ID: 1077578045

View in Genome Browser
Species Human (GRCh38)
Location 11:3399159-3399181
Sequence GTGTGAAGATACCACCAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077578045_1077578047 -5 Left 1077578045 11:3399159-3399181 CCTGTTTGGTGGTATCTTCACAC No data
Right 1077578047 11:3399177-3399199 CACACGGACGCGCATGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077578045 Original CRISPR GTGTGAAGATACCACCAAAC AGG (reversed) Intergenic
No off target data available for this crispr