ID: 1077606214

View in Genome Browser
Species Human (GRCh38)
Location 11:3614637-3614659
Sequence AGGGAGAAGCTGGGTGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 881
Summary {0: 1, 1: 32, 2: 8, 3: 88, 4: 752}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077606214_1077606223 13 Left 1077606214 11:3614637-3614659 CCCACCTCACCCAGCTTCTCCCT 0: 1
1: 32
2: 8
3: 88
4: 752
Right 1077606223 11:3614673-3614695 TTCGTCCCAGTCTGTACTGTGGG 0: 1
1: 0
2: 1
3: 6
4: 67
1077606214_1077606222 12 Left 1077606214 11:3614637-3614659 CCCACCTCACCCAGCTTCTCCCT 0: 1
1: 32
2: 8
3: 88
4: 752
Right 1077606222 11:3614672-3614694 CTTCGTCCCAGTCTGTACTGTGG 0: 1
1: 0
2: 0
3: 9
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077606214 Original CRISPR AGGGAGAAGCTGGGTGAGGT GGG (reversed) Intergenic
900527588 1:3136696-3136718 GGGGAGAAGCAGGGGGCGGTGGG - Intronic
900578203 1:3394486-3394508 AGGGAGGTGGTGGGTGGGGTGGG + Intronic
901055125 1:6445765-6445787 GGGGGGAAGCTGGGTGGGGGTGG - Exonic
901089539 1:6632250-6632272 AGGGAGAAGCTGGCTGTGGAGGG + Intronic
901195226 1:7436557-7436579 TGGGAGGAGCAGGGTGAGGTCGG + Intronic
901640117 1:10688855-10688877 AGGGAGAAGCTGGGAGCAGGAGG - Intronic
902193108 1:14777538-14777560 AAGCAGATGCTGGGTGAAGTTGG - Intronic
902341254 1:15784920-15784942 AGGGAAAAGCTGGGGGAGGTTGG + Intronic
902479244 1:16702849-16702871 GGGGGGAAGCTGGGTGGGGGTGG + Intergenic
903194296 1:21673345-21673367 AGGGAGTAGGTGGGTGTGGGAGG + Intergenic
903199962 1:21728044-21728066 AGGGATAAGCTGGATTATGTGGG + Intronic
903582749 1:24384410-24384432 AGGAGGAAGCTGAGTCAGGTGGG - Intronic
903670168 1:25030875-25030897 AGGGTGGGGCTGGGTGGGGTGGG - Intergenic
904036983 1:27564234-27564256 AGGGCCAAGCTGGGTGACCTTGG + Intronic
904095303 1:27972324-27972346 AGGGAGATGTAGTGTGAGGTAGG - Exonic
904293924 1:29505609-29505631 AGGGAGAAGCGGGAGGAGGTCGG + Intergenic
904339459 1:29824735-29824757 CTGGAGAGGCTGGGCGAGGTAGG + Intergenic
905107124 1:35570622-35570644 AAGGAGAAGCAGGTTGGGGTTGG + Intergenic
905391639 1:37639515-37639537 AGTGAGAGGCTGGGAGAGGCTGG - Intergenic
905489441 1:38332098-38332120 AGGGAGAGGAGGAGTGAGGTTGG - Intergenic
905649724 1:39648051-39648073 AGGCAGAGCCTGGGTGAGATGGG + Intergenic
905679441 1:39857241-39857263 AGGCAGCAGCTGGGTTTGGTGGG - Intronic
905869670 1:41396015-41396037 GGAGGGAAGGTGGGTGAGGTGGG - Intergenic
906383496 1:45347664-45347686 AGTGAGAAGCTGGCCGTGGTGGG - Exonic
907278245 1:53328523-53328545 AGGGAGAAGCTGGGGGCGCAGGG + Intergenic
907378766 1:54067313-54067335 AGGGAGAGCCTGTGGGAGGTGGG + Intronic
907418740 1:54332355-54332377 AGGGAGCTGCTGGGAGGGGTGGG + Intronic
907455266 1:54571740-54571762 AAGGGGAAGCTGGGTAAGGTGGG + Intronic
908912055 1:69083294-69083316 ATGGAGAAGATGGGGGAGGGAGG - Intergenic
908920597 1:69186624-69186646 AGGGAGATTCTCAGTGAGGTGGG - Intergenic
909252924 1:73381311-73381333 AGGGAGCAGGAGAGTGAGGTGGG - Intergenic
909520554 1:76563344-76563366 AGGGACAAACTGGGAGAGGCAGG + Intronic
910232768 1:85003357-85003379 AGTGGCAAGCTGGGAGAGGTAGG + Intronic
910715858 1:90229476-90229498 AGTGAGGAGAGGGGTGAGGTGGG - Intergenic
911409308 1:97482759-97482781 AGGCAGAGGTGGGGTGAGGTGGG - Intronic
911582796 1:99653684-99653706 AAGGAGAAGCTGGGTGAACTTGG - Intronic
912122033 1:106483138-106483160 AGGGTGAGTGTGGGTGAGGTAGG + Intergenic
912338325 1:108884626-108884648 AGGAAGGAGATGGGTTAGGTTGG + Intronic
912375095 1:109203429-109203451 GGAGAGAGGCTGGGTGAGGAGGG + Intronic
912628109 1:111222958-111222980 ACTGAGAAGCTGGGGGAGGTAGG + Intronic
912701708 1:111882769-111882791 ATAGAGAGGCTGGGTGAGGGTGG + Intronic
913046304 1:115076270-115076292 AAGGAGAGTCTGGGGGAGGTCGG + Intronic
913090528 1:115473750-115473772 AGAGAGAAGCAGGGTAAGGAAGG + Intergenic
913129761 1:115828794-115828816 TGGGAGAAGGTGGGGGAGGCGGG - Intergenic
914221846 1:145688624-145688646 TAGTAGAAGCTTGGTGAGGTAGG + Intronic
915095445 1:153459292-153459314 AGGGAGAAGCAGGGAGAGTCGGG + Intronic
915580373 1:156809511-156809533 AGGGAGGAGTGGGGTGAGGGAGG + Intronic
915940883 1:160117547-160117569 ACTAAGAGGCTGGGTGAGGTGGG + Intronic
916046689 1:161005304-161005326 AGGGAGGAGATAGGGGAGGTAGG - Intronic
916195216 1:162216092-162216114 AGGGAGGAGATGGGGGAGGAGGG - Intronic
916819282 1:168382278-168382300 AGTGAGAGGCTGGGAGAGCTAGG - Intergenic
917232909 1:172857151-172857173 AGGGAGAAGGAGGGAGAGGGAGG + Intergenic
917482090 1:175421057-175421079 AGTGAGCAGCTAGCTGAGGTGGG + Intronic
917505241 1:175621409-175621431 AGTGAGTAGCTGAGTGTGGTGGG - Intronic
917538526 1:175892011-175892033 AGGTGGAAGCTGGATGAGCTGGG - Intergenic
918886318 1:190198829-190198851 AGGGAGAAGTTGGAAGAGTTTGG - Intronic
918925689 1:190782611-190782633 GGGGAGAAGATGGATGAGGAAGG - Intergenic
918932837 1:190878495-190878517 AGTGAGAAGGTGGGCGAGGGGGG + Intergenic
920053319 1:203176053-203176075 AGGGCGCAGATGGGTGAGATGGG + Intergenic
920073038 1:203316884-203316906 AGGTAATAGCTGGGTGAGTTTGG + Intergenic
920073545 1:203320957-203320979 GGGGAGGAGCTGGGGGAGGGGGG - Intergenic
920565149 1:206967144-206967166 TGAGAGAAGCTGGGTGAGGGTGG + Intronic
920735194 1:208527174-208527196 AGGGAGAGGCCGGGGGAGGGGGG - Intergenic
921046251 1:211479865-211479887 TGGGAGAAGCTGGGACATGTCGG - Intronic
921643248 1:217581529-217581551 AGTGAGAAGTTGGGGGAGGTGGG - Intronic
922304160 1:224329856-224329878 AGGGAGAAGCCGGGGATGGTGGG - Intronic
922776990 1:228219362-228219384 AGGGAGGTGCAGGCTGAGGTGGG + Exonic
922868726 1:228883072-228883094 AGGGAGGAGCTTGGTGGGGTAGG + Intergenic
923093189 1:230754872-230754894 ATGGAGAAGCTGGGTGGGTAGGG + Intronic
923247484 1:232146619-232146641 AGGCAGAAGCTGGGAATGGTGGG + Intergenic
923843682 1:237704114-237704136 AGGTAGAAGCTATATGAGGTAGG + Intronic
1062803188 10:395121-395143 AGGGAGGAGTTGGGGGAGGGAGG + Intronic
1062878555 10:960399-960421 AGGGAGGCGCTGGGTATGGTGGG + Intergenic
1063219781 10:3956292-3956314 AGGGAAAGGCTGGGAGTGGTGGG + Intergenic
1063643131 10:7851572-7851594 CGGGTGAAGCTGGGTGATGACGG - Intronic
1063707883 10:8448767-8448789 TGGGAGGAGCAGGTTGAGGTGGG - Intergenic
1063868123 10:10389154-10389176 AGGGAGAAGTTGTCCGAGGTAGG - Intergenic
1063876410 10:10484012-10484034 AGGGAGAAAGTGGGGGAGGGAGG - Intergenic
1063876420 10:10484036-10484058 AGGGAGAAAGTGGGGGAGGGAGG - Intergenic
1065359090 10:24872267-24872289 AGGGAGAGGCTGGGTGTGCAGGG + Intronic
1065383375 10:25111687-25111709 AGAGAGAAGCAGGATGAGATGGG - Intergenic
1065655954 10:27950045-27950067 ATGGAGAAGCTGTGTGGGGTAGG - Intronic
1066228898 10:33412640-33412662 AGGGAGAAACTGGCTGATGGAGG + Intergenic
1066659541 10:37726865-37726887 GCGGAGTAGCTGGGTGAGCTGGG + Intergenic
1067554704 10:47260605-47260627 GGGCAGAAGCTGTGTGGGGTGGG - Intergenic
1067854577 10:49781072-49781094 AGGGAGCAGCTGGGGGTGTTGGG - Intergenic
1067907367 10:50307431-50307453 AGAGAGAAGCTGGGATATGTGGG - Intronic
1067983357 10:51113428-51113450 AGGGAGAAGATGGCTCTGGTTGG - Intronic
1068327964 10:55519152-55519174 AGGGGGCAGCTGGCTGAGTTAGG - Intronic
1068802691 10:61160236-61160258 TGGGAAAAGCTGCATGAGGTGGG + Intergenic
1069595915 10:69670122-69670144 AGGGAGAAGGTTGATGAGGCAGG - Intergenic
1069663075 10:70136735-70136757 AGAGAGAAGATGGCTGAGGCAGG - Intergenic
1069720117 10:70544494-70544516 AGGCAGGAGCTGAGTGAGGAGGG + Intronic
1069905632 10:71730655-71730677 AAGGAGGGGCTGGGTGAGCTGGG - Intronic
1069948794 10:72005510-72005532 AGGGAGAAACTGATGGAGGTGGG + Intronic
1069961042 10:72079671-72079693 ATGGAGAAGCTGGGAGAGATTGG - Intronic
1070236412 10:74632104-74632126 TGGGAGAAGATGGGTGAAGCTGG - Intronic
1070321296 10:75356712-75356734 TGGGAGAACCTGGGTGGGGCTGG - Intergenic
1071533876 10:86411489-86411511 AGGAAGAAGCCGGGTGGAGTGGG - Intergenic
1071991334 10:91103292-91103314 AAGGATGAGCTGTGTGAGGTCGG + Intergenic
1072175345 10:92915253-92915275 GAAGAGAAGCTGGGTGCGGTGGG + Intronic
1072610050 10:97011794-97011816 AGGGAAGTGCTTGGTGAGGTGGG - Intronic
1073959688 10:108912184-108912206 TGGGAAAAGCTGGGAAAGGTTGG - Intergenic
1074402266 10:113151903-113151925 AGGGAGAAGCGGGGGGCGGGTGG + Intronic
1074429596 10:113382607-113382629 AAGGAGAAGGTGGAGGAGGTAGG - Intergenic
1075277822 10:121110917-121110939 TGGGTGAAGCTGGGTGGGTTAGG + Intergenic
1075402709 10:122172568-122172590 AGGAAGAAGGCGGGAGAGGTTGG + Intronic
1076076946 10:127541185-127541207 AGTGACAAGCTGGAAGAGGTTGG - Intergenic
1076675650 10:132146308-132146330 AGGGAGCAGCTGAGCCAGGTGGG - Intronic
1077021342 11:418447-418469 AGGCAGAGGCTGGGTGGGGTGGG - Exonic
1077036686 11:498820-498842 AGCAACAAGCTGGGTGATGTGGG - Exonic
1077166035 11:1139282-1139304 AGGGGGTAGCTGGGGGAGGCGGG + Intergenic
1077208793 11:1358484-1358506 AGGGAGCAGCCGGGTGGCGTGGG - Intergenic
1077606214 11:3614637-3614659 AGGGAGAAGCTGGGTGAGGTGGG - Intergenic
1077875161 11:6298688-6298710 AGGATGAAGTAGGGTGAGGTTGG - Intergenic
1077888229 11:6401746-6401768 AGGGAGGACGTGGGTGGGGTGGG - Intronic
1079011899 11:16835330-16835352 AGGAAGAGGCTGGGGGAAGTGGG + Intronic
1079328638 11:19515777-19515799 AGGTGGAAGCAGGGTGGGGTGGG + Intronic
1080936819 11:36871939-36871961 AGGGAGAATGGGGATGAGGTGGG + Intergenic
1081566871 11:44265660-44265682 ATGGAGGGGTTGGGTGAGGTGGG + Intronic
1081631682 11:44693938-44693960 AGGGAGGTGTTGAGTGAGGTGGG - Intergenic
1081775848 11:45675470-45675492 AGTGAGAACCTGGCAGAGGTGGG - Intergenic
1081852814 11:46285463-46285485 CAGGAGAAGCTGGGAGAGGCAGG + Intronic
1081866929 11:46365319-46365341 AGGGTGAAGCTGGGTGATGCCGG - Intronic
1083366729 11:62145773-62145795 AGGGAGGAGGTGGGCGGGGTGGG + Intronic
1083874824 11:65516696-65516718 AGAGAGAAGCTGGGGTAGGTTGG + Intergenic
1084683081 11:70678470-70678492 AGGGAGAGGCAGGGAGAGGCAGG - Intronic
1086528612 11:87757878-87757900 AGGGAGAAACTGAGTGAGTGGGG + Intergenic
1086856435 11:91871598-91871620 AGGAGGAAGCTGGGTGAGTTGGG + Intergenic
1087837591 11:102890449-102890471 AGGGTGTAGCCGGGTGTGGTGGG - Intergenic
1087859269 11:103133363-103133385 AGGGAGAAGCTGGAAGAAATGGG + Intronic
1088843751 11:113647933-113647955 AGGGAGGAGGTGGTGGAGGTAGG + Intergenic
1089316029 11:117591995-117592017 AGGGACAACCTGGGCCAGGTTGG + Intronic
1089379043 11:118014673-118014695 AGGGAATATCTGGGTGAGGTGGG - Intergenic
1089496663 11:118911495-118911517 ATGGAGAAGCTGGGGGTGGCGGG - Intronic
1089499455 11:118923869-118923891 AGGGAGAGAATGGGTGAGGAAGG - Intronic
1089538111 11:119173045-119173067 AAGGAGAAGCAGGGTGAGGGAGG + Intronic
1089682726 11:120128366-120128388 AGGGAGCAGCAAGGTGAGCTTGG + Intronic
1089734590 11:120541017-120541039 AGAGAGAGGCTGGGGCAGGTTGG - Intronic
1089748491 11:120633719-120633741 AGGGAGAGGCTGGGAGGGGAAGG + Intronic
1091230939 11:133987540-133987562 CGGGAGAGGCTGGGTGGGGGGGG + Intergenic
1091356783 11:134943718-134943740 AGGGAGAAGCGGGGCCAGGCTGG - Intergenic
1091591408 12:1845070-1845092 AGGGAGAAGCAGGGTGGGGGTGG + Intronic
1091697156 12:2635517-2635539 ATGGAGGAGCTGGGGGTGGTGGG - Intronic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1092233107 12:6788774-6788796 TGGGAGAAGTTGGGTGAAGGGGG + Intronic
1093206651 12:16259405-16259427 AGGGAGGAACTGGGGGAGGGAGG - Intronic
1093844785 12:23956542-23956564 TGGGAGAGGTTAGGTGAGGTGGG - Intergenic
1094091674 12:26656898-26656920 AGCTAGAAGCTGAGTGAGGCTGG - Intronic
1094584708 12:31767438-31767460 AGAAAGAGGCTGGGTGCGGTGGG + Intergenic
1094754917 12:33456655-33456677 AGGTAGAAACTGGGTGGGGCGGG + Intergenic
1095938572 12:47710953-47710975 AGGGAGAGGCAGCGTGAAGTGGG - Intronic
1096550979 12:52371370-52371392 AGGGAGCAGCTGTGTCAGCTGGG - Intergenic
1096573733 12:52540023-52540045 AGGGAGGAGTTGGGAGAGGGAGG - Intergenic
1096581114 12:52585925-52585947 AGGGAGGAGACGGGTGAGTTGGG + Exonic
1096614001 12:52821502-52821524 AGGGAGAGGGTGGGTCTGGTGGG + Exonic
1096679028 12:53242509-53242531 AGGCAGGAGCTGGGTGGAGTGGG + Intergenic
1098223618 12:68297928-68297950 AGGCAGGGGCTGGGTTAGGTGGG - Intronic
1098450208 12:70610406-70610428 GGGGAGACGCTGGGTGTGGAGGG - Intronic
1099613985 12:84912331-84912353 AGGGAGAAGCTGGGCTGGGCGGG - Intronic
1099782489 12:87215408-87215430 AGGTAGAAGCTGGGTATGATGGG - Intergenic
1099873444 12:88375998-88376020 ATGCAGAAGCTGGGTGAGCGTGG - Intergenic
1100114545 12:91288213-91288235 AGGGAGTAGCTTGGAGATGTAGG - Intergenic
1101251305 12:102938874-102938896 AGTGAGAAGGTGGCTGTGGTGGG - Intronic
1101365217 12:104064500-104064522 AGGGAGCAGCCGGTTGAGGCGGG + Exonic
1101821205 12:108185499-108185521 AGGAGGAAGCTGTGTGTGGTAGG - Intronic
1102095913 12:110241252-110241274 AGGGAGAAGCAGACTTAGGTAGG + Intergenic
1102312592 12:111858353-111858375 GGGGTGAAGATGGGGGAGGTGGG - Intronic
1102514143 12:113435288-113435310 AGGGAGAAGCAGAGTGAGGGAGG - Intronic
1102595615 12:113990635-113990657 AGGGATAGGCTGGGTCAGGGGGG - Intergenic
1103005066 12:117414508-117414530 AAAGTGAAGCTGGGTGAGCTTGG + Intronic
1103052344 12:117791102-117791124 AGGGTAGAGGTGGGTGAGGTGGG - Intronic
1103560274 12:121789945-121789967 CGGGGGAGGCGGGGTGAGGTGGG - Intronic
1103575964 12:121877433-121877455 AGAGAAGAGCTGGGTGAGGTTGG + Intergenic
1103602640 12:122063897-122063919 AGGGATCAGCTGGGGGAGGTAGG + Intergenic
1103705348 12:122868277-122868299 AGGGAGCAGCGGGGTGAGTGAGG - Intronic
1103896398 12:124276157-124276179 GGAGAGAGGCTGAGTGAGGTGGG - Intronic
1104371606 12:128228528-128228550 AGGAAGAAGGGGGGTGAGGGAGG + Intergenic
1104778696 12:131405864-131405886 TGGGAGAAGCAGGGTGACTTGGG - Intergenic
1104909802 12:132235273-132235295 AGTGAGGAGCCGGGTGCGGTGGG + Intronic
1105280569 13:18960446-18960468 AAAGAGACACTGGGTGAGGTGGG + Intergenic
1105432439 13:20349769-20349791 AGGGCAAAGCTGGGTGTGCTGGG + Intergenic
1106191776 13:27459734-27459756 GGGGGGAAGCCGGGTGCGGTAGG + Intergenic
1106645046 13:31625135-31625157 AGGAAGAACCTGTGTGTGGTTGG + Intergenic
1106840859 13:33683665-33683687 GGGGAGAAGGTGAGGGAGGTGGG + Intergenic
1107244125 13:38272028-38272050 AAGGAGAATCTGTGTGTGGTGGG + Intergenic
1107522841 13:41200714-41200736 GAGCAGTAGCTGGGTGAGGTAGG - Intergenic
1107660933 13:42638434-42638456 TGAATGAAGCTGGGTGAGGTTGG + Intergenic
1108289306 13:48942364-48942386 AGGGAGTATCTGAGTGAGGAGGG + Intergenic
1109217276 13:59603818-59603840 GGGGTGAAGCTGGGCTAGGTTGG - Intergenic
1110521624 13:76485882-76485904 AGTGTGAAGCTAGGAGAGGTTGG + Intergenic
1112010940 13:95293380-95293402 ATGGAAAAGCTGTGTGAGGGTGG - Intronic
1112219344 13:97472048-97472070 AGGGAGAAGTTGTGTGATGCAGG + Intergenic
1112661684 13:101517122-101517144 AGACAGAAGCAAGGTGAGGTTGG - Intronic
1112749534 13:102567951-102567973 TGGAAGAAGCTGGGAGAGGGAGG - Intergenic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113215902 13:108040296-108040318 TGGGAAAAGAGGGGTGAGGTTGG - Intergenic
1113778406 13:112961924-112961946 AGGCAGAAACTGGAGGAGGTGGG - Intronic
1113871168 13:113560740-113560762 AGGCAGAAGCTGGGAGGGGCTGG + Intergenic
1113994038 14:16052658-16052680 AGGGATAAGCTGGGGGATGAAGG - Intergenic
1114183178 14:20382116-20382138 AAGGAGAGACTGGGTGTGGTGGG - Intronic
1114536649 14:23427175-23427197 AGGGTGGGGCTGGGTGGGGTTGG + Intronic
1114552659 14:23542304-23542326 AGGAAGAAGATGGGGGTGGTAGG + Intronic
1114556979 14:23567729-23567751 AGGCAGAAGCCAGGTGAGGCTGG - Exonic
1114611889 14:24048239-24048261 AGAGAGAGCCTGGGTGAGATGGG + Intergenic
1115368810 14:32589053-32589075 ATGGAGATGCTGGGAGAGATGGG - Intronic
1115933656 14:38527248-38527270 AGGAAGAGGGTGGGAGAGGTGGG + Intergenic
1116205610 14:41862039-41862061 AGAGAGAAGGTGAGTGAAGTAGG - Intronic
1116338429 14:43690198-43690220 AGGTGGTAGTTGGGTGAGGTGGG - Intergenic
1116964109 14:50997083-50997105 ATGGAGAATCCCGGTGAGGTGGG + Intronic
1117958738 14:61142901-61142923 ATGGATAAGCTTGGTCAGGTTGG + Intergenic
1118501742 14:66368569-66368591 AGGGAGAAGTTGGATGAGATAGG + Intergenic
1118869672 14:69730713-69730735 AAGAAAAAGCTGGGTGATGTAGG - Intronic
1118905129 14:70018134-70018156 AGGGAGCTGCAGGGTTAGGTGGG + Intronic
1118971845 14:70643431-70643453 TGGGAGAAGGTGGGAGAGGTTGG + Intronic
1119142868 14:72283791-72283813 AGGGAGAGGCTGGAAGAGTTTGG + Intronic
1119704718 14:76776452-76776474 AGGGAGGAGGTGGGTGGGCTGGG + Intronic
1119879543 14:78089646-78089668 GGAGACAAGCTGGCTGAGGTAGG - Intergenic
1119944503 14:78678433-78678455 CTGGAGTAGCTGGGTGTGGTGGG - Intronic
1120018604 14:79502524-79502546 AGGGAGAGGCGGGAGGAGGTGGG - Intronic
1120930739 14:89845761-89845783 AGGGAGAAGCAGGCTGAAGATGG + Intronic
1121183658 14:91947991-91948013 GGGGAGCAGCGGGGTGGGGTGGG + Intergenic
1121307828 14:92917986-92918008 TGGGAGAAGATGGGTGGGGAGGG - Intergenic
1121377998 14:93431193-93431215 AGAGAGAAGGTGGGGGAGGGTGG + Intronic
1121470083 14:94146058-94146080 AGGGAGCAACTGTGTGAGGTAGG + Intergenic
1121908501 14:97768565-97768587 TGGAGGATGCTGGGTGAGGTAGG + Intergenic
1121958904 14:98240579-98240601 AGGGAGCAGCTGGGGAAGGCTGG + Intergenic
1122236385 14:100332832-100332854 GGGGAGAAGCTGGTTGGTGTTGG + Intergenic
1122388887 14:101367035-101367057 ATTGAGAAGCTGGGTGGTGTCGG + Intergenic
1122606983 14:102953284-102953306 GGGAAGAGGCTGGCTGAGGTGGG + Intronic
1122874494 14:104657414-104657436 AGGGAGAGGCAGGGTTAGGAGGG - Intergenic
1122976922 14:105174557-105174579 AGGAAGCAGCTGGGTAAGGTCGG - Intronic
1123123283 14:105927922-105927944 AGACAGAAGCCAGGTGAGGTGGG - Intronic
1123587055 15:21770103-21770125 AGGCAGAAGCTGGGTTCTGTGGG + Intergenic
1123623693 15:22212668-22212690 AGGCAGAAGCTGGGTTCTGTGGG + Intergenic
1124100380 15:26687508-26687530 AGGGAGGGGATGGGAGAGGTAGG - Intronic
1124368821 15:29091788-29091810 AGGGATCAGCTGGCTGAGGGAGG + Intronic
1124953652 15:34345815-34345837 AGGGAAAAGTGGGGTGAGGGTGG - Intronic
1124999534 15:34755384-34755406 ATGGAGATGCTGGCTGAGGGAGG + Intergenic
1125818440 15:42606841-42606863 AGAGAGTAGCTGGGTCAGTTAGG - Intronic
1126349041 15:47725544-47725566 AGGGGGAAGGTGAGGGAGGTGGG - Intronic
1126491988 15:49247221-49247243 AGACAGAAGCGGGGAGAGGTGGG + Intronic
1126827838 15:52569111-52569133 CGGGAGAAGCGGGGTCAAGTAGG - Exonic
1127081382 15:55383729-55383751 AGGCGGAAGCTAGCTGAGGTTGG - Intronic
1127845373 15:62866082-62866104 GTGGAGAAGGTGGATGAGGTTGG + Intergenic
1128315138 15:66655180-66655202 AGGGCAAAGCTGGGGGTGGTGGG + Intronic
1128522845 15:68386896-68386918 TGAGAGAAGCAGGGAGAGGTGGG + Intronic
1128676857 15:69615978-69616000 TAGGAGGAGCTGGGTGAGGCGGG + Intergenic
1129104413 15:73296303-73296325 AGGGAGAAGCTGGGCAGGGTAGG - Intronic
1129150598 15:73685172-73685194 AGGGAGGTGGGGGGTGAGGTGGG + Intronic
1129186567 15:73910947-73910969 CGGGAGATGATGGGTGGGGTGGG - Intergenic
1129254388 15:74325869-74325891 AAGGAGGAGCTGGGTTAGGGAGG - Intronic
1129298148 15:74611052-74611074 AGGGAGAATCTGAGGGAGGGAGG - Intronic
1129459586 15:75693821-75693843 AGAGAGAAGCGGGGATAGGTGGG - Intronic
1129665294 15:77576226-77576248 AGGGAGGAGCAGGGGGAGGCTGG + Intergenic
1129714597 15:77839802-77839824 AGGGAGTGGTTGGGTGGGGTGGG - Intergenic
1129999500 15:80034677-80034699 AGGGTGCAGATGGGTGGGGTGGG - Intergenic
1130103497 15:80911976-80911998 TGGGAGAGGCTGGGAGAGCTGGG + Intronic
1130103505 15:80912014-80912036 TGGGAGAGGCTGGGAGAGGCTGG + Intronic
1130103508 15:80912024-80912046 TGGGAGAGGCTGGGAGAGCTGGG + Intronic
1130103521 15:80912081-80912103 TGGGAGAGGCTGGGAGAGCTGGG + Intronic
1130272401 15:82458862-82458884 AGGGAGAAGCAGGGATAGGTGGG + Intergenic
1130464752 15:84186215-84186237 AGGGAGAAGCAGGGATAGGTGGG + Intergenic
1130487933 15:84408589-84408611 AGGGAGAAGCAGGGATAGGTGGG - Intergenic
1130499514 15:84487322-84487344 AGGGAGAAGCAGGGATAGGTGGG - Intergenic
1130587044 15:85190829-85190851 AGGGAGAAGCAGGGATAGGTGGG + Intergenic
1131158268 15:90088310-90088332 AGAGACAAGCTGGGAGAGGAGGG + Intronic
1131480129 15:92773574-92773596 AGGCAGAAGCTGGGTGGAGGAGG - Intronic
1132457481 16:32224-32246 AGGGAGACACTGGGTGGGGTGGG - Intergenic
1132664655 16:1076022-1076044 AGGGAGAGGGAGGGGGAGGTGGG - Intergenic
1132810416 16:1794249-1794271 CGGGAGAGGCAGGGTGAGCTTGG - Intronic
1133255777 16:4514763-4514785 AGGGAGAAGCCGGATGTGGAAGG - Exonic
1134258373 16:12630350-12630372 TGAGAGAAGCTTGGTGTGGTAGG - Intergenic
1135066537 16:19314898-19314920 AGGGAGAAGAAGGGAGAGGAAGG + Intronic
1135649941 16:24197334-24197356 AGGAAGAAGATGAGGGAGGTGGG + Intronic
1136031232 16:27504516-27504538 AGGGAGAAGCGGCGTAGGGTAGG + Intronic
1136064203 16:27747748-27747770 TGGGAGAGGCTGGGAGGGGTGGG + Intronic
1136096467 16:27960621-27960643 ATGGAGAAGCTGAGTGTGGTGGG + Intronic
1136252127 16:29012296-29012318 AGGGAGCAAGTGGGGGAGGTGGG - Intergenic
1136268385 16:29133834-29133856 AGAGGGAAGCTGGAGGAGGTGGG + Intergenic
1137257114 16:46785124-46785146 AGGGAGAAGCTGGGAGTTGGGGG - Intronic
1137447433 16:48540261-48540283 AGGTAGGAGCTGGGGGAGGGCGG + Exonic
1137469021 16:48737993-48738015 ACGGAGAAGCTGGGAGACATCGG - Intergenic
1137547401 16:49413990-49414012 AGGGAGAAGATTGGTCCGGTGGG + Intergenic
1137709037 16:50553907-50553929 AGGCAGAGGCTGGGAGAGCTTGG + Intronic
1139159886 16:64491712-64491734 AGGGAGAATTGGGGTGATGTTGG + Intergenic
1139356284 16:66368740-66368762 AGGTAGAAGCAGGGTGAGTGCGG + Intronic
1139780633 16:69348519-69348541 CGGTAGAAGATGGGTGGGGTGGG + Intronic
1139940337 16:70601007-70601029 TGGGAGATGCTGGGAGAAGTAGG + Intronic
1140196447 16:72859434-72859456 TGGGAGAAGAAGGCTGAGGTGGG - Intronic
1140301758 16:73764803-73764825 AGGGAGAAGCAGGGTGGCTTAGG - Intergenic
1140321022 16:73951832-73951854 AGGGGGAAGCTGGGGGAGAAAGG + Intergenic
1140473497 16:75227383-75227405 AGGAAAAAGCTGGGAGAGGCAGG - Intergenic
1140663400 16:77208921-77208943 GGGGAGAAGCTGGATCAGGATGG + Intronic
1140739134 16:77925840-77925862 AGCCAGAAGCAGGGGGAGGTGGG - Intronic
1141464881 16:84198760-84198782 TGGGAGAATCTGAGGGAGGTGGG + Intergenic
1141631637 16:85291277-85291299 AGGGAGGAGGAGGGTGAGGAGGG - Intergenic
1141655414 16:85413360-85413382 AGGGAGGAGCTGCCTGAAGTTGG + Intergenic
1141664420 16:85458520-85458542 ATGGAGAGGCTGGTTGAGCTGGG + Intergenic
1141665480 16:85463222-85463244 AGGGCGAGGCTGGGTGAGTGCGG - Intergenic
1141833702 16:86524306-86524328 AGGGAGGAGCTGAGAAAGGTGGG + Intergenic
1142071696 16:88094171-88094193 AGAGGGAAGCTGGAGGAGGTGGG + Intronic
1142200690 16:88759877-88759899 AGGGGGAAGCTGTGTGGGGAGGG + Intronic
1142409235 16:89907826-89907848 AGGGAGGAGGGAGGTGAGGTGGG - Intronic
1142416560 16:89946604-89946626 AGGGAGAAGGTGAGTGAGTGAGG + Intergenic
1142626626 17:1196527-1196549 AGGGAGGGGGTGGGTGAGGCAGG - Intronic
1142978009 17:3656641-3656663 TGGGAGAAGCTGGGTGGTGAGGG - Intronic
1142981466 17:3674664-3674686 ACGGAGAACCTGGGTGAAGGCGG - Intronic
1142994113 17:3750909-3750931 AGGAGGAAGCTGGGTGGGCTGGG + Intronic
1143097929 17:4488363-4488385 ATGGAGAAGCTGGGTCAGAGTGG - Intergenic
1143165035 17:4893385-4893407 AGGGAGAAGCTGGGCCTGGGTGG - Intronic
1143532453 17:7513197-7513219 GGTGAGTAGCTGGGTGACGTTGG - Exonic
1143532456 17:7513218-7513240 GGTGAGTAGCTGGGAGAGGTCGG - Exonic
1143532460 17:7513239-7513261 GGCGAGTAGCTGGGAGAGGTGGG - Exonic
1143532465 17:7513260-7513282 GGCGAGTAGCTGGGAGAGGTGGG - Exonic
1143532470 17:7513281-7513303 GGTGAGTAGCTGGGAGAGGTGGG - Exonic
1143532501 17:7513449-7513471 GGTGAGTAGCTGGGGGAGGTGGG - Exonic
1143532542 17:7513638-7513660 GGGGAATAGCTGGGTGATGTTGG - Exonic
1143532547 17:7513659-7513681 GGGGAGTAACTTGGTGAGGTCGG - Exonic
1143625237 17:8106094-8106116 AGCGAGAGGCTGGGAGAGGTGGG + Intronic
1143918264 17:10310724-10310746 CGGGAGATGCTGGGTGTGTTTGG + Intronic
1144154473 17:12485661-12485683 ATGGTGAAGCTGTGTCAGGTTGG - Intergenic
1144165188 17:12603942-12603964 TGCGAGAAACTGGGTGAAGTGGG - Intergenic
1144218582 17:13079683-13079705 AGGCAGAAGATGCCTGAGGTGGG - Intergenic
1144410445 17:14995366-14995388 GGGAAGAAGTTGGGTGAGATGGG + Intergenic
1144686879 17:17231968-17231990 AGGGAGACCCTGGGTGTGGCTGG + Intronic
1144950256 17:18990080-18990102 AGGGAGTAGCTGGTTGATGCAGG + Intronic
1145209576 17:21003319-21003341 GGGGAGAGGCTGTGGGAGGTTGG - Intronic
1145320810 17:21766214-21766236 CGAGAGAAGCTGGGGGAAGTAGG + Intergenic
1145814302 17:27784394-27784416 AAGGAGCTGCTGGGTGAGGTGGG + Intronic
1145976349 17:28986354-28986376 AGGGCCCAGCTGGGTGAGGGTGG + Intronic
1146964189 17:37010868-37010890 AGGCGGAAGGTGGGTTAGGTTGG + Intronic
1147222010 17:38940487-38940509 AGGGAGAGGCTAGGTAAGGAAGG - Intronic
1147717986 17:42520914-42520936 AGGGAGGCTCGGGGTGAGGTGGG + Intronic
1147742272 17:42676120-42676142 AGGGAGAGGCAGGGCCAGGTCGG + Intronic
1147928637 17:43961980-43962002 AAGGAAAAGATGCGTGAGGTAGG - Intronic
1148153908 17:45411929-45411951 AGGGAGGAGCTGGGTGGAGAGGG + Intronic
1148529819 17:48378913-48378935 AGGGACAAGCTTGGAGAGGCAGG + Intronic
1148554872 17:48572502-48572524 AGGGAGAAGATATGAGAGGTTGG - Intronic
1148905870 17:50911798-50911820 AGGCAGAAGCTCGGTGGGGAGGG + Intergenic
1149444349 17:56702028-56702050 AGGGAGACACTGAGTGATGTTGG - Intergenic
1149600684 17:57891246-57891268 GGGGAGAAGCAGGTTGGGGTCGG - Intronic
1150481836 17:65516863-65516885 AGGGAGAAAATGGGGGAGGAGGG + Intergenic
1150578608 17:66452418-66452440 GGGAAGAAGCAGGGTGAGGAGGG + Intronic
1150888891 17:69121608-69121630 AGGGAGAAGTTGGGGGAAGGTGG + Intronic
1151216346 17:72579341-72579363 ATGAAGAAGGTGTGTGAGGTTGG - Intergenic
1151399288 17:73845159-73845181 ATGGAGAAGCTGTGTGATGCTGG - Intergenic
1151768584 17:76145167-76145189 AGGCAGCAGCTGAGTGAGGATGG + Exonic
1151948222 17:77330907-77330929 AGGGACAAGCTGTGTGGGGCTGG - Intronic
1152007008 17:77688625-77688647 AGGGGAAGGCTGGGGGAGGTGGG - Intergenic
1152213620 17:79018997-79019019 AGGTTGAAGGTGGGTGAGGTAGG - Intergenic
1152541607 17:80979567-80979589 AGGAAGAAGCCCGGGGAGGTGGG - Intergenic
1152702871 17:81828208-81828230 AGGAAGAAGTAGGGAGAGGTGGG - Intronic
1152814007 17:82397017-82397039 AGGGAGCAGCTGAGGGAGGCAGG + Intronic
1152941677 17:83176048-83176070 AAGGGGAGGCTGGGTGAGCTTGG - Intergenic
1152961498 18:83033-83055 AGGGAGACACTGGGTGGGGTGGG - Intergenic
1153545721 18:6203273-6203295 AGGGAAACGCTGATTGAGGTAGG + Intronic
1153886926 18:9475544-9475566 AGGCAGAGGCTGGGCGGGGTGGG + Intronic
1154497883 18:14975585-14975607 AGGGAGAAGCGGGGCCAGGCTGG + Intergenic
1156248826 18:35331228-35331250 AGGGAGAAGCTGGATCATGGAGG - Intergenic
1156555452 18:38062943-38062965 AGGGAGAAGTTGTTTCAGGTGGG - Intergenic
1156900902 18:42299374-42299396 AGGCAAAATCTGGGTGAGGCTGG + Intergenic
1157442045 18:47718940-47718962 AGGGAGGAGATGGCTGAGGCTGG - Intergenic
1157584642 18:48793247-48793269 AGGGAGAAGCAGGGAGGGGCAGG + Intronic
1157599980 18:48887907-48887929 AGGAAGAGGATGGGAGAGGTGGG - Intergenic
1157645130 18:49261250-49261272 TGGGGGATGCTGGGTGATGTGGG - Intronic
1157687868 18:49657361-49657383 AGGCAGCAGCAGGGTGAGGATGG - Intergenic
1157991769 18:52504800-52504822 CTGGAGAAGCAGGCTGAGGTTGG - Intronic
1159673370 18:71251002-71251024 GGGGAGAAGGTGGGGGAGGAAGG + Intergenic
1159915386 18:74183143-74183165 AGGGAGAGGAGGGGAGAGGTCGG - Intergenic
1159957101 18:74526402-74526424 AGGGAGGACTTGGGAGAGGTGGG - Intergenic
1160011389 18:75109284-75109306 TGGGAGGAGCTGGCTGGGGTCGG - Intergenic
1160629834 18:80239132-80239154 AGGGAGAATAAGGGAGAGGTGGG + Intronic
1161208177 19:3053209-3053231 TGGGAGGAGCAGGGTGAGGGTGG - Exonic
1161305710 19:3566417-3566439 AGGGAGAGTCAGGGTGTGGTTGG - Intronic
1161370954 19:3910728-3910750 AGGGAGGAGCTGGGTGGGACGGG - Intronic
1161606409 19:5217119-5217141 AAGGAGAAGCTGGGGGAGCAGGG + Intronic
1161619575 19:5291047-5291069 AGGGAGGGGCTGGGTGGGGCTGG + Intronic
1161684938 19:5697989-5698011 AAGGAGCAGCTGGGTGAAGGTGG - Intronic
1161684978 19:5698120-5698142 TGGGAGGAGCTGGAGGAGGTGGG - Intronic
1161957941 19:7506664-7506686 AGGGAGGAGCTGGAGGAGGACGG - Intronic
1162031262 19:7918143-7918165 TGGAGGGAGCTGGGTGAGGTAGG + Intronic
1162145685 19:8611148-8611170 AGGAAGGGGCTGAGTGAGGTGGG + Intergenic
1162379479 19:10323135-10323157 GGGGGGAAGCAGGGTAAGGTGGG - Exonic
1162467154 19:10849124-10849146 AGGGAGGGGGTGAGTGAGGTGGG - Intronic
1162869693 19:13576138-13576160 TGGGACAAGGTGAGTGAGGTGGG - Intronic
1163099773 19:15087849-15087871 TGGGAGGAGCTGGGGGATGTGGG - Exonic
1163428011 19:17249803-17249825 AGGGAGATGCTGGGTTTGGCTGG - Exonic
1163559538 19:18010540-18010562 AGAGACAGGGTGGGTGAGGTTGG - Intronic
1163717382 19:18880021-18880043 AAGGATAAGCCAGGTGAGGTGGG - Intronic
1163728952 19:18938939-18938961 AGGGCCAGGCTGGGGGAGGTGGG + Intronic
1164418341 19:28065138-28065160 AGAGAGAAGCTCTATGAGGTTGG - Intergenic
1164537991 19:29100658-29100680 AGGGAGAAGCTGAGAGAAGATGG - Intergenic
1164631065 19:29761759-29761781 AGGCACAGGCTGGGTGAAGTGGG + Intergenic
1165264927 19:34653198-34653220 AGGAAGTAGTTGGGGGAGGTGGG + Intronic
1165284148 19:34825349-34825371 AGGGAGAAACTGGGGAAGGCTGG - Intergenic
1165421310 19:35723327-35723349 AGGCAGAAGAGGAGTGAGGTAGG - Intronic
1165631518 19:37305580-37305602 AGGGAGAAACTTCGTGAGGATGG - Intergenic
1165992789 19:39825855-39825877 GGGCAGGCGCTGGGTGAGGTGGG + Exonic
1166119091 19:40674277-40674299 AGGGAGGAGCTACTTGAGGTGGG - Intronic
1166213261 19:41320619-41320641 AGGAAGAGGCTGGGTGACCTCGG + Intronic
1166390719 19:42407481-42407503 AGGGAGACGGTGTGTGAGGTTGG + Intronic
1166631354 19:44410457-44410479 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1166636816 19:44458137-44458159 GAGAAGAAGCTGGGTGAGGCAGG + Intergenic
1166665959 19:44680611-44680633 AGTGAGGAGCTGGGTGTGGGGGG - Intronic
1166696056 19:44851947-44851969 AGGGAGAAGCTGGGAGGGTTGGG - Intronic
1166863501 19:45822851-45822873 AGGGAGAAGGTGGTGGGGGTGGG + Intronic
1166888478 19:45975372-45975394 AGGGAGGAGCAGGGGGGGGTTGG - Intergenic
1166979729 19:46625353-46625375 AGGGAGACACTGGGGGAGGGAGG - Intergenic
1167149249 19:47699393-47699415 AAGGAGAAGCCGGGTGAGAGGGG + Exonic
1167602900 19:50464949-50464971 AGGGAGAGGCAGGGGCAGGTGGG - Intronic
1167714098 19:51129932-51129954 GGGCAGAAGCTGGGGGAGGCTGG - Intronic
1168080778 19:54008589-54008611 AGAGAAAAGCTGAGTGTGGTGGG - Intronic
1168190623 19:54735940-54735962 AGGGAAATGCTGAGTGAGGGAGG - Intronic
1168192845 19:54752336-54752358 AGGGAAATGCTGAGTGAGGGAGG - Intronic
1168197182 19:54783606-54783628 AGGGAAATGCTGAGTGAGGGAGG - Intronic
1168202980 19:54830048-54830070 AGGGAAATGCTGAGTGAGGGAGG - Intronic
1168202984 19:54830068-54830090 AGGGAAATGCTGAGTGAGGGAGG - Intronic
1168205540 19:54847871-54847893 AGGGAAATGCTGAGTGAGGGAGG - Intronic
1168208013 19:54866491-54866513 AGGGAAATGCTGAGTGAGGGAGG - Intronic
1168462737 19:56573385-56573407 ACTGACTAGCTGGGTGAGGTTGG - Intronic
1202648894 1_KI270706v1_random:163157-163179 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1202649372 1_KI270706v1_random:166431-166453 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1202713283 1_KI270714v1_random:28755-28777 GGGGGGAAGCTGGGTGGGGGTGG + Intergenic
926707094 2:15844616-15844638 TGGCCGAAGCTGGGTGGGGTGGG - Intergenic
926740112 2:16103440-16103462 AGCTAGGAGCTGGGTGTGGTGGG - Intergenic
927220332 2:20701860-20701882 ATGGAGAAGCCAGATGAGGTTGG - Intronic
927393281 2:22620511-22620533 AGGGAGAAACTAGATGAGGATGG + Intergenic
927876473 2:26658707-26658729 AGGCAGCTGATGGGTGAGGTGGG - Intergenic
927886703 2:26723272-26723294 AGGGAGATGCGGGGTGGGGATGG - Intronic
928314710 2:30236292-30236314 AGGAAGGAGCTGGGGGAGGAAGG + Intronic
928905311 2:36361452-36361474 AGTGAACAGCTGGGTGAGGCAGG + Intronic
929316329 2:40483392-40483414 AGGGAGAGGGTGGGTGAGATAGG + Intronic
930052655 2:47228600-47228622 AGGGAGAATCTGGGGTAGATAGG + Intergenic
930054039 2:47238447-47238469 AGGGATCAGCTGCTTGAGGTGGG + Intergenic
930103118 2:47618140-47618162 AGGCACCAGCTGGGTGAGGAGGG + Intergenic
930896389 2:56451710-56451732 AGGAAGAAGCTGGGGAGGGTGGG - Intergenic
931913746 2:66930433-66930455 AGGGAAAAGCAGTGAGAGGTTGG + Intergenic
932127383 2:69156370-69156392 AGGAAGATGCTGGGTGAGAAAGG - Intronic
932417907 2:71584739-71584761 GGGGAGAAGCTGGGAGAGGCTGG + Intronic
932577085 2:72968543-72968565 AGGCAGAAGCTGTGTGAGAGGGG + Intronic
933723051 2:85410347-85410369 AGTGAGAAGCCGGGTGGGGCAGG - Exonic
933984003 2:87575620-87575642 AGGGAGGCACTGGGTGAGGAAGG - Intergenic
934876368 2:97924510-97924532 AGGGAGATGGTGGCTGAGCTGGG - Intronic
935631789 2:105218155-105218177 AGGGAGACCCTGGGTGAGGCTGG - Intergenic
935678535 2:105616986-105617008 AAGGAAAAGCTGCCTGAGGTTGG - Intergenic
936309851 2:111375176-111375198 AGGGAGGCACTGGGTGAGGAAGG + Intergenic
936482401 2:112896793-112896815 AGGGAGAGGTGGGGTGAGGTGGG + Intergenic
936611345 2:114004973-114004995 AGAGAGAAGCTGAGCGAGGCAGG - Intergenic
936946975 2:117939902-117939924 GGGGTGAAGCTGGGTGAAGTGGG + Intronic
937202244 2:120211297-120211319 GGGTAGAAGCTGGAGGAGGTTGG - Intergenic
937911099 2:127075970-127075992 GGGGAGCAGCTGGGAGAGCTGGG - Intronic
938137873 2:128774143-128774165 AAGGAGAAGATGGATGAGCTCGG + Intergenic
938380189 2:130832135-130832157 AGGGAGGAGGTGGGGGAGGAGGG - Intergenic
938537092 2:132256291-132256313 AGGGAGCAGCTTGGGGTGGTGGG + Intronic
938540798 2:132282138-132282160 AGGGAGAAGCTGGGTGAGACAGG + Intergenic
938541628 2:132288041-132288063 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
938563314 2:132494293-132494315 AAGGAGAGGCTAGGAGAGGTAGG - Intronic
939057053 2:137378734-137378756 AGGGAGTGGTTGGGGGAGGTGGG - Intronic
940383339 2:153042098-153042120 AGGAAGAGGCTGGGTGCAGTGGG + Intergenic
940463288 2:153995811-153995833 AGGGAGAAGGTGGGAGTGGTAGG - Intronic
940681711 2:156794123-156794145 AGAGGGGAGCTGGCTGAGGTTGG - Intergenic
940887158 2:159000099-159000121 AGGGAGTAGCCAGGTGAGGTGGG + Intronic
941678324 2:168367957-168367979 AGGGAGAGGCTGAGTGCTGTGGG + Intergenic
942173671 2:173310657-173310679 AGGGAGAGGTTGGGTTGGGTGGG + Intergenic
942457102 2:176145813-176145835 AGGGAGAGGCTGGGTGGGTTTGG - Intergenic
943908035 2:193525541-193525563 GGGGAGATGATGGGGGAGGTTGG + Intergenic
946013431 2:216584837-216584859 AGGGCTGAGCTGGGTGAGGAGGG + Intergenic
946096328 2:217277534-217277556 TGGGAAAAGCTGGGTGAAATAGG - Intergenic
946110127 2:217407800-217407822 AGGTAGCAGCAGGGTGGGGTAGG - Intronic
946238803 2:218341614-218341636 AGGGACTTACTGGGTGAGGTAGG - Exonic
946238948 2:218342162-218342184 AGAGAGGAGCTGGGAGAGGAGGG + Intronic
946353730 2:219172131-219172153 TGGGAGCTGCTGGGTGAGGCAGG - Intronic
946831861 2:223735616-223735638 AGGGAGAGGCTAGGGGAGGTAGG + Intergenic
947594082 2:231399932-231399954 CTGGAGAAGCAGGGTGCGGTGGG - Exonic
947872955 2:233449817-233449839 AGGGGGAAGATGGGTGGGGGTGG + Intronic
947946322 2:234106052-234106074 GGGGAGAAGCTGGGAGGAGTAGG - Intergenic
948468016 2:238161416-238161438 GGGGAGAAGCTGTGAGGGGTTGG + Intronic
948609533 2:239157991-239158013 AGCGAGAAGCTGCTTGGGGTTGG - Intronic
948694317 2:239725544-239725566 AGGGAGAAGGTGAGTGAGGGAGG + Intergenic
948867832 2:240784417-240784439 AGGGTGAAGCTGGACGAGGTCGG - Intronic
949060342 2:241953224-241953246 AGGGAGAAGGGGGGAGAGGGAGG + Intergenic
1168919405 20:1518522-1518544 AGGGGGGTGCTGGGAGAGGTTGG + Intergenic
1169756709 20:9050643-9050665 ATGATGAAGCTGAGTGAGGTAGG - Intergenic
1169825629 20:9765654-9765676 AGGGAGAAGCAGGGAGAGGGCGG - Intronic
1170365039 20:15588881-15588903 AGGCAGAGGCTGGGAGAGTTTGG - Intronic
1170793936 20:19530413-19530435 AGGGAGAATCTGGGTGGGTGAGG + Intronic
1170877795 20:20267202-20267224 AGAGAGAGGCTGGGGGAGTTTGG + Intronic
1170906455 20:20519405-20519427 AGGCAGTGGCTGGGTGAGGGAGG - Intronic
1170980476 20:21207499-21207521 AGAGAGAAGGTGGGTGAAGTGGG - Intronic
1171138460 20:22719555-22719577 AGGGAAAAGCAGGGTGGGGTGGG + Intergenic
1171508803 20:25662471-25662493 AGAGAGAAGTAGGGTGGGGTGGG + Intergenic
1171756582 20:29115295-29115317 AGGGAAAGGCTGGGAGTGGTGGG - Intergenic
1171768390 20:29302153-29302175 AGGGATAAGCTGGGGGGGGAAGG + Intergenic
1171768399 20:29302174-29302196 GGGGGGGAGCTGGGCGAGGTAGG + Intergenic
1171866005 20:30488070-30488092 AGGGAGCAGCTCGGGGTGGTGGG + Intergenic
1171869706 20:30515139-30515161 AGGGAGAAGCTGGGTGAGACAGG + Intergenic
1171870493 20:30520917-30520939 AGGGAGAAGCTGGGTGAGACAGG + Intergenic
1172062258 20:32194668-32194690 AGACAGAAGGTGGGTGAGGGAGG + Exonic
1172312882 20:33931872-33931894 AGGGTGAAGCCAGGTGGGGTGGG + Intergenic
1172596265 20:36153271-36153293 AGGGAGGAGTTGGGGGAGGGAGG + Intronic
1172697222 20:36831228-36831250 GGGGTGAAGATGGGTGAGTTTGG - Intronic
1173001570 20:39109517-39109539 CGGGAGGAGGAGGGTGAGGTGGG + Intergenic
1173187100 20:40848625-40848647 AAGCAGAGGCTGGGTGGGGTGGG + Intergenic
1173203053 20:40968218-40968240 AGTCACAAGCTGGGCGAGGTGGG - Intergenic
1173224942 20:41156940-41156962 AGGAAGATGAAGGGTGAGGTTGG + Intronic
1173365700 20:42382685-42382707 AGGGAGAATCGGGGTATGGTGGG + Intronic
1173480825 20:43397987-43398009 AGGGAGAATCTGGGAGCCGTGGG - Intergenic
1173896835 20:46557565-46557587 AGGGAGAAGGTGGGAGCGATGGG - Intergenic
1173993724 20:47322145-47322167 ACAGGGAGGCTGGGTGAGGTGGG - Intronic
1174051676 20:47771524-47771546 AGGGAAGAGCTGGGGGAGGTTGG - Intronic
1174052089 20:47773997-47774019 AGGGGCAAGCTGGCTGAGGACGG - Intronic
1175491697 20:59384421-59384443 AGGGAGGATGTGGGGGAGGTGGG + Intergenic
1175499083 20:59436781-59436803 AGGGAGAGGCAGGGTCAGGAAGG + Intergenic
1176031684 20:63015971-63015993 AGGGAGAGGCAGGGAGAGGCAGG - Intergenic
1176031687 20:63015981-63016003 AGGGAGAGGCAGGGAGAGGCAGG - Intergenic
1176031690 20:63015991-63016013 AGGGAGAGGCAGGGAGAGGCAGG - Intergenic
1176031693 20:63016001-63016023 AGGGAGAGGCAGGGAGAGGCAGG - Intergenic
1176031696 20:63016011-63016033 AGGGAGAGGCAGGGAGAGGCAGG - Intergenic
1176132135 20:63500632-63500654 AGAGACCAGCTGGGTGGGGTGGG - Intergenic
1176191006 20:63809543-63809565 AGGGAGAAGAGGGGAGAGGAAGG - Intronic
1176304050 21:5114224-5114246 ATGGAGCAGCTGGGAGTGGTGGG + Intergenic
1176602449 21:8806115-8806137 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1176602928 21:8809384-8809406 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1176611894 21:8991218-8991240 AGGGAGAAGCTGGCTGAGGCAGG - Intergenic
1177036645 21:16052171-16052193 TGAGAGAAGCTAGGTGTGGTGGG + Intergenic
1177639004 21:23821917-23821939 AGGGAGAAGTTGGCTGAGCGCGG - Intergenic
1178608319 21:34058219-34058241 AGGGGCACGCTGGCTGAGGTGGG + Intergenic
1178619039 21:34158403-34158425 CGGGAGAAGGTGGCTGAAGTGGG + Intergenic
1178824667 21:36005031-36005053 AGGGAGAGGCAGGGGGAGGGGGG + Intergenic
1179077420 21:38136007-38136029 AGGGAGGAGAGGGGTTAGGTGGG + Intronic
1179099780 21:38346456-38346478 AGGGTGAAGCTGGGAGAAGTTGG + Intergenic
1179680855 21:43020373-43020395 AGGGAGACGCTGTGTGAGGGAGG + Intronic
1179780391 21:43696438-43696460 AGGCTGCAGCTGGGTGAGGCGGG + Intergenic
1179885851 21:44314004-44314026 TGTGAGAGGCTGGGTGAGGTGGG + Exonic
1180313230 22:11254857-11254879 AGGGATAAGCTGGGGGATGAAGG + Intergenic
1180344734 22:11697668-11697690 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180345214 22:11700941-11700963 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180352557 22:11816662-11816684 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180352994 22:11819182-11819204 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180385698 22:12175695-12175717 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180600084 22:17009773-17009795 AGGGAGACACTGGATGAGGTGGG + Intergenic
1181163072 22:20968917-20968939 AGGGAGAACTTGGGCGAGGGAGG + Intronic
1181386272 22:22548173-22548195 AGGGAGTTGCTGTGTGAGTTGGG - Exonic
1182490092 22:30665928-30665950 AGGGAGGGGCTGGGTGGGGATGG + Intronic
1182499401 22:30734898-30734920 AGTAAGAGGCTGGGTGTGGTTGG + Intronic
1182738288 22:32546835-32546857 AGGGAGAAGAGGGGCGAGGGAGG - Intronic
1182748162 22:32621677-32621699 AGGGAGACCTTGGGTGAGGTAGG - Intronic
1182931289 22:34176661-34176683 TGGGAGGAGCTGGGGGAGCTCGG + Intergenic
1183031971 22:35113326-35113348 AGGGAGGAGCTTTGTGAGGAAGG - Intergenic
1183172701 22:36199490-36199512 AGAAAGAATCTGGGTTAGGTTGG - Intronic
1183336194 22:37248174-37248196 AGGGAGAAACAGGGAGAGGTGGG - Intergenic
1183361298 22:37384658-37384680 AGTGGGAAGCGGGGTCAGGTGGG - Intronic
1183361314 22:37384699-37384721 AGTGGGAAGCGGGGTCAGGTGGG - Intronic
1183737869 22:39653861-39653883 AAGGAGGGGATGGGTGAGGTAGG + Intronic
1183978933 22:41528452-41528474 AAGGAGAAGGTGGGTGTGGGTGG - Exonic
1184155415 22:42663576-42663598 TGGGAGCTGCTGGGTGAGGAAGG + Intergenic
1184212496 22:43044110-43044132 AGGGAGAAGATGGGGGTGGGTGG - Intronic
1184320612 22:43739777-43739799 GGGGAGAAGCGGGGTGGGGGTGG - Intronic
1184505596 22:44899574-44899596 AAGAAGAGGCTGGGTGTGGTAGG - Intronic
1184738333 22:46412102-46412124 AGGGAGAAGCTGCGTGACCGCGG + Intronic
1184952878 22:47857247-47857269 AGGGAAAGGATGTGTGAGGTTGG - Intergenic
949710197 3:6862731-6862753 AGGGAGATAGTGGGTGAGGGGGG - Intronic
949900943 3:8814365-8814387 AGGGAGCATCTGGGAGAGGAGGG - Intronic
950525909 3:13523174-13523196 AGGGGGAAGCTGGGCGGGGCTGG - Intergenic
950887781 3:16375916-16375938 GGGGAGATTCTGGGTGAGGAAGG + Intronic
951815566 3:26750426-26750448 AGTGAGGATCTGGCTGAGGTGGG - Intergenic
951868512 3:27334050-27334072 AGGGTGAAGCTGGGCTAGGCTGG - Intronic
953118764 3:40018685-40018707 AGGTAGAAGCTGTGAGAGGAAGG - Intronic
953121169 3:40044057-40044079 AAGCAGAAGCTGGATGAGGAAGG + Exonic
953429737 3:42829416-42829438 AGGGAGAAAATGGGAGTGGTAGG + Intronic
953564181 3:44016966-44016988 AGGGAGCAGCTGGGGCAGGGAGG - Intergenic
953888595 3:46734170-46734192 AAGGGGAAGCTGGTAGAGGTAGG - Exonic
954035585 3:47849336-47849358 AGGCAGCACCTGGATGAGGTTGG - Exonic
954286541 3:49623617-49623639 AGTGTGAAGCTGGGTGGGGCTGG - Intronic
954317638 3:49809934-49809956 AGGGCTGAGCTGGGTGGGGTGGG + Intronic
954389375 3:50260739-50260761 AGGGAGGCACTGGGTGAGTTAGG - Intergenic
954415905 3:50393246-50393268 AGGGAGGAGCAGGGTGGGGGTGG - Intronic
954517382 3:51190801-51190823 AGGTGGGAGCTGGGTCAGGTAGG + Intronic
955058283 3:55474802-55474824 AGGTAGGAGGTGGGGGAGGTTGG + Intronic
956693113 3:71895842-71895864 AGAGAGAAGATGGGTGGGGTAGG + Intergenic
956753338 3:72362569-72362591 AGGCAGAAAATGGATGAGGTGGG - Intergenic
959369880 3:105510135-105510157 AGGAAGAAGATGGGGGTGGTCGG + Intronic
960001733 3:112739410-112739432 AGGGAGAGGCTGAGTGAGTCAGG - Intergenic
961040716 3:123676151-123676173 TGGGAGACACTGGGTGAGTTGGG + Intronic
961660446 3:128466028-128466050 AGTGAGAAGCTATGGGAGGTGGG - Exonic
961924032 3:130457552-130457574 TAGGAGAAACTGGGTGGGGTAGG - Intronic
962420083 3:135220207-135220229 AGAGAGCAGCTGAGTGAGGAAGG + Intronic
963044938 3:141095433-141095455 AGGGAGCAGGTGGGTGAGTGGGG - Intronic
964205575 3:154171281-154171303 GGGTAGAAGCTGTGTGGGGTGGG - Intronic
965547879 3:169934053-169934075 AGGGCCAAGGTGGGAGAGGTGGG + Intronic
966174391 3:177119828-177119850 ATGTAGAAAATGGGTGAGGTTGG - Intronic
966930579 3:184673052-184673074 AGGGAGGAGCTGGGTGGGCCGGG + Intronic
966955471 3:184873330-184873352 AGGGAGAAGATGAGTGAGAAGGG + Intronic
967977663 3:195044520-195044542 GGGGAGTAGCTGGGTGAGGAGGG - Intergenic
968139940 3:196247580-196247602 TGGGAGAAGATGGGAGAGGTCGG - Intronic
968615053 4:1573949-1573971 AGGGAGGAGCTGGATGAGGGAGG - Intergenic
968697851 4:2041542-2041564 AGGGAAAAGCCGGGCGAGGGCGG + Intronic
968938356 4:3625078-3625100 AGGAAGGAGCAGGGTGAGATGGG + Intergenic
968957775 4:3728002-3728024 AGGGAGAGGCTGGGGGACGTGGG - Intergenic
969537363 4:7764857-7764879 TTGGAGAGGCTGAGTGAGGTGGG + Intronic
969967438 4:11011753-11011775 GGGGAGGAGCTGGGGGAGGCAGG - Intergenic
970344862 4:15143707-15143729 AGGGAGAGGCAGGGGGAGTTTGG - Intergenic
970762495 4:19507839-19507861 AGGGAGAAGCCTGGTAAGATTGG + Intergenic
971258009 4:25031106-25031128 AGGGAAAAGTTGGGTGACCTTGG + Intergenic
971370830 4:26017457-26017479 ATGGAGAAGTTGGTTGGGGTTGG - Intergenic
971945533 4:33271385-33271407 AGGAAGAAGCAGCGTGAAGTGGG + Intergenic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972999168 4:44924531-44924553 AGGGAGAAAATGGGTGAGTCAGG - Intergenic
973375099 4:49280976-49280998 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973375998 4:49286998-49287020 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973376923 4:49293161-49293183 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973377843 4:49299316-49299338 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973378787 4:49305596-49305618 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973379431 4:49310058-49310080 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973380304 4:49316054-49316076 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973381227 4:49322220-49322242 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973382312 4:49329265-49329287 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973385851 4:49513877-49513899 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973750378 4:54012231-54012253 AGGAAAAAGCTGGGTGTAGTGGG - Intronic
973750788 4:54019723-54019745 AGGCAGAAGATGGGTCAGATGGG - Intronic
973851635 4:54966688-54966710 TGAGAGATGCTGGCTGAGGTTGG - Intergenic
976367364 4:84246000-84246022 AGACAGAAGGTGGGTGAGGGAGG - Intergenic
977795903 4:101164212-101164234 AGGGAGTGGCAGGGTGAGGGTGG - Intronic
978233055 4:106424096-106424118 AGGGAGAGGCTGAGGGATGTAGG + Intergenic
979343335 4:119555041-119555063 AAGAAGCAGCTGGGTCAGGTTGG - Intronic
979584842 4:122403800-122403822 AGATAGAAGCAGGGTTAGGTGGG + Intronic
980379587 4:131994802-131994824 AGGGAGAATCTAGGGGAGGGGGG - Intergenic
980894175 4:138845527-138845549 AGGGAGACACTGGGAGAGGAGGG + Intergenic
981622303 4:146715623-146715645 TGGGAGAAGGTGGGAGATGTTGG + Intronic
982473839 4:155826378-155826400 AGGGAGAAACTGTGAGAGATGGG - Intergenic
982845499 4:160247049-160247071 AGGTAGGGGCTGGGTCAGGTGGG + Intergenic
983877771 4:172896934-172896956 AGGGACCTGCTGGGAGAGGTGGG - Intronic
984623719 4:181981618-181981640 AGGTAGAAGCTGGAAGGGGTTGG + Intergenic
985178648 4:187231303-187231325 AGGGAGAAGGTGTGTGAGTTCGG + Intergenic
985777315 5:1851571-1851593 ACGGAGGAGATGGGGGAGGTGGG - Intergenic
985904989 5:2827438-2827460 AGGCAGAAGGTTGGTGGGGTTGG + Intergenic
986013838 5:3740563-3740585 CGGGAGAATCTGGGGGAGGGAGG + Intergenic
987955539 5:24735175-24735197 AGGGAGAATCCGGATGTGGTAGG + Intergenic
988777964 5:34494223-34494245 AGGGAGGAGCTGAGAGAGGTGGG + Intergenic
988960546 5:36366802-36366824 TGGTTGAAGCTGGGTGAGGAAGG - Intergenic
990115088 5:52380324-52380346 GGGGAGACGCTAGGTGAGGATGG - Intergenic
990708862 5:58561161-58561183 AGGATGGAGCTGGGTGAGCTTGG - Intergenic
992065603 5:73104798-73104820 AGGTGGAGGCTGGGTGAGGTGGG + Intergenic
992323455 5:75636855-75636877 GGGGAGCAGGTGAGTGAGGTAGG + Intronic
993029861 5:82693792-82693814 AAAGAGAAGCTGTGTGAGCTTGG + Intergenic
994403449 5:99313463-99313485 AGTGAGAAACTGGGAGAGCTAGG - Intergenic
994421258 5:99528108-99528130 AGGGAGAGGCTGGAACAGGTTGG - Intergenic
994485783 5:100386206-100386228 AGGGAGAGGCTGGAACAGGTTGG + Intergenic
995731290 5:115244876-115244898 AAGGATAGGCTGGGTGCGGTGGG - Intronic
996590895 5:125146931-125146953 AGGGAGAAGCAGGGAGAAGCAGG - Intergenic
997444124 5:133928902-133928924 AGGGAGCAGCTGGCTGAGGGAGG - Intergenic
997848951 5:137313698-137313720 AGGCAGCAGCTGGGTAGGGTAGG - Intronic
998443747 5:142182653-142182675 AGGGAAAAGCTGGGGCAGGTTGG + Intergenic
999275292 5:150325898-150325920 AGGGAAAAGGTGAGTGAGGCAGG - Intronic
999296537 5:150462959-150462981 AGGGAGAAGGGAGATGAGGTGGG + Intergenic
999429082 5:151510690-151510712 AGGGAAATGCTGGGAGGGGTGGG + Intronic
999498680 5:152125246-152125268 AGGGAGAAGCTAAGTGGTGTGGG - Intergenic
999589132 5:153124539-153124561 GGGGAGATGCGGGGAGAGGTGGG + Intergenic
1000230075 5:159307619-159307641 AGGGAGAAGCTGTGTGCCTTGGG - Intergenic
1001237808 5:170044821-170044843 ATGGAGAAGCTGGGGGAGGTAGG - Intronic
1001303147 5:170552595-170552617 AGGGAGAAGGGGAGTGAGGGTGG + Intronic
1001342161 5:170857410-170857432 CTAGAAAAGCTGGGTGAGGTCGG + Intergenic
1001391014 5:171379309-171379331 TGGGAAGAGGTGGGTGAGGTTGG + Intergenic
1001579935 5:172791576-172791598 ATGAAGAAGCTGGGTGTGGGTGG - Intergenic
1001798318 5:174520507-174520529 AGGGAGAGGCGGGGAGAGGAGGG - Intergenic
1002021842 5:176368648-176368670 AGCTAGAAGCAGGGTGGGGTGGG + Intronic
1002191323 5:177479260-177479282 TGGGAGAAGATGGGAGAAGTTGG - Intergenic
1002414131 5:179109955-179109977 AGGGAGAAGCAGGGGTAGGAAGG - Intergenic
1002542592 5:179915867-179915889 AGGGTGAATCTGGATGAGGAGGG - Intronic
1002682932 5:180982165-180982187 AGGGAGAGGCTGGGAGAGCCGGG + Intergenic
1003129972 6:3386978-3387000 GGTGAAAATCTGGGTGAGGTTGG - Intronic
1003287007 6:4743143-4743165 AGAAAGAAGTTGGGTGAGATGGG + Intronic
1003505186 6:6734776-6734798 AGGGAAAGACTGGGTGAGGGTGG - Intergenic
1003534766 6:6967138-6967160 GGGGAGAAGCTGGGTGTGTAAGG - Intergenic
1003598746 6:7499218-7499240 ATGGTGAAGCTTGGTGAGGAAGG - Intergenic
1003888245 6:10540273-10540295 AGTGAGAAGCCTGGAGAGGTAGG - Intronic
1003992281 6:11498194-11498216 AGGGAGAAGGAGGGTTAGTTAGG - Intergenic
1004049610 6:12063482-12063504 AGGGAGGAGCTGGCTCATGTTGG + Intronic
1004468373 6:15906584-15906606 AGTGAGAAGGTGGGGGAGGAAGG - Intergenic
1006184095 6:32170660-32170682 GGTGATGAGCTGGGTGAGGTGGG - Exonic
1006300313 6:33190592-33190614 AGAGTGGAGCTGGGTGGGGTGGG + Intronic
1007349191 6:41256202-41256224 AGGTAGAAGCCAGCTGAGGTGGG - Intergenic
1007585435 6:42986256-42986278 GAGGAGAAGCTGGGGGAGGCTGG - Intronic
1007786173 6:44280686-44280708 AGGGGGAAGCTGAGAGAGGGTGG + Intronic
1007913263 6:45536838-45536860 AGAGAGATGCTGGTTGAGGTAGG - Intronic
1008077388 6:47159328-47159350 AGGCAGAAGCTGGATCATGTGGG + Intergenic
1009749449 6:67864733-67864755 AGGAAGAAGCTGGGCAAGGCAGG - Intergenic
1010348383 6:74840494-74840516 AGGCAGAGGCTGGAAGAGGTTGG + Intergenic
1010988556 6:82453657-82453679 AGGAATTAGCTGGGTGTGGTGGG - Intergenic
1011394496 6:86891886-86891908 AGGTAGGGGCTGGGTCAGGTGGG - Intergenic
1011633752 6:89352303-89352325 AGGGAGAGGCTGGGTGCTGCGGG + Intronic
1011642649 6:89430533-89430555 AGGCAGAAGGAGGGTGAGCTAGG + Intergenic
1013058468 6:106608343-106608365 AGGGAAGAACAGGGTGAGGTTGG + Intronic
1013276209 6:108587197-108587219 ACTCAGAAGCTGGGTGAGCTTGG - Intronic
1013469420 6:110448684-110448706 AGAGAGAAGTTGTTTGAGGTGGG - Intronic
1013591900 6:111625940-111625962 GGGGTGAAGCGAGGTGAGGTAGG - Intergenic
1015222898 6:130825276-130825298 TGAGAGTAGCTGGGTGATGTGGG - Intergenic
1016809722 6:148248223-148248245 AGAAAGAAGCTTGGTGAGGGTGG + Intergenic
1017102147 6:150858228-150858250 AGTGAGAAGGTGGGTCAGGAGGG - Intergenic
1017127812 6:151081934-151081956 AAGGAGAAGCTGGAGGAGATGGG - Intronic
1017369580 6:153689237-153689259 AGGGATGAAATGGGTGAGGTAGG + Intergenic
1017647284 6:156551048-156551070 AGCTGGAAGCTGGGTGGGGTGGG - Intergenic
1018614996 6:165678693-165678715 AGGGAGATGCTGAGTGTGGGCGG - Intronic
1018828018 6:167422828-167422850 AGGGAGACGCCGTGTGTGGTGGG - Intergenic
1019758342 7:2789719-2789741 AGGGAGATGCTGTGCGTGGTTGG - Intronic
1019812070 7:3172110-3172132 AGGGAGAAGTGGGGAGAGGAGGG + Intronic
1019991686 7:4696269-4696291 AGGGACAAGCTTGCTGATGTAGG + Intronic
1020079486 7:5279709-5279731 GGGGAGAAGGGAGGTGAGGTTGG - Intronic
1022835538 7:34110298-34110320 TGGGAGAAGCTGAGTGGGGAAGG - Intronic
1023622945 7:42091339-42091361 AGGCAGGGCCTGGGTGAGGTAGG - Intronic
1023769084 7:43538248-43538270 AGGGAGAAACTGGATGAGGGAGG + Intronic
1023818742 7:43968769-43968791 AGGGAGCAACTTGGGGAGGTGGG + Intergenic
1023991711 7:45132604-45132626 AGGGAGGAGGTGGGAGAGGGAGG + Intergenic
1024458238 7:49632789-49632811 AGGGAGCAGGTGGGTGAGGGAGG - Intergenic
1024653726 7:51431423-51431445 AGGGAGAAGCTGGGGGATGGGGG + Intergenic
1024667951 7:51564732-51564754 AGATAGAAGCTGGGTGGGTTGGG - Intergenic
1024849648 7:53696463-53696485 AGGGAGAAGCTGGGAGAGGAGGG + Intergenic
1025078382 7:55962812-55962834 GGGGAGAACCTGGGAGAAGTAGG - Intronic
1025199407 7:56952486-56952508 GGGGAGAAGGGAGGTGAGGTTGG + Intergenic
1025672541 7:63624447-63624469 GGGGAGAAGGGAGGTGAGGTTGG - Intergenic
1026735328 7:72945386-72945408 TGGGAGAAGCAGGCTGAGCTGGG + Intronic
1026785668 7:73300316-73300338 TGGGAGAAGCAGGCTGAGCTGGG + Intergenic
1026836872 7:73645506-73645528 GGGGTGGAGGTGGGTGAGGTGGG + Intergenic
1027035863 7:74924857-74924879 TGGAAGGAGGTGGGTGAGGTTGG - Intergenic
1027108398 7:75419620-75419642 TGGGAGAAGCAGGCTGAGCTGGG - Intronic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1029151921 7:98486322-98486344 GAGGTGAAGCTGGGTGAGGGGGG - Intergenic
1029536646 7:101161187-101161209 AGGCAGGAGCTGGGAGGGGTGGG + Exonic
1029597585 7:101545877-101545899 AGGGATAACCTTGGTGGGGTGGG - Intronic
1029645152 7:101850343-101850365 GGGGAGAAGTGGGGTGGGGTTGG - Intronic
1029677089 7:102077246-102077268 AGGGAGGAGCTGGGACAGGAAGG + Intronic
1029969603 7:104776447-104776469 AAGGAGAAGCTGGCTGTGGGGGG - Intronic
1030105539 7:105983912-105983934 AGGGTGATGCTGTTTGAGGTGGG - Intronic
1030324282 7:108203543-108203565 AAGGAGAAGCTGGTTCAGGGAGG - Intronic
1030501567 7:110365804-110365826 AGGGAAAAGCTCTGTGAGATTGG - Intergenic
1031964675 7:128019094-128019116 AGGAACTAGCTGGCTGAGGTGGG - Intronic
1032160503 7:129505890-129505912 AGGGAGAAGCTCGGAGTGTTGGG + Intronic
1032936665 7:136740150-136740172 AGGGTGCAGCTGGGTGATCTCGG - Intergenic
1033020995 7:137724175-137724197 AGCCAGAAAGTGGGTGAGGTTGG + Intronic
1034435292 7:151060231-151060253 AGGGAGCAGCTGGGTGGGAATGG + Intronic
1034448755 7:151126417-151126439 TGGGAGAGGCTGGGAGAGGCTGG + Intronic
1034448758 7:151126427-151126449 TGGGAGAGGCTGGGAGAGGCTGG + Intronic
1034448761 7:151126437-151126459 TGGGAGAGGCTGGGAGAGGCTGG + Intronic
1035117816 7:156539676-156539698 AGAGAGAAGCAGGGGGAGGGAGG - Intergenic
1035459896 7:159032144-159032166 AGGGGGCAGCTGGGTGTGGGAGG + Intronic
1035544735 8:471218-471240 AGGGACAAGCTGTGGGAGCTGGG + Intronic
1035595313 8:853236-853258 AGGGAGAAGGTGGAGGAGGGAGG + Intergenic
1035615280 8:995230-995252 TGGGAGGAAGTGGGTGAGGTTGG + Intergenic
1035731899 8:1859624-1859646 AGGGAGAAGCTGCCGGAGGAGGG - Intronic
1037164557 8:15810933-15810955 AGGCAGATGCTGGGTGAGTAAGG + Intergenic
1037297494 8:17416326-17416348 AGGGAAAATCGGGGAGAGGTGGG + Intergenic
1037323024 8:17661722-17661744 AGGGAGAAAATGGGTCAGATGGG + Intronic
1037695439 8:21219506-21219528 AGGGAGAAGCTGGAAGAATTTGG + Intergenic
1037720513 8:21439635-21439657 AGGGAGGAGATGGGGGAGGAAGG + Intergenic
1037788591 8:21918095-21918117 AGGGAGAAACACGGGGAGGTTGG + Intergenic
1037813374 8:22099408-22099430 AGGACGAGGCTGGGTGGGGTAGG - Intronic
1038243553 8:25832536-25832558 AGGCAGCAGCTGGAGGAGGTGGG - Intergenic
1038324391 8:26561560-26561582 AGTGAGTAGCGGGGTGAAGTGGG - Intronic
1038487856 8:27949491-27949513 AGGGTGGAGTTGGGTGAGGTTGG + Intronic
1039468839 8:37801419-37801441 AGGGAGAACCTGGGTGTGGGAGG + Intronic
1039575384 8:38619750-38619772 AGGCTGAAGATGGGTGAGGTTGG + Intergenic
1040510021 8:48085070-48085092 AAGGAGAAGCTGGGTGAGGCTGG + Intergenic
1041306189 8:56463775-56463797 AGGGAGACGTTGGGAGAGTTTGG + Intergenic
1041347925 8:56920676-56920698 AGGGAGAAGCAGAGAAAGGTGGG + Intergenic
1041510222 8:58647940-58647962 AGGCAGAAGCTGGAAGAGTTTGG + Intronic
1042084124 8:65089111-65089133 AGGTAGGGGCTGGGTTAGGTGGG - Intergenic
1043485855 8:80698547-80698569 TGGGAGAGGTTGGGTAAGGTTGG + Intronic
1044230185 8:89765985-89766007 AGGGAGGAAGTGGGTGAGGTAGG - Intronic
1044841765 8:96343181-96343203 AGGGAGAAGCGTGGAGATGTAGG - Intergenic
1045100097 8:98835569-98835591 AGGGAGGAGTGGGGTGTGGTGGG - Intronic
1045244814 8:100433810-100433832 AGGGTGGCCCTGGGTGAGGTGGG + Intergenic
1045381434 8:101631405-101631427 AGAGAAAATCTGGGAGAGGTGGG + Intronic
1045500921 8:102743817-102743839 AGGGCTAAGCTGGGTGAGACGGG + Intergenic
1045689926 8:104749779-104749801 AGTGAGAAGCTTGGTGTGGCTGG + Intronic
1046547905 8:115674597-115674619 AGGGAGAAGGAGGGAGAGGAAGG - Intronic
1047698422 8:127426800-127426822 AGGGAGGAGCTGGGGGAGGAGGG - Intergenic
1048879081 8:138858531-138858553 AGGGGAAAGCTGGATGTGGTGGG - Intronic
1048977555 8:139681467-139681489 AGTGAGAAGCTGGGAGAGCAGGG + Intronic
1049108813 8:140630019-140630041 TGGGAGAAGCAGGGTGTGGGAGG - Intronic
1049405120 8:142448963-142448985 AGGGAAGAGATGGGTGAGGATGG - Intergenic
1049405126 8:142448990-142449012 AGGGAAGAGATGGGTGAGGATGG - Intergenic
1049471030 8:142775083-142775105 AGGGTGAGGCAGGGTGAGCTGGG + Intronic
1049542389 8:143214530-143214552 AGGGAGGGGCTGTGTGTGGTGGG - Intergenic
1049583162 8:143421786-143421808 AGGGAGAAGCTGGGGATGGGTGG + Intronic
1049616388 8:143577497-143577519 AAGGAGGGGCTGGGTGAGGGTGG - Intronic
1049650430 8:143764947-143764969 AGGGAGGAGCAGAGTTAGGTGGG - Intergenic
1050032962 9:1405609-1405631 AGGGAGTACGGGGGTGAGGTAGG + Intergenic
1050401978 9:5266086-5266108 AGGGCAAAGCTTGTTGAGGTGGG + Intergenic
1050690400 9:8221172-8221194 AAGGAGAAGCAGGGTGGGGGAGG + Intergenic
1051147681 9:14045883-14045905 AGGGGGAAGCTGGATGAGAAAGG + Intergenic
1051250050 9:15150459-15150481 AGGGAGAAGGTGAGTGTGGCTGG + Intergenic
1051507727 9:17844277-17844299 AGGGAGAAACTAGGAGAGGTAGG - Intergenic
1051846403 9:21455867-21455889 AAGGAGAAGCTGGGGGCAGTGGG + Intergenic
1052708325 9:32020771-32020793 AGGGAGAATCTATGTGTGGTAGG + Intergenic
1052730358 9:32278069-32278091 AGGAAGAAGCTGGGTGCAGCTGG - Intergenic
1053199031 9:36140342-36140364 AGGGAGAAGCTGTGTGGGCCAGG + Intronic
1055423073 9:76163681-76163703 AGGGAGAAGCCAGGTGGGCTTGG + Intronic
1055441780 9:76343637-76343659 AGAGGGAAAGTGGGTGAGGTTGG - Intronic
1056479678 9:86988462-86988484 AGGCAGAGGCTGGATGAGGAGGG - Intergenic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1057272326 9:93658117-93658139 AAGGAGACACTGGGTGAGGTGGG - Intronic
1057302504 9:93894958-93894980 AGGGAGAAGCAGGGAGATGCAGG - Intergenic
1057598052 9:96433423-96433445 GGTCAGAAGCTGGGTGTGGTGGG + Intergenic
1057885105 9:98823837-98823859 GGGGAGGGGCTGGGTGAGGATGG + Intronic
1058070047 9:100592436-100592458 ATGGAGAAGCTAGGTTCGGTGGG - Intergenic
1058947314 9:109869866-109869888 GGGCAGGAGGTGGGTGAGGTGGG + Intronic
1059337628 9:113579199-113579221 AGTGAGTAGCTGTGTGATGTTGG + Intronic
1059431670 9:114254284-114254306 TGGGAGAGGCTGGGAGAGCTGGG + Intronic
1059435133 9:114271520-114271542 AGGGAGCAGCAGGGTCAAGTTGG - Intronic
1059632342 9:116137897-116137919 AGGGAACAGCTGGTTGTGGTAGG + Intergenic
1059644656 9:116252535-116252557 AGAGGGAAGATGGGTGTGGTGGG + Intronic
1060013373 9:120064469-120064491 AGAGAGAAGGTGGGAGAGGAAGG - Intergenic
1060402164 9:123355550-123355572 TGGGAGGAGCTGTGTGTGGTCGG + Intergenic
1061035187 9:128109542-128109564 AGGCAGGAGCGGGGTGAGGCTGG - Intergenic
1061301787 9:129709764-129709786 AGGAAGAGGCTGGGGGAGGCCGG - Intronic
1061804868 9:133132286-133132308 AGGCAGGATCTGGGTGAGGCAGG + Intronic
1061900401 9:133669310-133669332 AGGGAGAGGGAGGGTGAGGGAGG - Intronic
1062062131 9:134502381-134502403 AGGGAGAAGCTGGGGTTGGGGGG - Intergenic
1062113760 9:134796684-134796706 AGGGTGAGGCAGGGTGAGGGAGG + Intronic
1062129637 9:134885523-134885545 TGGGGGAGGCTGGGAGAGGTTGG + Intronic
1062247221 9:135575389-135575411 TGGGAGAGGCTGGGTGAGCTGGG - Intergenic
1062454147 9:136627833-136627855 AGGGAGATGATGGGTGGGCTTGG + Intergenic
1062591701 9:137277426-137277448 AGGGATAACCTGGGGGAGGTGGG + Intergenic
1062681532 9:137784695-137784717 AGGGAGCAGCTGAGTGAACTGGG + Intronic
1062736652 9:138141085-138141107 AGGGAGACACTGGGTGGGGTGGG + Intergenic
1202801917 9_KI270720v1_random:8044-8066 AGGGAAAGGCTGGGAGTGGTGGG + Intergenic
1203698817 Un_GL000214v1:119225-119247 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203699773 Un_GL000214v1:125523-125545 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203479507 Un_GL000224v1:113-135 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203480473 Un_GL000224v1:6409-6431 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203481440 Un_GL000224v1:12737-12759 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203482404 Un_GL000224v1:19046-19068 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203548993 Un_KI270743v1:152910-152932 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203549457 Un_KI270743v1:155639-155661 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203550415 Un_KI270743v1:161951-161973 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203568541 Un_KI270744v1:111237-111259 AGGTAGATGCTGGGTGAGGCAGG + Intergenic
1203569112 Un_KI270744v1:115471-115493 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203570061 Un_KI270744v1:121760-121782 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1185480973 X:445996-446018 AGGGAGTAGCTGGGGGAGTCAGG + Intergenic
1185644703 X:1608640-1608662 AGGCATGAGCTGAGTGAGGTGGG - Intergenic
1186042958 X:5501991-5502013 GGTGAGAGGCTGGGAGAGGTGGG + Intergenic
1187098011 X:16167285-16167307 AGGGAGAATCTTGGTCTGGTGGG + Intergenic
1187272793 X:17793806-17793828 AGGGAGGTGCTGGGGGAGGGAGG + Intergenic
1188544784 X:31292966-31292988 AGAGGGAATGTGGGTGAGGTAGG + Intronic
1188932579 X:36130934-36130956 AGTGAGAGGCTGGGGGAGGTGGG + Intronic
1189063800 X:37784353-37784375 AGAGAGAAGTTGTGTCAGGTGGG + Intronic
1189277442 X:39797288-39797310 AGGGAGAGGCTGGGCAGGGTCGG - Intergenic
1190154672 X:47979788-47979810 AGGGAAAAACTGGGTGATGCTGG + Intronic
1190259370 X:48788219-48788241 AGGGAGAAACAGGGAGAGATGGG + Intronic
1190288912 X:48978966-48978988 AGGGAGAAAATGGAAGAGGTTGG + Intronic
1190914781 X:54803238-54803260 AGTGAGACCCTGGGGGAGGTGGG + Intergenic
1191210131 X:57875991-57876013 AGGTGGCAGCTGGGTCAGGTGGG - Intergenic
1191976238 X:66874708-66874730 AGGGAGAAGCAAGGTGAGATTGG + Intergenic
1192059938 X:67813279-67813301 GGGGTGAAGTTGGATGAGGTTGG - Intergenic
1192093831 X:68189193-68189215 ATGGAGCAGATGGGTGAGATGGG - Intronic
1192797869 X:74439585-74439607 AGAGTGAGGCTGGGTGTGGTGGG - Intronic
1193198741 X:78663191-78663213 AGGGAGAAGCGGGGAGATGAGGG + Intergenic
1194615391 X:96095098-96095120 TGTGAGAAGCAGGGAGAGGTAGG + Intergenic
1194767621 X:97860448-97860470 AGGAAGAAGCTGAGGGAGGCTGG + Intergenic
1194996127 X:100593299-100593321 AGGAATAAACTGGGTGGGGTTGG + Intronic
1195107656 X:101616499-101616521 AGTGAGAAGCTGGAGGAGGAGGG - Exonic
1195817309 X:108902894-108902916 AGGTAGAGGCAGGGTTAGGTGGG - Intergenic
1196759894 X:119191615-119191637 AGGTTGAGGCTGAGTGAGGTAGG + Intergenic
1197441092 X:126492444-126492466 GGGGTGAAGTTGGGGGAGGTGGG - Intergenic
1197774022 X:130108765-130108787 AGCAAGAGGCTGGGTGAGGGTGG + Intronic
1198398756 X:136250658-136250680 GGGAGGAAGCTGGGTGAGGGTGG - Intronic
1198710293 X:139494552-139494574 GGGGAGGAGCAGGGTGTGGTAGG - Intergenic
1199320139 X:146428296-146428318 AGGGAGAAGAAGGGTGGTGTGGG - Intergenic
1199404200 X:147436820-147436842 TGGGAAAAGCTGGGTGAAGAAGG + Intergenic
1199532297 X:148863769-148863791 AGGGAGAAAATGGGTAGGGTGGG + Intronic
1199798436 X:151226273-151226295 AGGTAAAAGCTGAGTGAGGCTGG + Intergenic
1199827046 X:151510534-151510556 AGGGAGAAACGGAGAGAGGTAGG + Intergenic
1199875445 X:151924331-151924353 TGGGAGGAGCTGGGTGTGATGGG + Exonic
1200088934 X:153625499-153625521 AGTGTGAAGGTGGGTGAGGAGGG + Intergenic
1200398876 X:156007157-156007179 AGGGAGACACTGGGTGGGGTGGG + Intronic
1200747887 Y:6918309-6918331 AGACAGAAGGTGGGTGGGGTGGG + Intronic
1201146286 Y:11067095-11067117 AGGGAGAAGAAGGGAGAGGAAGG + Intergenic
1201146388 Y:11067409-11067431 AGGGAGAAGAAGGGAGAGGAAGG + Intergenic
1202370465 Y:24192458-24192480 AGGGAGAAGTGGGGATAGGTGGG - Intergenic
1202500319 Y:25477659-25477681 AGGGAGAAGTGGGGATAGGTGGG + Intergenic