ID: 1077581879

View in Genome Browser
Species Human (GRCh38)
Location 11:3422473-3422495
Sequence TGGTGCCCGAGGAGAACGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077581879_1077581888 -10 Left 1077581879 11:3422473-3422495 CCCCGCGTTCTCCTCGGGCACCA No data
Right 1077581888 11:3422486-3422508 TCGGGCACCATGACGGGGGCGGG No data
1077581879_1077581896 18 Left 1077581879 11:3422473-3422495 CCCCGCGTTCTCCTCGGGCACCA No data
Right 1077581896 11:3422514-3422536 AGCGTTGCCGGGAGACCGGGCGG No data
1077581879_1077581889 -9 Left 1077581879 11:3422473-3422495 CCCCGCGTTCTCCTCGGGCACCA No data
Right 1077581889 11:3422487-3422509 CGGGCACCATGACGGGGGCGGGG No data
1077581879_1077581894 14 Left 1077581879 11:3422473-3422495 CCCCGCGTTCTCCTCGGGCACCA No data
Right 1077581894 11:3422510-3422532 CCGCAGCGTTGCCGGGAGACCGG No data
1077581879_1077581891 6 Left 1077581879 11:3422473-3422495 CCCCGCGTTCTCCTCGGGCACCA No data
Right 1077581891 11:3422502-3422524 GGGCGGGGCCGCAGCGTTGCCGG No data
1077581879_1077581892 7 Left 1077581879 11:3422473-3422495 CCCCGCGTTCTCCTCGGGCACCA No data
Right 1077581892 11:3422503-3422525 GGCGGGGCCGCAGCGTTGCCGGG No data
1077581879_1077581895 15 Left 1077581879 11:3422473-3422495 CCCCGCGTTCTCCTCGGGCACCA No data
Right 1077581895 11:3422511-3422533 CGCAGCGTTGCCGGGAGACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077581879 Original CRISPR TGGTGCCCGAGGAGAACGCG GGG (reversed) Intergenic