ID: 1077579550 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:3407968-3407990 |
| Sequence | CTGCAGTTTAGGAAGTGATC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1077579547_1077579550 | -9 | Left | 1077579547 | 11:3407954-3407976 | CCGGGTGGGCCGGGCTGCAGTTT | No data | ||
| Right | 1077579550 | 11:3407968-3407990 | CTGCAGTTTAGGAAGTGATCAGG | No data | ||||
| 1077579541_1077579550 | 9 | Left | 1077579541 | 11:3407936-3407958 | CCACAAATGATGCTGGAGCCGGG | No data | ||
| Right | 1077579550 | 11:3407968-3407990 | CTGCAGTTTAGGAAGTGATCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1077579550 | Original CRISPR | CTGCAGTTTAGGAAGTGATC AGG | Intergenic | ||
| No off target data available for this crispr | |||||