ID: 1077606246

View in Genome Browser
Species Human (GRCh38)
Location 11:3614790-3614812
Sequence CATATGTGGGGACTTCCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077606239_1077606246 28 Left 1077606239 11:3614739-3614761 CCCTATCTGCCAGTTGCGGTTCT No data
Right 1077606246 11:3614790-3614812 CATATGTGGGGACTTCCCTCAGG No data
1077606240_1077606246 27 Left 1077606240 11:3614740-3614762 CCTATCTGCCAGTTGCGGTTCTC No data
Right 1077606246 11:3614790-3614812 CATATGTGGGGACTTCCCTCAGG No data
1077606241_1077606246 19 Left 1077606241 11:3614748-3614770 CCAGTTGCGGTTCTCAGCAAGAG No data
Right 1077606246 11:3614790-3614812 CATATGTGGGGACTTCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077606246 Original CRISPR CATATGTGGGGACTTCCCTC AGG Intergenic
No off target data available for this crispr