ID: 1077597560

View in Genome Browser
Species Human (GRCh38)
Location 11:3547049-3547071
Sequence CTGTGTTTAAGGTGAGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077597560_1077597567 11 Left 1077597560 11:3547049-3547071 CCCACTTCTCACCTTAAACACAG No data
Right 1077597567 11:3547083-3547105 TTCCCATCATTCCAAAACTTGGG No data
1077597560_1077597566 10 Left 1077597560 11:3547049-3547071 CCCACTTCTCACCTTAAACACAG No data
Right 1077597566 11:3547082-3547104 CTTCCCATCATTCCAAAACTTGG No data
1077597560_1077597568 12 Left 1077597560 11:3547049-3547071 CCCACTTCTCACCTTAAACACAG No data
Right 1077597568 11:3547084-3547106 TCCCATCATTCCAAAACTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077597560 Original CRISPR CTGTGTTTAAGGTGAGAAGT GGG (reversed) Intergenic
No off target data available for this crispr