ID: 1077579550

View in Genome Browser
Species Human (GRCh38)
Location 11:3407968-3407990
Sequence CTGCAGTTTAGGAAGTGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077579547_1077579550 -9 Left 1077579547 11:3407954-3407976 CCGGGTGGGCCGGGCTGCAGTTT No data
Right 1077579550 11:3407968-3407990 CTGCAGTTTAGGAAGTGATCAGG No data
1077579541_1077579550 9 Left 1077579541 11:3407936-3407958 CCACAAATGATGCTGGAGCCGGG No data
Right 1077579550 11:3407968-3407990 CTGCAGTTTAGGAAGTGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077579550 Original CRISPR CTGCAGTTTAGGAAGTGATC AGG Intergenic
No off target data available for this crispr