ID: 1077587476

View in Genome Browser
Species Human (GRCh38)
Location 11:3464810-3464832
Sequence CCTCCTGGTGTTATTCGTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077587476_1077587480 -9 Left 1077587476 11:3464810-3464832 CCACAACGAATAACACCAGGAGG No data
Right 1077587480 11:3464824-3464846 ACCAGGAGGTGGGAATATTAAGG No data
1077587476_1077587483 8 Left 1077587476 11:3464810-3464832 CCACAACGAATAACACCAGGAGG No data
Right 1077587483 11:3464841-3464863 TTAAGGTCCATTGTGAAGGATGG No data
1077587476_1077587482 4 Left 1077587476 11:3464810-3464832 CCACAACGAATAACACCAGGAGG No data
Right 1077587482 11:3464837-3464859 AATATTAAGGTCCATTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077587476 Original CRISPR CCTCCTGGTGTTATTCGTTG TGG (reversed) Intergenic
No off target data available for this crispr