ID: 1077610964

View in Genome Browser
Species Human (GRCh38)
Location 11:3642796-3642818
Sequence GCCTTTCCCCCACCTCCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077610961_1077610964 -4 Left 1077610961 11:3642777-3642799 CCCATGTTTGTAAACACTGGCCT No data
Right 1077610964 11:3642796-3642818 GCCTTTCCCCCACCTCCTCTGGG No data
1077610957_1077610964 26 Left 1077610957 11:3642747-3642769 CCGCTCTCGTGGCCGCTCAGACT No data
Right 1077610964 11:3642796-3642818 GCCTTTCCCCCACCTCCTCTGGG No data
1077610959_1077610964 14 Left 1077610959 11:3642759-3642781 CCGCTCAGACTCAGGTGACCCAT No data
Right 1077610964 11:3642796-3642818 GCCTTTCCCCCACCTCCTCTGGG No data
1077610962_1077610964 -5 Left 1077610962 11:3642778-3642800 CCATGTTTGTAAACACTGGCCTT No data
Right 1077610964 11:3642796-3642818 GCCTTTCCCCCACCTCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077610964 Original CRISPR GCCTTTCCCCCACCTCCTCT GGG Intergenic
No off target data available for this crispr