AATGGTTTAAAAATAGATCATGG + Intronic
983626441 4:169806293-169806315 TTTGTTTTAAAAAGAAATGTTGG + Intergenic
984037522 4:174688539-174688561 TTTGAATTAGAAATAGAGAAGGG + Intronic
984205561 4:176783786-176783808 TTTGATTTTGAAACAGGTGAAGG - Intronic
984317353 4:178143439-178143461 CCTGATTTAAAAATGGGTGAAGG + Intergenic
984930932 4:184846565-184846587 GTTTATTTCTAAATAGATGAAGG + Intergenic
986440718 5:7779327-7779349 TTTGATTTTAGAATAGGGGAAGG + Intronic
986723262 5:10575694-10575716 GCTGATTTAAAAATAAAGGAAGG + Intronic
987172948 5:15277723-15277745 TTGGATTTAAAAATATATATTGG - Intergenic
987648280 5:20705196-20705218 TTTAATTTAAAAATATAATAGGG + Intergenic
987693649 5:21300407-21300429 TTTATTTAAAAAATAGGTGATGG - Intergenic
988093661 5:26573535-26573557 GTTGATTCTAAAATATATGAAGG - Intergenic
988101395 5:26683518-26683540 CTTGATTTATCAATAGTTGATGG - Intergenic
988310096 5:29545677-29545699 TTTGTTTTAAAAAATTATGATGG + Intergenic
988643807 5:33071548-33071570 TTTGATTTAAAAATTTTTGAGGG + Intergenic
989260046 5:39408663-39408685 GTTGCTTTCAAATTAGATGAAGG + Intronic
989371951 5:40719861-40719883 TGTAATTTAAAAATAGACAAAGG - Intronic
989509732 5:42271526-42271548 TTTGAATTAAAATTACATTAAGG - Intergenic
990433327 5:55760190-55760212 TTTGCTTTAGAAATGGATGATGG + Exonic
991122787 5:63034814-63034836 TTTGATTTTCAATTATATGAGGG + Intergenic
991157144 5:63452091-63452113 TTTGATTTTCAAATATGTGAGGG + Intergenic
991197508 5:63953594-63953616 TATGTTTTAAAAAGATATGAAGG - Intergenic
991372072 5:65929373-65929395 TTTGTTTTGGAAATAGATTATGG + Intronic
991446086 5:66701758-66701780 TTTGATAAAATAATAGATGGAGG - Intronic
991746620 5:69749139-69749161 TTTATTTAAAAAATAGGTGATGG + Intergenic
991751085 5:69806103-69806125 TTTATTTAAAAAATAGGTGATGG - Intergenic
991768497 5:70015977-70015999 TTTTTTTTAAATATAGATGGGGG + Intergenic
991798222 5:70329082-70329104 TTTATTTAAAAAATAGGTGATGG + Intergenic
991825998 5:70624451-70624473 TTTATTTAAAAAATAGGTGATGG + Intergenic
991830372 5:70680998-70681020 TTTATTTAAAAAATAGGTGATGG - Intergenic
991847735 5:70891059-70891081 TTTTTTTTAAATATAGATGGGGG + Intergenic
992118991 5:73571633-73571655 TTTGATTTAAAAATAAGTTGAGG + Intronic
992180571 5:74193431-74193453 TTTCATTTAAAGTTGGATGATGG + Intergenic
992674583 5:79093066-79093088 TTTCATTTAACAATATATGGAGG - Intronic
992966523 5:82007189-82007211 TTTGATTTACAATTTTATGAAGG + Intronic
992980556 5:82166670-82166692 TTTGTTTAACAAACAGATGAAGG - Intronic
993564542 5:89457176-89457198 TTGGATTTTAAAATAGAAAAGGG + Intergenic
994045150 5:95300083-95300105 TTTTGTTTGAAAATAAATGATGG + Intergenic
994098582 5:95870204-95870226 GTTGAGTCAAAAGTAGATGAAGG + Intergenic
994202582 5:96994806-96994828 TTTGCTTTAAAAATAGGGCATGG + Intronic
994227359 5:97268365-97268387 TTAAATTTAAAAAAAGAGGAGGG - Intergenic
994430722 5:99656932-99656954 TTAAATTAAAAAATAGATGTTGG + Intergenic
994433107 5:99693940-99693962 TTTGATTTAAATAGAAATGATGG - Intergenic
994678257 5:102852312-102852334 TCTTATTTAAAAATATATTAAGG - Intronic
994679737 5:102871010-102871032 TTGGATTTCAAAATAAATAAAGG + Intronic
994754041 5:103773101-103773123 TCTTATTTAAAAATATATAATGG + Intergenic
995217781 5:109614862-109614884 TTTCTTGTAAAAATTGATGAGGG + Intergenic
995260570 5:110099313-110099335 TTTGATTCAAAACTATATAATGG - Intergenic
995604580 5:113838284-113838306 TTCAATTTAAAAATAGGTAAAGG - Intergenic
996019397 5:118575342-118575364 TTGGAATTAAAAATAGATCTTGG - Intergenic
996043175 5:118839660-118839682 TTGGATTTAAAAACAAATTAGGG - Exonic
996160373 5:120154776-120154798 TTTGATTTTAAAATTGGTGCAGG - Intergenic
996256180 5:121405606-121405628 TTTCAGTTAAAAATAGATAGAGG + Intergenic
996283089 5:121755868-121755890 TTTCAAATCAAAATAGATGAAGG - Intergenic
996344000 5:122470314-122470336 TTGAATTTTAAAATATATGATGG - Intergenic
996673060 5:126141946-126141968 TATTATTTAAAAAGAGAAGAGGG + Intergenic
996887811 5:128379429-128379451 TTTGAAGTAAAAAAACATGAGGG + Intronic
996939326 5:128984841-128984863 TTTTATTTAAAAATTGGTGGAGG + Intronic
997886485 5:137634786-137634808 TTTAATTTAAAAGTAAATGACGG - Intronic
998210268 5:140191786-140191808 TGTGATTTAAAAATAAATAATGG + Intronic
998678994 5:144443672-144443694 ATTGATTTAAACATATTTGATGG + Intronic
998924730 5:147109762-147109784 TTTTATTTTGAAATAGATGTAGG - Intergenic
998925625 5:147122000-147122022 TTTAATTTAAAAATATAGAATGG - Intergenic
999568966 5:152897164-152897186 TTTCTGTTAAAAATTGATGAGGG + Intergenic
999884370 5:155904519-155904541 TTTTATTTTAAAATATATAATGG + Intronic
1000153161 5:158523432-158523454 TTTCATTTAAAAATGGATTCTGG + Intergenic
1000244089 5:159434605-159434627 TTTGATTTGAAAAATGGTGAAGG + Intergenic
1000503069 5:162076960-162076982 CTTTATTTAAAAATAGTTGCAGG - Intronic
1000699507 5:164430893-164430915 TTTAAGTGAAAAATATATGATGG - Intergenic
1001927784 5:175651366-175651388 TTTGCTGTAAAGATAGCTGATGG - Intergenic
1003392118 6:5723234-5723256 TTTGATATAAAAAGAGAATAAGG + Intronic
1003485837 6:6578673-6578695 TTTGATTTTATAATAGAAAATGG + Intergenic
1003488948 6:6604469-6604491 ATTGTTTTTAAAATAGCTGAAGG + Intronic
1003622970 6:7718259-7718281 TTTGAGTTAAAAATGAATTATGG + Intergenic
1003898382 6:10629891-10629913 TTTTATTTGAAAAAATATGATGG - Intergenic
1004395969 6:15246819-15246841 TTTCATCTAAAAGTAGATTATGG - Intronic
1004634382 6:17453024-17453046 GTTGATTTATAAGTAGTTGATGG - Intronic
1004648226 6:17583456-17583478 TTTAATTAAAAAATAGAGAAAGG + Intergenic
1004951127 6:20673137-20673159 TTCTGTTTAAGAATAGATGATGG + Intronic
1005277905 6:24239351-24239373 TTTGATGGAAAATAAGATGATGG - Intronic
1005402624 6:25450495-25450517 TTTAAGTGAAAAATAAATGAAGG - Intronic
1005545632 6:26866800-26866822 TTTAATTTAAAAATATAATAGGG - Intergenic
1005557261 6:26999531-26999553 TTTATTTAAAAAATAGGTGATGG + Intergenic
1006174367 6:32113078-32113100 TTTAATTTAAAAATAGAAGTGGG - Intronic
1006524880 6:34595743-34595765 TTTGATTTAAATAAATAAGAAGG + Intronic
1006551594 6:34828142-34828164 TTTCATTTAAAAATATATCCTGG + Intronic
1006792047 6:36708601-36708623 TTTGAAATAAACATAGAAGAAGG + Intronic
1007669535 6:43539950-43539972 TTATTTTTAAAAATAGAAGACGG + Intronic
1007846460 6:44761437-44761459 ATTGACTTATAAATAAATGAGGG - Intergenic
1008242947 6:49134800-49134822 ATTGATTCAAAAATATATGCTGG - Intergenic
1008437499 6:51493759-51493781 TTTGATTTTAAAATAGAACATGG + Intergenic
1008463775 6:51806673-51806695 CGTTATCTAAAAATAGATGAGGG + Intronic
1008733876 6:54518225-54518247 TTTGTTTTTTAAAAAGATGAGGG + Intergenic
1008743953 6:54645980-54646002 TTTGATTAAAAAATAGATGCAGG + Intergenic
1009016337 6:57907569-57907591 TTTAATTTAAAAATATAATAGGG - Intergenic
1009054922 6:58323154-58323176 TTTCATTTAATAATATATTATGG - Intergenic
1009236229 6:61127422-61127444 TTTCATTTAATAATATATTATGG + Intergenic
1009467405 6:63988987-63989009 TTTAATTTAAATTTAGATGTTGG + Intronic
1009563783 6:65282299-65282321 TTTGATTTATAAATAGAATGTGG - Intronic
1009907344 6:69886148-69886170 TCTGATTTAAAAATGGACAAAGG + Intronic
1010739632 6:79484728-79484750 TTTTTTTTAAAAAAAGATGAGGG - Intergenic
1010837778 6:80611694-80611716 TTTTATTTAAAAATATAGGTTGG + Intergenic
1010851896 6:80787321-80787343 TTTGATATAAAAATGGGTTATGG + Intergenic
1011519249 6:88186454-88186476 TTTTAAGTAAAAATAGGTGAAGG + Intergenic
1012538673 6:100332119-100332141 TTTGTTTAAAATAAAGATGAAGG + Intergenic
1012613331 6:101244038-101244060 TTTGATTTAGAAAAAAATGTTGG - Intergenic
1012700003 6:102444085-102444107 TGAGATTAAAAAATACATGAAGG + Intergenic
1012792852 6:103722059-103722081 TGTGATTTAAAAATATATGTAGG - Intergenic
1012887602 6:104863024-104863046 TGTGATATAAAAATATATCAGGG + Intergenic
1012914843 6:105158362-105158384 TTTGATTTATAAAAACATTAGGG + Exonic
1013145382 6:107385203-107385225 TTTAATTTAAAAATGCAGGAAGG - Intronic
1013250279 6:108326656-108326678 CTTTATTTAAAAATGAATGAGGG + Intronic
1013768422 6:113599487-113599509 TTTGTTTTAAAGAATGATGATGG - Intergenic
1013796957 6:113898889-113898911 TTTGACTTAAACATGCATGAGGG - Intergenic
1013797127 6:113900420-113900442 TGTCATTAAAAAATATATGAGGG - Intergenic
1013943958 6:115700065-115700087 CTTGATTTAAAAATGGATAAAGG - Intergenic
1014554946 6:122834407-122834429 TTTGTGTTAAAAATAAAGGAAGG + Intergenic
1014615932 6:123599672-123599694 TTTGATTAAAGAATGTATGAGGG + Intronic
1014639838 6:123895436-123895458 TTTGTTTTCAAAATATATCAAGG - Intronic
1014656145 6:124106861-124106883 TTTAATGTAAAAATCTATGAAGG - Intronic
1014704100 6:124725465-124725487 TTAGTTTTAAAAATAGAACAGGG - Intronic
1014842576 6:126237733-126237755 TTTGATTTAGAATTAGTTTAGGG - Intergenic
1014948953 6:127531550-127531572 TTTGATTAAAAACTATATGTAGG + Intronic
1015402007 6:132797903-132797925 TTTAATTTATAAATGGCTGATGG - Intronic
1015752912 6:136578868-136578890 TTTAATTTAAAAATATTTCAGGG + Intronic
1016111206 6:140226861-140226883 TTTGATTTGATAATCCATGATGG - Intergenic
1016444953 6:144121721-144121743 TCCAATTTAAAAATAGATAAAGG - Intergenic
1016564339 6:145436175-145436197 TTGGCCTTAAAAATAAATGAAGG - Intergenic
1016601064 6:145861262-145861284 TTTGATTTAAAAATGGGCAAAGG + Intergenic
1016636082 6:146292440-146292462 ATGCAATTAAAAATAGATGAAGG + Intronic
1016901933 6:149111605-149111627 TTTGATTTAAAATCAAATTATGG - Intergenic
1017022845 6:150154472-150154494 CTTGATTTGAAAAAAAATGAGGG + Intronic
1017578332 6:155831566-155831588 TTTGCTTTAAAAAAATTTGAAGG + Intergenic
1017773181 6:157659115-157659137 TTTATTATGAAAATAGATGAGGG + Intronic
1017871767 6:158492931-158492953 TTTGATTTAAATATTGCAGATGG + Intronic
1019835380 7:3378079-3378101 GTTGATTTAAAAATAGAGTTTGG - Intronic
1020305603 7:6831785-6831807 TATGATTTAAAAATAATTTAAGG + Intergenic
1020408237 7:7861415-7861437 TTATATTTCAAAATAGAAGATGG - Intronic
1020743496 7:12052091-12052113 TTTGTTTAAAAAATAGTTAAAGG - Intergenic
1021208965 7:17820897-17820919 TTTAATTTAAAAATAGGACAGGG + Intronic
1021332153 7:19351751-19351773 TTTGTTTTAAAAATAGAGATGGG - Intergenic
1021951213 7:25776796-25776818 TAAGATTTAAAAAAAAATGAAGG - Intergenic
1022012405 7:26320276-26320298 TGTGATTTAAAAATATAGGCCGG - Intronic
1022257838 7:28677092-28677114 TTTTATCTTAAAATAGAAGAGGG + Intronic
1022465658 7:30651881-30651903 GGTGTTTTTAAAATAGATGAGGG + Intergenic
1022553671 7:31269499-31269521 CTAGATTAAAAAGTAGATGAAGG - Intergenic
1022796939 7:33739392-33739414 TTTGATGTGAAAATAGAGGGAGG + Intergenic
1023122887 7:36926920-36926942 TTTGCTTTAAAAATAAGTTACGG - Intronic
1023201505 7:37702384-37702406 CTTGATTAAAAAAGAAATGAAGG - Intronic
1023383041 7:39627289-39627311 TTTGATTTAATTATACGTGAAGG + Intronic
1024492868 7:50005923-50005945 TTAGATTTAAAAATACATACAGG + Intronic
1024820259 7:53320604-53320626 TTTAATATAAAAATAAATCATGG - Intergenic
1024963543 7:55003154-55003176 TTCTATTAAAAAATAGATGGAGG - Intergenic
1025276879 7:57590035-57590057 TTTGTTTTAAAAATACACAAAGG - Intergenic
1025928367 7:65976630-65976652 TTTAATTTAAAAAAAGATTTTGG + Intronic
1026370876 7:69697727-69697749 TGTAATTTAAAAATGGAGGAAGG - Intronic
1026591008 7:71695499-71695521 GTTGATTTAAAAATATATATGGG - Intronic
1027052110 7:75027125-75027147 CTTGAATTAAAAATATATGGTGG - Intronic
1027260075 7:76458583-76458605 TTTGGTTTAACAATAGATCTAGG + Intergenic
1027311450 7:76956687-76956709 TTTGGTTTAACAATAGATCTAGG + Intergenic
1027565227 7:79783483-79783505 CTCTATTTAAAAATAGATAAAGG - Intergenic
1027585990 7:80059148-80059170 TTTGATTAATCAATAGATGTAGG - Intergenic
1027850550 7:83445913-83445935 TTTGAGTTAGAAAAAGGTGAAGG + Intronic
1028221172 7:88198755-88198777 TTTCATGTAAAAATAGGTGAGGG - Intronic
1028894732 7:96028464-96028486 GTTGAGTGAAAAGTAGATGAAGG + Intronic
1028949229 7:96615580-96615602 TTTAAATAAAAAATTGATGATGG - Intronic
1029005871 7:97208694-97208716 TCTGATTTAAAAATAGGTAAGGG - Intergenic
1029064057 7:97830522-97830544 TTTGATTTAGCAATAGACAATGG - Intergenic
1029245718 7:99199893-99199915 TTTGACTTAAAAATGGACAAAGG + Intronic
1030461854 7:109848212-109848234 TTTTCTTTAGAAATATATGAGGG + Intergenic
1030569160 7:111200544-111200566 TTACATTTAAAAATTGAGGAAGG + Intronic
1030912479 7:115268517-115268539 TTATATTTAAAAACAGATGAAGG + Intergenic
1031254146 7:119427444-119427466 TCTGATATAAATATAGCTGAGGG + Intergenic
1031272676 7:119672423-119672445 TTAGCTTTGAAAATAGAAGAAGG + Intergenic
1031523069 7:122790094-122790116 TGTGAATTAAAAATAGAAAAAGG + Intronic
1031786242 7:126037180-126037202 ATTCTTTTAAAAATACATGAAGG - Intergenic
1032006772 7:128308626-128308648 TTTGGTTTAGAAATGGATGAAGG - Exonic
1032331202 7:130982066-130982088 TCTCATTAAAAAATACATGAAGG + Intergenic
1032370537 7:131346151-131346173 TTCACTTAAAAAATAGATGATGG + Intronic
1032632590 7:133669863-133669885 TTTGATATAAAAATATAATAAGG - Intronic
1032868939 7:135959594-135959616 TCTGGATTAAAAATAGTTGATGG - Intronic
1033433116 7:141307268-141307290 TTTGTTTTAAAAATGGAAAATGG + Intronic
1033434211 7:141317997-141318019 TTTGGCTTAAAAAAAGAAGATGG + Intronic
1034061050 7:148090425-148090447 CTTGATTTAAAAATGGACAAAGG + Intronic
1034302675 7:150030267-150030289 TTTAAATTTAAAATAGATGAAGG + Intergenic
1034373027 7:150616832-150616854 TATTATTAAAACATAGATGACGG - Intergenic
1034673442 7:152874118-152874140 GGTGATTAAAAACTAGATGACGG - Intergenic
1034803386 7:154067031-154067053 TTTAAATTTAAAATAGATGAAGG - Intronic
1035094065 7:156339125-156339147 TATGATTTAAAAAGGGAAGAAGG + Intergenic
1035543728 8:462414-462436 TTTAATTTAATAATACATTATGG + Intronic
1035854607 8:2961223-2961245 TGTGATTTAAAAAGAAAAGAGGG + Intronic
1035939798 8:3886348-3886370 TTTGTTTAAAAAATATATAATGG - Intronic
1035996529 8:4553477-4553499 TTTTATTCAAAAATAAAGGAGGG + Intronic
1036028153 8:4934000-4934022 TTTTTTTTAAAAAAAAATGAAGG + Intronic
1036074586 8:5481448-5481470 TTTGATATAAAAATAAATAAAGG + Intergenic
1036118794 8:5991544-5991566 CCTCATTTCAAAATAGATGAAGG + Intergenic
1036168340 8:6458548-6458570 TTTGATAGCAATATAGATGAAGG + Intronic
1036521035 8:9491864-9491886 TTTGATTTTGAAAAAGAGGATGG - Intergenic
1037239660 8:16762146-16762168 TTAGATTTAAAAGGAAATGATGG - Intergenic
1037372623 8:18196007-18196029 TTTGTCTTATAAATAGATGGTGG + Intronic
1037780980 8:21868924-21868946 TTAGATTTACTAATAGAAGAGGG + Intergenic
1037935333 8:22911666-22911688 TTGGATTTTAAAATAGCTGCCGG - Intronic
1038052016 8:23822840-23822862 TTTGAATTGAAGATAAATGAGGG + Intergenic
1038344711 8:26721615-26721637 TTCCATTTAATAATAGATGAAGG - Intergenic
1038759924 8:30376750-30376772 CTAGATTTAAAAAGAGACGATGG - Intergenic
1039387584 8:37149759-37149781 TTTGAAATAAAAATATAAGATGG + Intergenic
1040350938 8:46567031-46567053 TTTGATTTAGCAATAGACAATGG - Intergenic
1041114679 8:54523885-54523907 TTTGTTTTAAAAATAGATCTAGG + Intergenic
1041139684 8:54803766-54803788 TTTAATTTAAAAATAAACAATGG + Intergenic
1041321290 8:56616050-56616072 TTTGTTTAAAAAATTGGTGAAGG + Intergenic
1041982232 8:63875622-63875644 TCTGATTTAAAAATAGTCAAAGG - Intergenic
1042277146 8:67017744-67017766 TTTGATTTATAAAGAAATTATGG - Exonic
1042323014 8:67497954-67497976 TTAAATTTAAAAATAGAGGATGG - Intronic
1042345543 8:67723337-67723359 TTTTATTTAAATAGAGACGAGGG + Intronic
1042467635 8:69146317-69146339 TTTCATTTTAAAATAAGTGATGG - Intergenic
1042688755 8:71472450-71472472 TTTGAATTAAAAATAGGTCAAGG + Intronic
1042870636 8:73395374-73395396 TTTGATGTGAATATAAATGAAGG + Intergenic
1043075705 8:75696101-75696123 TTTGAATTAAATATAGATTTGGG + Intergenic
1043079899 8:75753861-75753883 TTTGATCCACAAATAGATCATGG - Intergenic
1043470042 8:80553225-80553247 TTTTACTTACAAATTGATGATGG - Intergenic
1043580463 8:81706438-81706460 TTTATGTTAAAAAAAGATGATGG + Intronic
1044097229 8:88081455-88081477 ATTGAAATAAAAATTGATGATGG + Intronic
1044103438 8:88170837-88170859 TCTGATGGAAAAATGGATGATGG + Intronic
1044179825 8:89177912-89177934 TCTTAATTAAAAATAGTTGAAGG - Intergenic
1044266506 8:90188369-90188391 TTTGATTTAAATGTAGAAGCAGG + Intergenic
1044350245 8:91156395-91156417 TTTGATTTAAAAATTGGTGAAGG - Intronic
1044376167 8:91473682-91473704 TTTAATTTAAAAATAAATTTTGG + Intergenic
1044488691 8:92785977-92785999 TTTAATTTTACAATAGATGAAGG + Intergenic
1045147010 8:99356921-99356943 ATAGATTTCAAAATAGATAAAGG - Intronic
1045431049 8:102115322-102115344 TTTGACTTTAAAAGAGAGGAAGG - Intronic
1046237034 8:111437938-111437960 TTTGCTTTAAAGATGGAAGACGG - Intergenic
1046239936 8:111477146-111477168 TTTCATTTAAACATAGAGGCTGG + Intergenic
1046303891 8:112336208-112336230 CTTTATTTAAAAATATATTAAGG - Intronic
1046389298 8:113547260-113547282 TTTTCTTTTAAAATAGATGCTGG + Intergenic
1046731648 8:117732556-117732578 TGTTATTTAAAAATAAATAAAGG - Intergenic
1046831075 8:118747071-118747093 TTTTATTTAAAAGTACATTAAGG + Intergenic
1046922955 8:119753311-119753333 TTTGATTTAAAAAAATTTAATGG - Intronic
1047114492 8:121825454-121825476 TTGTATTTAAAAAGAGCTGATGG - Intergenic
1047479538 8:125268054-125268076 TTTTTTTTAAATAGAGATGAGGG - Intronic
1047612967 8:126539067-126539089 ATTAATTTAAAAATAGATGCAGG + Intergenic
1047649183 8:126901201-126901223 TTTCCTTTAAAAAAAGATGGAGG + Intergenic
1048278533 8:133087245-133087267 TTTGCTTTAAAAATTGCAGAGGG + Intronic
1049020951 8:139957383-139957405 TTTCTTTTTAAAATAAATGAAGG + Intronic
1050207674 9:3214199-3214221 CTTGATTTAAACAAAGATAACGG - Intergenic
1050467831 9:5949900-5949922 TTTGATTACAAAACAGATAAAGG + Intronic
1050941459 9:11464489-11464511 ACTGATTTAAAAATAGACAAAGG - Intergenic
1050970627 9:11868218-11868240 TTTGCGATAAAAATAGAGGACGG + Intergenic
1051033364 9:12711489-12711511 TTAGATTTAAAAATACATATAGG + Intergenic
1051073112 9:13197308-13197330 TTTGTTTTTAAATTAGATGGGGG + Intronic
1051307565 9:15730081-15730103 TTTATTTTAAAAATAAATAAAGG - Intronic
1051320687 9:15901997-15902019 TTTTCTTTCAAAAAAGATGAGGG + Intronic
1051417623 9:16859018-16859040 CCTGATTTAAAAATAGGTGAAGG + Intronic
1051771785 9:20586934-20586956 TTTGTTTTAAAAACAGATTGAGG - Intronic
1051935992 9:22442998-22443020 TTTAAATCAGAAATAGATGAGGG + Intergenic
1051977673 9:22972143-22972165 TGTGATTTAAAAATTGATCCTGG + Intergenic
1052175038 9:25450771-25450793 ATTTATTGAAAAATAGTTGATGG - Intergenic
1052275710 9:26674038-26674060 TTTTATTTAAAAATAAGTGAGGG - Intergenic
1052291541 9:26847091-26847113 TTTGACTTAAAAATATATCTTGG + Intronic
1052430170 9:28356048-28356070 ATTGATCTAGAAATAGATTATGG + Intronic
1052715179 9:32107527-32107549 TGTGATTAAAAAATAAATTAAGG - Intergenic
1052783968 9:32811691-32811713 CTTGATTTAAAAATAGTTTTAGG - Intergenic
1052815061 9:33096252-33096274 TTTGATTTCAAAATTCATTAAGG + Intergenic
1052885635 9:33645348-33645370 TTTGCTTTAATTATAGATGAGGG + Intergenic
1052895902 9:33748235-33748257 TTTGTTTTAGAAATCGTTGATGG - Intergenic
1054820119 9:69513949-69513971 TTTCATTTAAAAATGGATCTTGG - Intronic
1054988935 9:71298577-71298599 TTTTTTTAAAAAGTAGATGATGG - Intronic
1055140513 9:72871843-72871865 TTTAGTTTCAGAATAGATGAAGG + Intergenic
1055218598 9:73898903-73898925 CTTGATTTTAATATAGGTGAAGG - Intergenic
1055254714 9:74355209-74355231 TTTCCTATAAAAATAAATGATGG - Intergenic
1055457516 9:76486901-76486923 TTTGTTTTAAGTAGAGATGAGGG - Intronic
1055857498 9:80707893-80707915 TATGATTTTAAAATAGACAAGGG - Intergenic
1056231528 9:84550476-84550498 TTTTATTTAAACAAAGAAGAGGG + Intergenic
1056730956 9:89166385-89166407 ATTGATTTAAAAATTGATGAAGG + Intronic
1057375329 9:94516555-94516577 TGTAATTTAAAAACAGGTGAAGG + Intergenic
1058252840 9:102723194-102723216 TCTGATTTAAAAATGGGTGAAGG + Intergenic
1058302560 9:103394227-103394249 TTTGATTTTCCAATACATGAGGG + Intergenic
1058787685 9:108406322-108406344 TTTGATTTACAATTAGTTAAAGG - Intergenic
1058840836 9:108907291-108907313 TTTCATTTAAAAAAAATTGATGG - Intronic
1059327838 9:113515008-113515030 TTTTATTTGAAAATAACTGAGGG + Intronic
1059845365 9:118269657-118269679 TCTGACTTAAACACAGATGAGGG - Intergenic
1059864001 9:118493688-118493710 TCTGATTAAAAAATAGACAAAGG - Intergenic
1059921285 9:119163086-119163108 ATTAATTTAAAAGTAGATAAAGG - Intronic
1060293719 9:122328858-122328880 TTTTTTTTAATAAGAGATGAGGG + Intergenic
1060337989 9:122744819-122744841 TTTCACTTCCAAATAGATGATGG - Intergenic
1060909368 9:127337050-127337072 TGTGACATAAAAATAGAGGATGG + Intronic
1061036510 9:128117353-128117375 TTTGTTTAAAAAATAGAGGCCGG - Intergenic
1062420521 9:136479142-136479164 TTTTATTTAAAAACTGATGGAGG - Intronic
1202630276 M:10870-10892 TTTGGTTAAAAAATAGTAGAGGG - Intergenic
1185551822 X:988114-988136 TATGATTTAAAAAAAGATCATGG + Intergenic
1185831478 X:3307145-3307167 GTAGATAGAAAAATAGATGATGG - Intergenic
1186079036 X:5910589-5910611 TTTGTTTTAAAAGTAGAAGCCGG - Intronic
1186943959 X:14543969-14543991 TTTGCCATGAAAATAGATGATGG + Intronic
1187055270 X:15736674-15736696 GTAGATTTAAAAATAGGGGAAGG - Intronic
1187537968 X:20161147-20161169 TCTGAATTAAAAATAGAACATGG + Intronic
1187595258 X:20764659-20764681 TTTGATTTAAAAATCATTCATGG - Intergenic
1188131681 X:26442376-26442398 TTTCCTTTTAAAATAGAAGAAGG - Intergenic
1188317153 X:28688981-28689003 TTTAATTTAAAAATGAATCATGG - Intronic
1188610079 X:32084591-32084613 TCTGCTTTATAGATAGATGATGG + Intronic
1188962088 X:36504732-36504754 TATGGTTTAAAAATATCTGATGG + Intergenic
1189458177 X:41212535-41212557 TTTGACTTGAAAATTGATTAAGG + Intronic
1189512110 X:41673289-41673311 TTATGTTTAAAAAGAGATGAGGG + Intronic
1190238918 X:48641504-48641526 ATTTATTTAAAAATAAATGTAGG - Intergenic
1191007474 X:55725626-55725648 TTTGAAGTAAGAATACATGATGG + Intronic
1191126560 X:56961677-56961699 TTTCTTTTAAAAGTAGGTGATGG + Intergenic
1192110804 X:68362041-68362063 CCTGATTTAAAAATAGACAAAGG - Intronic
1192904327 X:75534219-75534241 TTTGATTTGAAGATAGATGTTGG - Intergenic
1193136889 X:77982121-77982143 GTTGATTCAAAAATATATTATGG + Intronic
1193233829 X:79082007-79082029 TTTGATTTAAAATTCCATTAAGG - Intergenic
1194242916 X:91473865-91473887 TTTGATTTAAAAATAGGCAAAGG + Intergenic
1194726791 X:97408368-97408390 TTTAAATTAAAAAAAGAAGATGG - Intronic
1194956324 X:100185106-100185128 GTTTCCTTAAAAATAGATGAAGG - Intergenic
1194969405 X:100326424-100326446 TTTCATTAAAAAATAAATGAGGG - Intronic
1195339064 X:103887309-103887331 TTTGAATTAAAAACAGAAAATGG + Intergenic
1195529476 X:105936211-105936233 TTTAAATTAAAAATAGAAAAGGG + Intronic
1195609998 X:106855512-106855534 TTTCATTCAGAAATAGATCATGG + Intronic
1196081102 X:111632044-111632066 TTTGACTTATTAATAAATGAGGG - Intergenic
1196506908 X:116457359-116457381 TTGGATTTATAAATATATGATGG + Intronic
1196535481 X:116838600-116838622 TTTGGTTTAAAGAGAGAAGATGG - Intergenic
1196544946 X:116951304-116951326 TTTGTTTCAAAAGTAGGTGATGG + Intergenic
1196662695 X:118284314-118284336 TTTTATTTAAAAATAACTCAAGG + Intergenic
1196998481 X:121410767-121410789 ATTGATATAAAAATAGATAATGG - Intergenic
1197160308 X:123315523-123315545 TTTCATTTAAAAATAATTCATGG - Intronic
1197605977 X:128585920-128585942 TTACATTTAAAACTAGATGATGG + Intergenic
1197867203 X:131031760-131031782 TTTGATTTAACAATATATCATGG - Intergenic
1197907091 X:131437064-131437086 TTTTATTAAACAATAGATAATGG + Intergenic
1198183212 X:134230214-134230236 TTCGATTTAAAAACAACTGAAGG - Intergenic
1198852457 X:140979734-140979756 TCTGCTTTAAAAATACCTGAAGG + Intergenic
1199184656 X:144901199-144901221 TTTGATTTAAAAACACATATGGG + Intergenic
1199250138 X:145652022-145652044 TTTGAGTTAAAAAAAAATTAAGG - Intergenic
1199275113 X:145931998-145932020 ATTGACTTAATAATTGATGAGGG + Intergenic
1199394288 X:147316452-147316474 TATTATTTAAAAATAGAGGCTGG - Intergenic
1199885784 X:152020780-152020802 TTTGTTTTACAAAAAGATGGAGG + Intergenic
1200693859 Y:6338729-6338751 TTTGTTTGAAATACAGATGATGG + Intergenic
1200987369 Y:9317085-9317107 TTTGTTTGAAATACAGATGATGG - Intergenic
1201041418 Y:9835990-9836012 TTTGTTTGAAATACAGATGATGG - Intergenic
1201059046 Y:10026655-10026677 TTTGTTTGAAATACAGATGATGG - Intergenic
1201059153 Y:10028480-10028502 CTTGTTTGAAATATAGATGATGG - Intergenic
1201315145 Y:12637389-12637411 TGTAATTTAAAAATGGATGAAGG - Intergenic
1201398782 Y:13579827-13579849 TTAGAATGAAAAATAGGTGATGG - Intergenic
1201917671 Y:19199722-19199744 TATGATAAATAAATAGATGATGG - Intergenic
1202036076 Y:20637426-20637448 TTTTATTTATGAATAGATGCTGG + Intergenic
1202112290 Y:21434837-21434859 TTTGTTTGAAATACAGATGATGG - Intergenic
1202118220 Y:21495594-21495616 TTTGTTTGAAATACAGATGATGG + Intergenic
1202120671 Y:21519134-21519156 TTTGTTTGAAATACAGATGATGG + Exonic
1202123122 Y:21542675-21542697 TTTGTTTGAAATACAGATGATGG + Exonic
1202155883 Y:21886706-21886728 TTTGTTTGAAATACAGATGATGG - Exonic
1202158331 Y:21910247-21910269 TTTGTTTGAAATACAGATGATGG - Exonic
1202160629 Y:21931659-21931681 TTTGTTTGAAATACAGATGATGG - Intergenic
1202184786 Y:22175172-22175194 TTTGTTTGAAATACAGATGATGG - Exonic
1202206574 Y:22411229-22411251 TTTGTTTGAAATACAGATGATGG + Exonic
1202230727 Y:22654716-22654738 TTTGTTTGAAATACAGATGATGG + Intergenic
1202233009 Y:22674845-22674867 TTTTATTTACACATATATGAAGG - Intergenic
1202310147 Y:23521313-23521335 TTTTATTTACACATATATGAAGG + Intergenic
1202312431 Y:23541449-23541471 TTTGTTTGAAATACAGATGATGG - Intergenic
1202558372 Y:26129145-26129167 TTTGTTTGAAATACAGATGATGG + Intergenic
1202560654 Y:26149280-26149302 TTTTATTTACACATATATGAAGG - Intergenic