ID: 1077595893

View in Genome Browser
Species Human (GRCh38)
Location 11:3531416-3531438
Sequence TCATGGGAGGGCCCCCCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 81}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077595893_1077595902 5 Left 1077595893 11:3531416-3531438 CCCATGGGGGGGCCCTCCCATGA 0: 1
1: 0
2: 1
3: 10
4: 81
Right 1077595902 11:3531444-3531466 ATGATGGGCCCTCCTCCTCCTGG No data
1077595893_1077595898 -10 Left 1077595893 11:3531416-3531438 CCCATGGGGGGGCCCTCCCATGA 0: 1
1: 0
2: 1
3: 10
4: 81
Right 1077595898 11:3531429-3531451 CCTCCCATGATGCCAATGATGGG No data
1077595893_1077595907 19 Left 1077595893 11:3531416-3531438 CCCATGGGGGGGCCCTCCCATGA 0: 1
1: 0
2: 1
3: 10
4: 81
Right 1077595907 11:3531458-3531480 TCCTCCTGGGATGATGCCAGTGG 0: 16
1: 3
2: 2
3: 19
4: 234
1077595893_1077595909 20 Left 1077595893 11:3531416-3531438 CCCATGGGGGGGCCCTCCCATGA 0: 1
1: 0
2: 1
3: 10
4: 81
Right 1077595909 11:3531459-3531481 CCTCCTGGGATGATGCCAGTGGG 0: 15
1: 3
2: 4
3: 13
4: 173
1077595893_1077595903 6 Left 1077595893 11:3531416-3531438 CCCATGGGGGGGCCCTCCCATGA 0: 1
1: 0
2: 1
3: 10
4: 81
Right 1077595903 11:3531445-3531467 TGATGGGCCCTCCTCCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077595893 Original CRISPR TCATGGGAGGGCCCCCCCAT GGG (reversed) Intergenic
900140816 1:1138933-1138955 TCATGGGAGGGCCCAGCCTGCGG + Intergenic
900540359 1:3199645-3199667 TCATCAGAGGCCCACCCCATGGG - Intronic
901658500 1:10784274-10784296 TAAATGGAGGACCCCCCCATGGG - Intronic
917279427 1:173366979-173367001 TCATGCGAGGGCCCCTCCCAGGG - Intergenic
918232804 1:182551055-182551077 TCATAGGAGGGAACCCCCAGTGG - Intronic
924934296 1:248755221-248755243 TCAAGGCAGGGCCCCCACCTGGG + Exonic
1067183017 10:44004894-44004916 TCAGGGGAGGGTCCCTTCATTGG + Intergenic
1076756026 10:132572234-132572256 TCTTCTGAAGGCCCCCCCATGGG - Intronic
1077372001 11:2186690-2186712 TCAAAGGAGGCCCCTCCCATGGG - Intergenic
1077595893 11:3531416-3531438 TCATGGGAGGGCCCCCCCATGGG - Intergenic
1081664079 11:44906356-44906378 TCCTGGGTGGGGTCCCCCATCGG + Intronic
1084251793 11:67905411-67905433 TCATGGGAGGGCCCCCCATATGG - Intergenic
1084821046 11:71690617-71690639 TCATGGGAGGGCCCCCCATATGG + Intergenic
1085685948 11:78622100-78622122 TCTTTGGCAGGCCCCCCCATAGG + Intergenic
1089320204 11:117620676-117620698 GCATGGGATGCCCTCCCCATGGG + Intronic
1091362245 11:134986930-134986952 TCATGGGAGGTCCCCGCTGTAGG + Intergenic
1092422062 12:8340202-8340224 TCATGGGAGGGCCCCCCATATGG - Intergenic
1093448280 12:19285502-19285524 TCATGGGAGGGAACCCCCACAGG - Intronic
1094829211 12:34292231-34292253 ACATGGGGGGGCACCCCAATAGG - Intergenic
1095279313 12:40331811-40331833 TCATGGGAGGTACTCACCATAGG + Intronic
1096560650 12:52433737-52433759 TCTTGGAAGGGCCATCCCATGGG - Intronic
1100239649 12:92698437-92698459 TCATGGGAAGCCCGGCCCATTGG + Intergenic
1101045381 12:100799904-100799926 TCATGGAAGGGGCCCCACACTGG - Intronic
1103925827 12:124422959-124422981 ACATGGCAGGGCCCCACCAGTGG + Intronic
1107877490 13:44803638-44803660 CCCTGGGAGGGCCCCCACACAGG + Intergenic
1110084760 13:71364298-71364320 TCTTGGGATGGCCCTCCCCTTGG + Intergenic
1111709446 13:91793325-91793347 TCATGGGAGGGACCCGGAATGGG - Intronic
1111903638 13:94230320-94230342 TCATGGGAAAGCCCTCCCCTGGG - Intronic
1114700275 14:24670775-24670797 TCATGGGTGGGCTCTCCAATAGG + Intergenic
1119729572 14:76942400-76942422 TCATGGGATGAGCCTCCCATCGG - Intergenic
1123627895 15:22239884-22239906 TCATGCCAGGGCTCCCCCAGTGG - Intergenic
1126383010 15:48067378-48067400 TCTAGGGAGGGCTCACCCATGGG + Intergenic
1129158359 15:73732766-73732788 TCCTGGGAAGGCCCCACCACTGG + Intergenic
1129458476 15:75688236-75688258 TCATGGAGCGGCCCCGCCATGGG - Exonic
1129725310 15:77898634-77898656 TCATGGAGCGGCCCCGCCATGGG + Intergenic
1133065275 16:3201970-3201992 GCAGAGGAGGGCTCCCCCATAGG - Intergenic
1133376227 16:5289373-5289395 TCATGGGAGGGCCCCCATATGGG + Intergenic
1141976059 16:87517455-87517477 TCATGCCAGGGCTCCCCCAGCGG + Intergenic
1147456547 17:40541751-40541773 TGCGGGCAGGGCCCCCCCATGGG + Intergenic
1152622804 17:81373687-81373709 TCAGGGAAGGGGCACCCCATGGG - Intergenic
1157892138 18:51427904-51427926 TCATGGGGGGGTCCCCTCATGGG - Intergenic
1157911765 18:51623184-51623206 TCATGGGTGGGCCCACCTATGGG - Intergenic
1160907069 19:1456476-1456498 GCATGGGAGGGCACCACCACTGG - Intronic
1161977920 19:7616370-7616392 TCATAGAGGGGTCCCCCCATAGG + Intronic
925418164 2:3688176-3688198 GCATTGGAGGGCCCCCTCAAGGG - Intronic
936040116 2:109143078-109143100 TCATGGCAGGCCCCCCACACTGG - Intronic
936733844 2:115416160-115416182 TCATGGAATGGCCACCCCAATGG + Intronic
937835495 2:126466926-126466948 TCACGGGAAGGCCCCCACAGTGG - Intergenic
948632393 2:239310498-239310520 TCATGGGAGGGGCCTTCCCTTGG - Intronic
1170505807 20:17024658-17024680 TAATGGAAGAGCCCCTCCATGGG - Intergenic
1174271338 20:49371674-49371696 TCATGAGAGGCCCCACCCAAGGG + Exonic
1178454944 21:32740249-32740271 TCAAAGCAAGGCCCCCCCATTGG - Intronic
1185054316 22:48570076-48570098 GCATGGGAGGGCCCTGCCAGGGG - Intronic
952886853 3:38017496-38017518 TGAGGGGAGGGCCCTCCCCTTGG - Intronic
955925040 3:63996145-63996167 TCAGGGAGGGGCCCCCCCACCGG + Exonic
957065866 3:75521817-75521839 TCATGGGAGGGCCTCCCATATGG - Intergenic
961287284 3:125816249-125816271 TCATGGGAGGGCCTCCCATATGG + Intergenic
961899807 3:130199725-130199747 TCACGGGAGGGCCCCCCATATGG - Intergenic
963899516 3:150720528-150720550 TCATGGGAGGGCCCCCCAGCTGG + Intergenic
966253948 3:177897095-177897117 TCATGGGTGGGCCTCCTGATGGG - Intergenic
969252395 4:5976692-5976714 TCATAGGAGTGCCCACCCACTGG + Intronic
969743592 4:9052015-9052037 TCATGGGCGGGCCCCCCATATGG + Intergenic
969802996 4:9584115-9584137 TCATGGGAGGGCTCCCATATGGG + Intergenic
976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG + Intronic
988840765 5:35081486-35081508 GCATCGGAGGGCCCCTTCATAGG + Intronic
992015240 5:72568515-72568537 TCATGGGAAGGCCTCGCTATGGG - Intergenic
997625326 5:135327236-135327258 TCCTGCGAGGGCCTCCGCATGGG + Intronic
997725921 5:136119854-136119876 TCATGGAAGGGCCCCCTAAGGGG + Intergenic
999157151 5:149466269-149466291 CCCTGGGATGGCCACCCCATAGG - Intergenic
1002604694 5:180375679-180375701 TCATGGAAAGGCTCCTCCATAGG + Intergenic
1002604716 5:180375774-180375796 TCATGGAAAGGCCCTTCCATAGG + Intergenic
1006544719 6:34770325-34770347 TCATGGGAGGGCCCCCCATATGG - Exonic
1007547876 6:42708175-42708197 TCATGGGAGAGCCCTCCCTGGGG + Intronic
1007762581 6:44141682-44141704 TCAGTGAAGGGCCCCTCCATGGG + Intronic
1017053239 6:150413846-150413868 CCAGGGCAGGGCCACCCCATTGG + Intergenic
1019666232 7:2253515-2253537 TCACGGGACAGCCCACCCATCGG + Exonic
1024961395 7:54980734-54980756 TGAAGGCAGGGCCACCCCATTGG + Intergenic
1027998755 7:85464067-85464089 TCATGGGATGGCTCTGCCATGGG - Intergenic
1029069750 7:97885882-97885904 TCATGGGCGGGCCCCCCATATGG - Intergenic
1029373966 7:100166973-100166995 TCTTGGGAGGGCCCTTCCAGAGG - Exonic
1036248802 8:7143805-7143827 TCATGGGAGGGCCCCCCATATGG + Intergenic
1036251998 8:7170549-7170571 TCATGGGAGGGCCTCCCATATGG - Intergenic
1036365492 8:8116912-8116934 TCATGGGAGGGCCTCCCATATGG + Intergenic
1036813217 8:11881881-11881903 TCATTGGAGGACCTCCCAATGGG - Intergenic
1044624875 8:94227280-94227302 TCCTGGAAGGGCTCCCACATGGG + Intergenic
1047800794 8:128307501-128307523 TCCTGGGAGTGCCACCCCAGAGG + Intergenic
1048575391 8:135686010-135686032 TCAAGGCAGGGCCACTCCATTGG - Intergenic
1052769683 9:32676218-32676240 TCATGGGAGGGCTCGCATATGGG + Intergenic
1057541703 9:95979334-95979356 ATATGGGAGTGCCTCCCCATTGG - Intronic
1062569307 9:137177641-137177663 ACGTGGGAGGGGCCCACCATGGG + Intronic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1200962946 Y:9011721-9011743 CCATGGGAGGGAACCCCCGTGGG + Intergenic
1202151306 Y:21845984-21846006 CCATGGGAGTGACTCCCCATGGG + Intergenic