ID: 1077574996

View in Genome Browser
Species Human (GRCh38)
Location 11:3376198-3376220
Sequence CAGACTGCTCACAGCAACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 237}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077574996_1077575010 25 Left 1077574996 11:3376198-3376220 CCATGGTTGCTGTGAGCAGTCTG 0: 1
1: 1
2: 0
3: 17
4: 237
Right 1077575010 11:3376246-3376268 GGAAGCACTAGCTAGGCCAGGGG 0: 1
1: 0
2: 0
3: 6
4: 130
1077574996_1077575009 24 Left 1077574996 11:3376198-3376220 CCATGGTTGCTGTGAGCAGTCTG 0: 1
1: 1
2: 0
3: 17
4: 237
Right 1077575009 11:3376245-3376267 GGGAAGCACTAGCTAGGCCAGGG 0: 1
1: 0
2: 1
3: 5
4: 119
1077574996_1077575006 18 Left 1077574996 11:3376198-3376220 CCATGGTTGCTGTGAGCAGTCTG 0: 1
1: 1
2: 0
3: 17
4: 237
Right 1077575006 11:3376239-3376261 CTCCTTGGGAAGCACTAGCTAGG 0: 1
1: 0
2: 1
3: 11
4: 132
1077574996_1077575008 23 Left 1077574996 11:3376198-3376220 CCATGGTTGCTGTGAGCAGTCTG 0: 1
1: 1
2: 0
3: 17
4: 237
Right 1077575008 11:3376244-3376266 TGGGAAGCACTAGCTAGGCCAGG 0: 1
1: 0
2: 1
3: 16
4: 176
1077574996_1077575000 -8 Left 1077574996 11:3376198-3376220 CCATGGTTGCTGTGAGCAGTCTG 0: 1
1: 1
2: 0
3: 17
4: 237
Right 1077575000 11:3376213-3376235 GCAGTCTGGCGCACCCGCAGGGG 0: 1
1: 0
2: 0
3: 3
4: 58
1077574996_1077575002 3 Left 1077574996 11:3376198-3376220 CCATGGTTGCTGTGAGCAGTCTG 0: 1
1: 1
2: 0
3: 17
4: 237
Right 1077575002 11:3376224-3376246 CACCCGCAGGGGAGGCTCCTTGG 0: 1
1: 0
2: 1
3: 21
4: 168
1077574996_1077575003 4 Left 1077574996 11:3376198-3376220 CCATGGTTGCTGTGAGCAGTCTG 0: 1
1: 1
2: 0
3: 17
4: 237
Right 1077575003 11:3376225-3376247 ACCCGCAGGGGAGGCTCCTTGGG 0: 1
1: 0
2: 1
3: 16
4: 106
1077574996_1077574999 -9 Left 1077574996 11:3376198-3376220 CCATGGTTGCTGTGAGCAGTCTG 0: 1
1: 1
2: 0
3: 17
4: 237
Right 1077574999 11:3376212-3376234 AGCAGTCTGGCGCACCCGCAGGG 0: 1
1: 0
2: 0
3: 4
4: 45
1077574996_1077574998 -10 Left 1077574996 11:3376198-3376220 CCATGGTTGCTGTGAGCAGTCTG 0: 1
1: 1
2: 0
3: 17
4: 237
Right 1077574998 11:3376211-3376233 GAGCAGTCTGGCGCACCCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 62
1077574996_1077575001 -5 Left 1077574996 11:3376198-3376220 CCATGGTTGCTGTGAGCAGTCTG 0: 1
1: 1
2: 0
3: 17
4: 237
Right 1077575001 11:3376216-3376238 GTCTGGCGCACCCGCAGGGGAGG 0: 1
1: 0
2: 1
3: 4
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077574996 Original CRISPR CAGACTGCTCACAGCAACCA TGG (reversed) Intronic
902849710 1:19144744-19144766 CAGAGAGCTCGCAGCAGCCAGGG - Intronic
903642007 1:24866717-24866739 GACACTGATCACAGCAACAACGG + Intergenic
903950843 1:26994928-26994950 AAGACTGCTCACAGCTCCGAGGG - Intronic
904447430 1:30586582-30586604 CATAATCCTCACAGCAACCCTGG - Intergenic
905878558 1:41448933-41448955 CATTCTGCTTACAGCAGCCAGGG - Intergenic
907562890 1:55407081-55407103 GAGACTGCTCACTGCTCCCAGGG + Intergenic
908531888 1:65041602-65041624 CAGACATTTCACAGGAACCATGG + Intergenic
909145164 1:71920812-71920834 TAGACAGCTCACAGCTCCCAGGG + Intronic
912135008 1:106650270-106650292 CAGTCTGTTCAAAGCAACCTAGG + Intergenic
912924679 1:113903768-113903790 CAAACTTATCACAGCACCCAAGG - Intronic
913683186 1:121206529-121206551 CAGGCAACTCAGAGCAACCAGGG - Intronic
913689585 1:121266556-121266578 CACACTGCTAACCGCAATCATGG - Intronic
914035027 1:143994154-143994176 CAGGCAACTCAGAGCAACCAGGG - Intergenic
914148013 1:145013716-145013738 CACACTGCTAACCGCAATCATGG + Intronic
914154426 1:145073817-145073839 CAGGCAACTCAGAGCAACCAGGG + Intronic
914828466 1:151153292-151153314 CACACTGCTCACTGCAGCCTTGG - Intergenic
915860076 1:159434750-159434772 TTGACTTCTCACAGCAACCCTGG - Intergenic
919451242 1:197775273-197775295 GAGGCTGCTCACAGCAGCCGTGG + Exonic
920190586 1:204191123-204191145 CAGGCTGCTCACAGCCAGGAAGG - Intronic
920470496 1:206225039-206225061 CAGGCAACTCAGAGCAACCAGGG - Intronic
920476908 1:206285030-206285052 CACACTGCTAACCGCAATCATGG - Intronic
920647220 1:207812511-207812533 CAGAAGGCCAACAGCAACCATGG + Intergenic
921410904 1:214835615-214835637 CAGACTCCTCAGAAGAACCATGG - Intergenic
923551133 1:234964564-234964586 CAGAATGCACACAGCAATAATGG + Intergenic
924955900 1:248926377-248926399 GACACTGCCCACAGAAACCAAGG - Intergenic
1064018276 10:11789587-11789609 CATCCTGCTCACATCATCCAAGG - Intergenic
1067046340 10:42987364-42987386 CAGACCCCTCACAGGGACCAAGG - Intergenic
1069716300 10:70523434-70523456 CAGACCCCTCCCAGCAACCTGGG - Intronic
1069918580 10:71802360-71802382 CAGGCAGCTCCCAGCAGCCAGGG + Intronic
1071707282 10:88012697-88012719 CAGACTGCTAGCAGCAATCCTGG + Intergenic
1072619712 10:97071713-97071735 CAGTCAGCTCACAGCGCCCACGG + Intronic
1073184794 10:101609430-101609452 AAGACAGCCCACAGCAACGATGG + Exonic
1075270412 10:121044617-121044639 CTCACTGCTCACTGCAACCTCGG + Intergenic
1075671863 10:124268498-124268520 CAGACTCCTCGGAGCAACCTTGG - Intergenic
1076478175 10:130767030-130767052 CACACTGCTTTCAGAAACCAGGG - Intergenic
1077555887 11:3225854-3225876 GAGCCTGCTCTCAGCATCCAGGG - Intergenic
1077574996 11:3376198-3376220 CAGACTGCTCACAGCAACCATGG - Intronic
1078853877 11:15190598-15190620 CATGCTCCTAACAGCAACCATGG - Intronic
1080399149 11:31917974-31917996 CAGACTTCTGACAGTAAGCAAGG + Intronic
1081909880 11:46694090-46694112 CAGCCTCCTCTCAGCAATCAGGG + Intronic
1084177717 11:67432087-67432109 AAGACTGCTCACAGCCTGCAGGG - Intronic
1084560798 11:69904614-69904636 GAGTCTGCTCTCAGCATCCAAGG + Intergenic
1086462104 11:87016355-87016377 CTGACTGCTCTCAGAAATCAGGG - Intergenic
1087253855 11:95933918-95933940 CAGGCTGCCCACAGACACCAAGG - Intergenic
1087832999 11:102840137-102840159 CAGAGTGCTGACAGCATCAAAGG + Exonic
1088446685 11:109937973-109937995 CAGTCTGCTCTCAGTCACCAAGG + Intergenic
1093705643 12:22272376-22272398 CAAACTGCCCACACCAACCAAGG + Intronic
1095194616 12:39298388-39298410 CAGACAGCAAACAGCTACCAGGG + Intronic
1097056508 12:56253220-56253242 CAGACTGCTCACATCAACCATGG - Intronic
1100076031 12:90785058-90785080 CAGACAGCTAACAAGAACCAGGG + Intergenic
1100354343 12:93814979-93815001 CAGATTGCTACCAGCACCCAAGG - Intronic
1103703153 12:122858376-122858398 CAGGGTGCTCACGGCATCCAAGG - Exonic
1106469684 13:30043327-30043349 CAGTCTGCTCACAAAAACAAGGG - Intergenic
1106477499 13:30111020-30111042 CAGACTGCTCACAGGGAGCTTGG + Intergenic
1107274663 13:38664896-38664918 AAGACTGATCCCAGGAACCAAGG + Intergenic
1108283229 13:48880050-48880072 CAGTCTTCTCACAGCATCCTGGG - Intergenic
1111474316 13:88725445-88725467 CACAATGCCCACAGCACCCAGGG - Intergenic
1113143048 13:107175817-107175839 AAGACTGCTAACTTCAACCAAGG - Intronic
1113988838 13:114342220-114342242 GACACTGCCCACAGAAACCAAGG - Intergenic
1116559888 14:46364395-46364417 CAGAGTGCTCAGACCAACCCTGG + Intergenic
1119906532 14:78308580-78308602 CAGACAGCTCATTGCAAACAAGG - Intronic
1123129726 14:105975113-105975135 CAGAGGGCGCCCAGCAACCAAGG + Intergenic
1123579915 15:21705647-21705669 CAGAGGGCGCCCAGCAACCACGG + Intergenic
1123616563 15:22148269-22148291 CAGAGGGCGCCCAGCAACCACGG + Intergenic
1124013767 15:25860095-25860117 CAGACAGCACAGAGCAGCCAAGG - Intronic
1124581355 15:30958027-30958049 CAGCCTGCTCTCAGAAACCGGGG - Intronic
1124854515 15:33374497-33374519 CAGACTGTTCAAAGCAAAGAAGG - Intronic
1125793899 15:42390164-42390186 CAGACTCCCCTCAGCAGCCAGGG + Intronic
1129527986 15:76234686-76234708 CAGACTGCTATCAGCCACCTGGG - Intronic
1130011707 15:80157507-80157529 CAGACTGCTCAGAACATGCAAGG - Intronic
1130087667 15:80791650-80791672 GAGACTGCATACAGCAAACAGGG - Intronic
1202988785 15_KI270727v1_random:439892-439914 CAGAGGGCGCCCAGCAACCACGG + Intergenic
1132520282 16:384103-384125 CGGACTGCACCCAGCAACCAAGG + Intronic
1132999272 16:2840986-2841008 GAGCCTCCTCACAGCCACCAAGG + Intergenic
1133810846 16:9160019-9160041 CAGACTCCTTGCAGCACCCAGGG + Intergenic
1136316564 16:29457919-29457941 GTGACTTCTCACAGCTACCAAGG - Exonic
1136431140 16:30197261-30197283 GTGACTTCTCACAGCTACCAAGG - Exonic
1136673292 16:31876892-31876914 CAGCCTGCTCACCCCATCCATGG + Intronic
1138209984 16:55155397-55155419 CAGACTATTCCCAGCATCCATGG - Intergenic
1139447232 16:67005372-67005394 CAGACTGCTCACTACCACCGAGG + Exonic
1139696168 16:68676544-68676566 CACAATGGCCACAGCAACCAAGG - Intronic
1140076760 16:71707314-71707336 GAGTCTCCTCACAGGAACCAGGG - Intronic
1140267053 16:73429785-73429807 CAGGCTGCTCACAGCTCCCTGGG + Intergenic
1141880133 16:86852596-86852618 CAGACTGCTAACACCAACATGGG + Intergenic
1143513074 17:7406397-7406419 CAGACTGGGCTCAGCTACCATGG - Intronic
1144848564 17:18232685-18232707 CAGACTGCTGTCATCAAGCAGGG - Exonic
1145259055 17:21343912-21343934 GAGACTGCACACAGCAGCCTGGG - Intergenic
1145317563 17:21744091-21744113 GAGACTGCACACAGCAGCCTGGG + Intergenic
1147359078 17:39920163-39920185 CAGGCTGGTGAAAGCAACCAGGG + Intergenic
1151534440 17:74730686-74730708 CAGTCTGCTCTCAGCAGCCAGGG + Intronic
1152408934 17:80112315-80112337 CAGACTCCTGTCAGCATCCAGGG - Intergenic
1155215516 18:23640195-23640217 GAGAGTGCTGACAGCCACCAGGG + Intronic
1155440009 18:25852225-25852247 CCCACTACTCACAGCAGCCAAGG + Intergenic
1156600806 18:38603833-38603855 CAGTCTGCTCACAGCAAGAATGG - Intergenic
1157048410 18:44130828-44130850 CAGATTTCTGACAGCCACCATGG + Intergenic
1157299214 18:46467640-46467662 CAGGCTGGGCACAGCAATCAGGG + Intergenic
1157441655 18:47716373-47716395 CTTACTGCTCACAGTAACCCAGG + Intergenic
1158041019 18:53093759-53093781 CAGGCTACTCCCAGCAGCCAAGG - Intronic
1158097941 18:53796091-53796113 CAGGCTGCACACAGGATCCAAGG + Intergenic
1158551327 18:58438542-58438564 CTGACTGCTCACATCAGACAAGG - Intergenic
1160227120 18:77019997-77020019 CAGTCTGTTCACAGCCATCAAGG - Intronic
1160523673 18:79523051-79523073 CAGTCTGTTCACAGGGACCACGG - Intronic
1160887318 19:1355843-1355865 CAGACCGTTCACAGCATCAATGG - Intronic
1162219378 19:9163295-9163317 CAGAAAGCTCACAGCGACCCTGG + Exonic
1163884536 19:19954162-19954184 CAGCCTGCTCACCCCAGCCATGG - Intergenic
1163908672 19:20169469-20169491 CAGCCTGCTCACCCCACCCATGG + Intronic
1163957729 19:20659903-20659925 AAGACTGCTCACCCCAGCCACGG - Intronic
1163983839 19:20926648-20926670 CAGCCTGCTCACCCCAGCCATGG + Intronic
1163999662 19:21085694-21085716 CAGTCTGCTCACCCCAGCCATGG + Intronic
1164030644 19:21400644-21400666 CAGCCTGCTCACTCCAGCCATGG + Intronic
1164070537 19:21764093-21764115 CAGCCTTCTCACTGCAGCCATGG - Intronic
1164095529 19:22006596-22006618 CAGCCTGCTTACCGCAGCCATGG - Intronic
1164114998 19:22211281-22211303 CAGCCTGCTTACCGCAGCCATGG - Intergenic
1164123617 19:22290194-22290216 CAGCCTGCTCACCCCAGCCATGG + Intronic
1164272147 19:23682583-23682605 CAGCCTGCTCACCCCAGCCATGG - Intronic
1164309621 19:24034287-24034309 CAGCCTGCTCACAATAGCCATGG + Intronic
1164839314 19:31380629-31380651 CAGCCTCCTCTCAGCAACCACGG - Intergenic
1164871237 19:31645576-31645598 CAGACTGCTTCCTGCAACTATGG - Intergenic
1167152429 19:47717955-47717977 CCAAGTCCTCACAGCAACCATGG - Intronic
1167158823 19:47754964-47754986 CAGGCTGCCCGCAGCACCCAGGG - Intronic
1168277707 19:55286388-55286410 CAGACAGCACACAGACACCAAGG - Intronic
1168726703 19:58586810-58586832 GACACTGCCCACAGAAACCAAGG - Intergenic
925085199 2:1102309-1102331 CAGCCTCCTCACAACAGCCAGGG - Intronic
925296222 2:2779375-2779397 CACTCTGCACACAGCAGCCAGGG + Intergenic
926126085 2:10272727-10272749 CAGACTGGTGACTGAAACCACGG - Intergenic
926922773 2:17955728-17955750 CACTCTGCTCACAGACACCAGGG - Intronic
928299990 2:30116521-30116543 CACACTGCTCAAAGCAGCAAGGG - Intergenic
930694576 2:54398068-54398090 TAGAATGCTCACAGCTACCTTGG - Intergenic
931992010 2:67799877-67799899 CACACTGTTCCCAGCAAGCAGGG + Intergenic
932501182 2:72183927-72183949 GAGATTGCTGACAGCACCCAGGG + Intronic
933662543 2:84939512-84939534 GAGACTGTTCTCAGCAGCCACGG - Intergenic
933703579 2:85273549-85273571 GACACTGCTAACAGCAACCTGGG - Intronic
934527747 2:95062080-95062102 CAGACTGTTCTCAGCACCCCGGG - Intergenic
936062022 2:109301188-109301210 CAGCCTGCGCAGAGGAACCAGGG - Intronic
936506879 2:113115269-113115291 CAGTCTTCTCACGGCATCCAGGG + Intronic
936571851 2:113624394-113624416 GACACTGCCCACAGAAACCAAGG + Intergenic
937997625 2:127706885-127706907 CTGCCTGCTCCCAGCCACCAGGG + Intronic
938995473 2:136673378-136673400 CAGACTGCAGACAGGAGCCAAGG + Intergenic
940331150 2:152476145-152476167 CACACTGCTGACATCATCCAAGG - Intronic
944080519 2:195783118-195783140 CAGAAAACTCACATCAACCAAGG + Intronic
944900247 2:204206583-204206605 CAGACTGCTCTCTTCCACCATGG + Intergenic
945664330 2:212721933-212721955 CAGATTGATTACAGCAGCCATGG + Intergenic
945974083 2:216257516-216257538 CAAACTGCCCCCAGCACCCATGG + Intergenic
946101079 2:217324059-217324081 AAGACTTCTCACAGCAACAATGG - Intronic
946977563 2:225170151-225170173 CACATTGCTCACAGCCACTAAGG + Intergenic
948458097 2:238116609-238116631 CAGACCCCTCACAGCTGCCATGG - Intronic
948739255 2:240032228-240032250 CAGTCTGTCCACAGAAACCAGGG - Intergenic
948865005 2:240770778-240770800 CAGACCACCCACAGCAGCCAAGG - Intronic
1171379690 20:24724986-24725008 TAGACCCCTCACAGCAACAATGG - Intergenic
1172266722 20:33621850-33621872 CAGGCTGCTCAGAGCAGCCGAGG - Intronic
1172639140 20:36430614-36430636 CAGACAGCTCACTGCAGCCTTGG - Intronic
1172647118 20:36477517-36477539 CAGGCTCCTCAAAGCCACCAGGG - Intronic
1173757594 20:45531639-45531661 CAGACATCTGACTGCAACCATGG - Intergenic
1173892327 20:46522552-46522574 CACACTGCCCACAACATCCAAGG - Intergenic
1174417191 20:50375219-50375241 CACATAGCTCACAGCAGCCAAGG - Intergenic
1174876286 20:54229985-54230007 GAGACTGATAGCAGCAACCATGG + Intergenic
1175875210 20:62226315-62226337 CTCACTTCTCACAGCAGCCAGGG - Intergenic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1178592657 21:33924495-33924517 CAGACTTCCCATAGCAACCCAGG + Intergenic
1179519175 21:41931198-41931220 GAGCCTGCTCACAGCAGCCGTGG + Intronic
1179800146 21:43807938-43807960 CCGACTCCTCACAACAAACAGGG - Intergenic
1181077829 22:20393409-20393431 CAGAATGCTCACAGCAGTCCAGG - Intergenic
1181961623 22:26625853-26625875 CTCTCTGCTCACAGCAACCCTGG + Intronic
1183464412 22:37972555-37972577 CAGCCTGCCGACAGCAACCTGGG + Exonic
1183937727 22:41273171-41273193 TTGCCTGCTCACAGCAACCAGGG - Intronic
1184150620 22:42636281-42636303 CACACAGCTCAGAGCACCCAGGG + Intronic
1184567200 22:45299156-45299178 CAGCCTGCTCACAGCCAACAGGG + Intergenic
1185394397 22:50579321-50579343 CAGGCTGCCCACAGCCACCCGGG + Intronic
1185428344 22:50786493-50786515 GACACTGCCCACAGAAACCAAGG - Intergenic
949494470 3:4619106-4619128 CAGACATCTCACAGCAACCCTGG - Intronic
949497373 3:4645301-4645323 CAGACTTCTCACCGCAGCCTAGG - Intronic
950716118 3:14848835-14848857 CTGACTTCTCACACCAGCCAGGG - Intronic
950933422 3:16813757-16813779 CAGATAGCTCACAGCAACGATGG + Intronic
952413861 3:33073056-33073078 CAGGCAGGTCACAGCAACAATGG - Intronic
952990184 3:38824683-38824705 CAGACCTCTGACAGCATCCATGG - Intergenic
957452360 3:80395969-80395991 CAGACTGCTCTCAAAAACCTGGG - Intergenic
961176484 3:124839807-124839829 CAGACTGCTAAGAGACACCAGGG + Intronic
961529380 3:127531081-127531103 CAGATTTCTCACTGAAACCATGG + Intergenic
963718102 3:148827675-148827697 CAGACTTTACACAGCTACCAAGG + Exonic
965496831 3:169408918-169408940 CAGTCTCCTCACAGCTAGCATGG + Intronic
967046965 3:185746317-185746339 CTAACTGCTCACAGCGACCATGG + Intronic
967084933 3:186085968-186085990 CAGACTCCGCACTGCAGCCATGG + Intronic
968374426 4:27080-27102 GACACTGCCCACAGAAACCAAGG + Intergenic
968869940 4:3236662-3236684 CACCCTGCTCACAGGCACCACGG - Intronic
969575346 4:8033316-8033338 CACTCTGTTCACAGGAACCATGG + Intronic
969605539 4:8200452-8200474 CAGGGTGCTCACAGCATCCTCGG - Intronic
977034732 4:91935318-91935340 CAGGCTGCCCACAGACACCAAGG + Intergenic
984706485 4:182850869-182850891 CAGACTGCTCTCAGCAAAGGCGG - Intergenic
985460302 4:190099183-190099205 GACACTGCCCACAGAAACCAAGG - Intergenic
985468343 5:19609-19631 GACACTGCCCACAGAAACCAAGG + Intergenic
986386832 5:7242947-7242969 CAGGATGCTCACAGCAATCCAGG + Intergenic
989788443 5:45361246-45361268 CAGACTGGTCACTGCAACCTCGG + Intronic
990268357 5:54104991-54105013 CAGCCATCTCAGAGCAACCAAGG + Intronic
996434812 5:123422995-123423017 CGGACCGCTCACCGCAACCATGG - Exonic
998957890 5:147455241-147455263 CAGACTGGTCACATAATCCAAGG + Intronic
999121117 5:149210109-149210131 AAGACTCCTCTCAGCAATCATGG + Intronic
1001465180 5:171957833-171957855 CAGACAGCTCACTGAAACCTTGG + Intronic
1002439166 5:179255486-179255508 CAGTCTGCTCACAGGCACAAAGG - Intronic
1003360137 6:5417573-5417595 CAGATTTCTCACAGGAAACAGGG - Intronic
1003384388 6:5653917-5653939 CTGAATGTTCACAGAAACCAGGG - Intronic
1004600159 6:17141912-17141934 AAGAATGTTCACAGCAACCTGGG - Intergenic
1007284699 6:40739149-40739171 CAGAGTGCTGACATCAACTATGG - Intergenic
1008057053 6:46955963-46955985 CATTCTCCTCTCAGCAACCAGGG + Intergenic
1008475287 6:51929645-51929667 CACAGTACTCATAGCAACCATGG + Intronic
1009269286 6:61598111-61598133 CAGACTCCTCACAGTCAGCAGGG - Intergenic
1015377111 6:132524068-132524090 CTGATTACTCACAGCAACTATGG - Intergenic
1016185327 6:141191819-141191841 TAGACTGCACACAGCAGCCTGGG + Intergenic
1018420138 6:163633987-163634009 CAGACTGATCACAGCTACGCAGG - Intergenic
1020615636 7:10457264-10457286 CAGACTGCTCATGTCAACAATGG + Intergenic
1021822220 7:24509409-24509431 CAGACTACACACAGCGCCCAGGG - Intergenic
1022183821 7:27947812-27947834 CTGGCTGCTCACAGCACCCTTGG + Intronic
1024255716 7:47538515-47538537 CAGACTGCTCCCCACATCCAAGG - Intronic
1025253450 7:57367318-57367340 CACATAGCTCACAGCAGCCAAGG + Intergenic
1025265624 7:57454528-57454550 CAGCCTGCTCACTCCAGCCATGG + Intronic
1025747186 7:64253411-64253433 CAGCCTGCTCACACCAGCAAAGG + Intronic
1025775646 7:64558509-64558531 CAGGCTGCTCACCCCAGCCATGG + Intronic
1029734335 7:102457270-102457292 CACACTGCTCACAGCATCAGGGG + Exonic
1032259117 7:130320562-130320584 CACACAGCTCTCAGGAACCATGG + Intronic
1033598402 7:142872186-142872208 CAGACTTCCCAAAGCATCCAGGG - Intronic
1034235831 7:149568425-149568447 CAGGCTGCTGCCCGCAACCAAGG + Intergenic
1036681545 8:10878020-10878042 GATACTGCTCACAGTAACCAAGG - Intergenic
1038056586 8:23864023-23864045 CAGACTCATCAAAGCAGCCATGG - Intergenic
1038748806 8:30277651-30277673 AAAACTGCGCACAGAAACCAGGG + Intergenic
1043142384 8:76605972-76605994 CACATTGCCCACAGCAACCATGG - Intergenic
1045278220 8:100725417-100725439 CAGACTGCTAACATCAAAAAGGG - Intergenic
1045278275 8:100726313-100726335 CAGACTGCTAACATCAAAGAGGG + Intergenic
1047886002 8:129250814-129250836 CAGACTGCTCTCAGCAGCACTGG - Intergenic
1049215034 8:141403760-141403782 CACACATCTCACGGCAACCATGG + Intronic
1053298784 9:36934068-36934090 CAGAGGCCTGACAGCAACCAGGG + Intronic
1053466341 9:38311436-38311458 AAGGCTGCTCACAGGAGCCAGGG - Intergenic
1056489224 9:87088380-87088402 CAGAGTGCTGACAGCACCCTTGG + Intergenic
1057172906 9:92974599-92974621 CTGCCTGCTCAAGGCAACCAGGG + Intronic
1058387105 9:104449800-104449822 CAGACTGGTCAAATAAACCAGGG + Intergenic
1059387962 9:113979894-113979916 CACACTGGACAGAGCAACCAAGG - Intronic
1060545495 9:124456786-124456808 CAGACAGCTCCCAGTCACCAGGG - Intronic
1062510077 9:136900362-136900384 CAGACTCCCTGCAGCAACCAAGG - Intronic
1203574796 Un_KI270744v1:167071-167093 GACACTGCCCACAGAAACCAAGG - Intergenic
1186198058 X:7129841-7129863 CAGACAGCACACAGCATGCAGGG + Intronic
1186452879 X:9687890-9687912 CAGCTGGCTCCCAGCAACCAGGG - Intronic
1186487439 X:9944556-9944578 CACACTGCTCACTGCCACCTTGG - Intronic
1188059117 X:25578427-25578449 CAGACTTTTCACAGCAATAATGG + Intergenic
1189023782 X:37370547-37370569 CAGCCTGCTCCCAGCCCCCAAGG - Intronic
1189304387 X:39975625-39975647 CAGCCTGCTCTCAGCAGACAGGG - Intergenic
1189932791 X:46032905-46032927 GAGACTGCTCTCCTCAACCAAGG - Intergenic
1193148587 X:78102680-78102702 CAGACTGGTCCCAGCAAGAAGGG - Intronic
1193802406 X:85952278-85952300 CATGCAGCTCACAGCAACGAAGG + Intronic
1195127636 X:101823463-101823485 GAGACTGCTCAGAGCAACAAGGG - Intergenic
1195937928 X:110143017-110143039 CAGGCTGCTCTCCCCAACCAAGG - Intronic
1196167993 X:112555965-112555987 CAGACTCCTCAGAGCGAGCAAGG - Intergenic
1196188129 X:112766132-112766154 CAGACTGCTTACTGCAAATATGG - Intergenic
1197516770 X:127441894-127441916 CAGACTGCTCACAGAGACAAGGG - Intergenic
1199870585 X:151894842-151894864 CAGACTGTTCAGAGCAGCCTAGG + Intergenic