ID: 1077590568

View in Genome Browser
Species Human (GRCh38)
Location 11:3487803-3487825
Sequence ACCAAAATTGTCTCCAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077590568_1077590572 -5 Left 1077590568 11:3487803-3487825 CCATGTCTGGAGACAATTTTGGT No data
Right 1077590572 11:3487821-3487843 TTGGTTGTTGCGGCTGGAGGAGG No data
1077590568_1077590573 -2 Left 1077590568 11:3487803-3487825 CCATGTCTGGAGACAATTTTGGT No data
Right 1077590573 11:3487824-3487846 GTTGTTGCGGCTGGAGGAGGTGG No data
1077590568_1077590571 -8 Left 1077590568 11:3487803-3487825 CCATGTCTGGAGACAATTTTGGT No data
Right 1077590571 11:3487818-3487840 ATTTTGGTTGTTGCGGCTGGAGG No data
1077590568_1077590574 7 Left 1077590568 11:3487803-3487825 CCATGTCTGGAGACAATTTTGGT No data
Right 1077590574 11:3487833-3487855 GCTGGAGGAGGTGGTGCTACTGG No data
1077590568_1077590576 18 Left 1077590568 11:3487803-3487825 CCATGTCTGGAGACAATTTTGGT No data
Right 1077590576 11:3487844-3487866 TGGTGCTACTGGCAGCTAATGGG No data
1077590568_1077590575 17 Left 1077590568 11:3487803-3487825 CCATGTCTGGAGACAATTTTGGT No data
Right 1077590575 11:3487843-3487865 GTGGTGCTACTGGCAGCTAATGG No data
1077590568_1077590577 24 Left 1077590568 11:3487803-3487825 CCATGTCTGGAGACAATTTTGGT No data
Right 1077590577 11:3487850-3487872 TACTGGCAGCTAATGGGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077590568 Original CRISPR ACCAAAATTGTCTCCAGACA TGG (reversed) Intergenic
No off target data available for this crispr