ID: 1077612066

View in Genome Browser
Species Human (GRCh38)
Location 11:3649432-3649454
Sequence CATTGGGCAGAGACTAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 4, 2: 9, 3: 41, 4: 277}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077612066 Original CRISPR CATTGGGCAGAGACTAGGGA GGG (reversed) Intronic
900297071 1:1957268-1957290 CATTGGGCAGAGCCGAGGTATGG - Intronic
900368616 1:2321626-2321648 CAGTGGGCTGAGGCCAGGGAGGG - Intronic
902238514 1:15073373-15073395 CATGGGGCAGAGACTGAGGGTGG + Intronic
902721388 1:18306602-18306624 CATTGGCCCCTGACTAGGGAGGG - Intronic
902773719 1:18661034-18661056 CAGGGGGCATAGAATAGGGAGGG + Intronic
904371203 1:30048524-30048546 CATCGGGCAGAGGCTTGGCAGGG + Intergenic
904619521 1:31766854-31766876 CCTGGGGCAGAGACTGGGCATGG + Intergenic
907213654 1:52843572-52843594 CATTCGGCAAAGGCTGGGGACGG - Intronic
910423968 1:87100610-87100632 AATAGGGCAGGGAATAGGGAAGG - Intronic
911191863 1:94956333-94956355 CATTGTTCATAGGCTAGGGATGG + Intergenic
911510736 1:98805459-98805481 CATTGGGAACAGACTAGGGAGGG + Intergenic
912345559 1:108960329-108960351 CAATGGGCAAAAACTAAGGAGGG + Intronic
912760214 1:112359769-112359791 ATTTGGGCAGAGAGGAGGGATGG - Intergenic
913530954 1:119733976-119733998 CAGTGGGCAGTGACTGGGGGAGG + Intronic
915324085 1:155071551-155071573 TATTCGGGAGAGACTAGGGCAGG - Intergenic
917218469 1:172702464-172702486 CGTTGTGAAGAGACTATGGATGG + Intergenic
919482946 1:198111768-198111790 CATTGGGAAAGGACTTGGGATGG - Intergenic
920061247 1:203228479-203228501 CATTAAGCAGAGCCCAGGGAAGG + Intronic
920645608 1:207801764-207801786 GGATGGGCAGAGAATAGGGAAGG - Intergenic
920907817 1:210188298-210188320 CACTGGTCACAGACTCGGGAAGG + Intergenic
922371670 1:224917433-224917455 CACAGGGCAGAATCTAGGGAAGG + Intronic
923414007 1:233737072-233737094 CAATGGGCAGCGAACAGGGATGG - Intergenic
923860090 1:237884689-237884711 GTTTGGCCAGAGACTAGGAAAGG + Intronic
1063509717 10:6633775-6633797 CAATGGGCACAGACTAGGAAGGG + Intergenic
1063527796 10:6801272-6801294 CACTGGGCACAGACTAGGAAGGG + Intergenic
1064967105 10:21026244-21026266 CATTTGGGAGTGAGTAGGGAGGG + Intronic
1066297498 10:34067612-34067634 CAGTGGGCACAGCCTATGGAGGG + Intergenic
1066694967 10:38069238-38069260 CATTGGGCAGTGAGTGGGCAGGG - Intergenic
1067203048 10:44191219-44191241 CATGGGGCAGAGTAGAGGGATGG + Intergenic
1068082860 10:52341365-52341387 GATGGGGAAGAGAGTAGGGAGGG + Intergenic
1071837423 10:89432435-89432457 CCTTGGGCAGAGGCAAGGGCTGG + Exonic
1073206690 10:101773146-101773168 TGTGGGGCAGGGACTAGGGAAGG + Intronic
1075354792 10:121761761-121761783 GATTGGGCTGAGACCAGGAATGG - Intronic
1075818467 10:125284747-125284769 CATTGGGCATTGATTACGGATGG + Intergenic
1076434482 10:130430699-130430721 AATGGGGCAGAGAATAGGAAAGG - Intergenic
1076719210 10:132385864-132385886 CACTGGCCAGAGAGCAGGGAGGG - Intergenic
1077612066 11:3649432-3649454 CATTGGGCAGAGACTAGGGAGGG - Intronic
1077766503 11:5164499-5164521 CATTGGGAAGAGACTAGGGAGGG + Intronic
1078038551 11:7835095-7835117 CTTTGGGCAGAGTCGAGGTATGG - Intergenic
1078386371 11:10896481-10896503 CATGGGGCTGAGAGTGGGGAAGG + Intergenic
1080083582 11:28251824-28251846 CATTGGGCAGTGACTAGAGGTGG - Intronic
1081065364 11:38534096-38534118 CATTGGGCAATGACAAGGGTGGG + Intergenic
1083685570 11:64373137-64373159 CATTGGGTGGAGAGTAGGGGAGG + Intergenic
1083693284 11:64424818-64424840 GGTTGGTCAGAGATTAGGGATGG + Intergenic
1083802328 11:65053774-65053796 CATTGCCCAGAGACTAGTCAGGG - Intronic
1084525793 11:69697294-69697316 CATTTGCCAGGGATTAGGGATGG - Intergenic
1086040643 11:82473146-82473168 TATTGGGGAGGGAATAGGGAGGG - Intergenic
1086454419 11:86947250-86947272 CATTGAGCACAGACTTTGGAAGG - Exonic
1089317339 11:117600929-117600951 CACTGGGAAGAGTCTTGGGAGGG + Intronic
1091637269 12:2206593-2206615 CATTGGACAGTGAGTAGGTAGGG - Intronic
1091692270 12:2605351-2605373 CTTAGGGCAGACACTTGGGATGG - Intronic
1091917643 12:4281094-4281116 CTTTGGTCAGGGACTAGGAAAGG + Intronic
1092416288 12:8292733-8292755 CACTGGGAACAGACTAGGGAGGG + Intergenic
1093578703 12:20764922-20764944 CATTGGGCAGAGACTAGGAAGGG - Intergenic
1093584632 12:20821168-20821190 CATTGGGCAGAGACTAGGAAGGG + Intronic
1093812964 12:23510227-23510249 CTGTGAGCAGAGACTAGGGAGGG + Intergenic
1094798241 12:34000918-34000940 CCTTGGGCAGAGACTCTGGCAGG - Intergenic
1095111007 12:38295005-38295027 CCTTGGGCAGAGACTGTGGCAGG - Intergenic
1095601561 12:44019068-44019090 CTCTGGGCAGAGGCCAGGGAAGG + Intronic
1096093214 12:48916694-48916716 CATTTGGCAGGGAACAGGGATGG + Intronic
1096181681 12:49554609-49554631 AAGTGGGCAGAGGCTGGGGATGG + Intronic
1096241565 12:49962594-49962616 CATTGGAGAGAGACCAGGGTGGG - Intronic
1096354474 12:50928637-50928659 CTTTAGGCAGACAGTAGGGAAGG - Intronic
1096780065 12:53986414-53986436 CTTGGGCCAGGGACTAGGGAAGG + Intronic
1098611041 12:72458563-72458585 CATTGGGGAGAGGCTGGGGTCGG - Intronic
1099399355 12:82182698-82182720 CAATGGGCAGGGACCAGGGAAGG + Intergenic
1099484844 12:83216282-83216304 CATTGGACATAGGCTGGGGAAGG + Intergenic
1100457339 12:94765185-94765207 CATTGGAGACAGAATAGGGATGG - Intergenic
1100674048 12:96847186-96847208 CATAGGGCAGAGCACAGGGAAGG + Intronic
1101098936 12:101372282-101372304 CTTTGGACACAGACTAGGCATGG + Intronic
1101306643 12:103535073-103535095 CTTGGGTCAGAGACAAGGGAAGG - Intergenic
1102076919 12:110067030-110067052 CAATGGCCACAGACTAGGGAAGG - Intronic
1102119465 12:110429344-110429366 CCTAGTGCAGGGACTAGGGAAGG + Intergenic
1102694713 12:114789800-114789822 CAGAGGACAGAGACTAGGGTGGG - Intergenic
1102932524 12:116873726-116873748 CATGGGCCAGAGACTTGGGCAGG - Intronic
1104406832 12:128524950-128524972 CAGTGGGCAGTGACTAGGGAAGG - Intronic
1105723035 13:23135130-23135152 CCTAGTGCAGGGACTAGGGAAGG - Intergenic
1107075466 13:36317972-36317994 CACTGGGCACAGACTAGGAAGGG - Intronic
1107786493 13:43962997-43963019 CATTGGGCAGAGGGTGGGGAAGG - Intergenic
1108212731 13:48154793-48154815 CACTGGGCAGAGATGAGGGCTGG - Intergenic
1109870741 13:68328938-68328960 CAGTGGACAGAGGCCAGGGATGG + Intergenic
1111108890 13:83681649-83681671 CATAGGGAAAAGACTAGAGAGGG - Intergenic
1111301934 13:86359936-86359958 CTGTGCGCAGAGACTAGGAAGGG - Intergenic
1112584495 13:100706145-100706167 CAGTGGGCAGAAACTTAGGAAGG + Intergenic
1112746099 13:102528858-102528880 CTTTGGGCAGAGATGTGGGAAGG - Intergenic
1113772405 13:112918496-112918518 CCATGGGGAGAGAGTAGGGAGGG + Intronic
1114699383 14:24661939-24661961 CAGTGGGCAGAATCTAGAGAGGG + Intergenic
1116535036 14:46017358-46017380 CACCGGTCACAGACTAGGGAAGG - Intergenic
1117156842 14:52950689-52950711 CTTTCGGCAGAAACTCGGGAGGG + Intronic
1118252384 14:64173946-64173968 CAGTGTGCAGAGAGTAGCGAAGG - Intronic
1119024045 14:71138475-71138497 CACAGGGCTGAGCCTAGGGAAGG - Intergenic
1120660232 14:87240045-87240067 CACCGGTCACAGACTAGGGAAGG - Intergenic
1121193425 14:92048924-92048946 CTGGGAGCAGAGACTAGGGAGGG + Exonic
1122900696 14:104781229-104781251 CACTGGGCAGGGGTTAGGGAGGG + Intronic
1123107130 14:105846895-105846917 CACTGGTGAGACACTAGGGATGG + Intergenic
1202850254 14_GL000225v1_random:12340-12362 CATTTGACAGAGCCTAGAGAGGG + Intergenic
1202850944 14_GL000225v1_random:18757-18779 CTTTTGGCAGAGCCTAGGCAAGG + Intergenic
1202868585 14_GL000225v1_random:138427-138449 CTTTTGGCAGAGCCTAGAGAAGG - Intergenic
1124205754 15:27718699-27718721 TGTTGGGCAGAGACAAGGGGTGG - Intergenic
1124639495 15:31388043-31388065 CATTGATCTGAGACTAGGTAAGG + Intronic
1124696640 15:31869891-31869913 CAGTGAGGAGATACTAGGGAAGG + Intronic
1125964880 15:43866053-43866075 CATTGGGCAGAGGGTAAAGACGG - Intronic
1126285471 15:47005978-47006000 CAGGGGGCAGAGGCAAGGGAAGG - Intergenic
1127314815 15:57784990-57785012 CTCTGGGCTGAGAATAGGGAAGG + Intergenic
1127315207 15:57788473-57788495 CACTGGGCAGAGCTTGGGGATGG + Intergenic
1127545947 15:59994443-59994465 CATGGGGCAAAGACTAAGCAGGG + Intergenic
1127675218 15:61231776-61231798 CAATGAGCAGAGTCTAAGGAAGG - Intergenic
1128237135 15:66075950-66075972 CTTAGGGCAGGGACAAGGGAAGG + Intronic
1128813010 15:70585734-70585756 CACTGTGCAGAGACTGGGGGCGG - Intergenic
1129226179 15:74171716-74171738 CTTTGGGCCCAGGCTAGGGAAGG - Intergenic
1129248965 15:74297796-74297818 CACAGGGCTGAGACCAGGGAGGG - Intronic
1129259315 15:74355412-74355434 CATTGGAAATAGACTAGGGAGGG - Intronic
1129769419 15:78193869-78193891 CAGTGGGCAGAGGGTAGGGGAGG - Intronic
1132262737 15:100440928-100440950 CACTGGTCACGGACTAGGGAAGG + Intronic
1133031282 16:3012431-3012453 CACTGGGCTGAGACGGGGGATGG + Intergenic
1133776231 16:8897398-8897420 CATTGTGCTGAGAGTTGGGAAGG - Intronic
1133857999 16:9567650-9567672 CATAGGGGAGAGACAAAGGAAGG - Intergenic
1134382580 16:13741550-13741572 CATTGGGCAAAGAATAGGAAAGG + Intergenic
1139249023 16:65477003-65477025 AATTGGGCAGAGAATAAGAAAGG - Intergenic
1140948579 16:79794449-79794471 CATTTGGCAGAGAAGAGAGAAGG + Intergenic
1142656258 17:1396530-1396552 GATAGGGAAGAGACTAGGAAAGG + Intronic
1143618713 17:8069041-8069063 CATTGGGCAGAAACTGGGGAAGG - Intergenic
1144155137 17:12492990-12493012 CCATGGACAGAGACAAGGGAGGG + Intergenic
1145922707 17:28622737-28622759 CAGTTGGCAGAAACAAGGGAAGG - Intronic
1145942123 17:28748051-28748073 CATGGGGCAGCGATTAGGGCAGG - Exonic
1146423821 17:32716388-32716410 TATTAGCCACAGACTAGGGAGGG - Intronic
1146723170 17:35137473-35137495 CATTGGGCAGGGAAAGGGGATGG + Intronic
1147703722 17:42411931-42411953 CAGTGGGCAGTGACTGGGGATGG + Intronic
1149046303 17:52249691-52249713 CATGGAGCAGGGACTAGGGGTGG + Intergenic
1149712254 17:58754535-58754557 CATTATGCAGAGACTAAAGAGGG + Intergenic
1152000332 17:77641315-77641337 CAGTGGGCAGAGCCTAGAGCTGG + Intergenic
1152293888 17:79455529-79455551 CTTTGAGCAGAGGCCAGGGAGGG + Intronic
1152697151 17:81803192-81803214 CACTGGGCACAGAGCAGGGATGG + Intergenic
1155892816 18:31288443-31288465 CATTGGGAGCAGACTAGGGAGGG + Intergenic
1155972531 18:32094719-32094741 CATTGGGTAGATAAAAGGGAGGG + Intronic
1157045556 18:44098900-44098922 CCTTGGGCAGAGGCTATGGCAGG + Intergenic
1157297944 18:46459506-46459528 CCTGGGGCAGAGAATTGGGAGGG - Exonic
1157990928 18:52495356-52495378 ACTTGGGCAGAGACTATGGGTGG - Intronic
1158366921 18:56746845-56746867 TAGTGGGTAGAGGCTAGGGATGG - Intronic
1158375066 18:56854392-56854414 CATTGGGCAAGGCATAGGGAAGG + Intronic
1159164348 18:64683162-64683184 CACTGGGCACAGACTAGGGAGGG - Intergenic
1160299890 18:77669827-77669849 CATGGGGCAGAGACTGGTGTGGG + Intergenic
1160299916 18:77669963-77669985 CATGGGGCAGAGACTGGCGTGGG + Intergenic
1160299928 18:77670014-77670036 CATGGGGCAGAGACTGGTGTGGG + Intergenic
1160299936 18:77670048-77670070 CATGGGGCAGAGACTGGCGTGGG + Intergenic
1160299968 18:77670201-77670223 CATGGGGCAGAGACTGGCGTGGG + Intergenic
1160299980 18:77670252-77670274 CATGGGGCAGAGACTGGTGTGGG + Intergenic
1160299992 18:77670303-77670325 CATGGGGCAGAGACTGGCGTGGG + Intergenic
1160300004 18:77670354-77670376 CATGGGGCAGAGACTGGTGTGGG + Intergenic
1160300018 18:77670422-77670444 CATGGGGCAGAGACTGGCGTGGG + Intergenic
1160300030 18:77670473-77670495 CATGGGGCAGAGACTGGTGTGGG + Intergenic
1160300042 18:77670524-77670546 CATGGGGCAGAGACTGGCGTGGG + Intergenic
1160300054 18:77670575-77670597 CATGGGGCAGAGACTGGTGTGGG + Intergenic
1160300066 18:77670626-77670648 CATGGGGCAGAGACTGGCGTGGG + Intergenic
1160300096 18:77670779-77670801 CATGGGGCAGAGACTGGCGTGGG + Intergenic
1160300116 18:77670864-77670886 CATGGGGCAGAGACTGGCGTGGG + Intergenic
1160715499 19:574685-574707 CCTTGGGCAGAGGCTGGGGAGGG + Intronic
1161502251 19:4622811-4622833 CCTTGGGCAGAGGGGAGGGAAGG + Intergenic
1163917332 19:20252616-20252638 CATAGGGCAGACACTAGGGCAGG + Intergenic
1163931111 19:20392995-20393017 CATAGGGCAGACACTAGGGCAGG + Intergenic
1164004201 19:21133978-21134000 CTGGGAGCAGAGACTAGGGAGGG + Intergenic
1166211244 19:41307975-41307997 GATGGGGCAGAGACCAGGGCTGG + Intronic
1167047429 19:47058623-47058645 CATTCGGCAGAGCCTGGGGGCGG + Intergenic
1167351853 19:48980227-48980249 TATTGGGCAGAGACGAGGAAAGG - Intronic
926236408 2:11048414-11048436 GAATGGGCAGAGATTAGAGACGG + Intergenic
931236830 2:60419170-60419192 CACTGGGCAGAGACTAGGAAGGG - Intergenic
931916992 2:66967178-66967200 CATTGAGCAGACACCAGGGAAGG - Intergenic
932122563 2:69115102-69115124 TAGTGGGTAGAGACCAGGGATGG - Intronic
932757288 2:74417525-74417547 CCTAGTGCAGGGACTAGGGAAGG + Exonic
935191555 2:100782433-100782455 CAGTGGGGAGAGACTGGGGCTGG - Intergenic
937073077 2:119079523-119079545 CATTGGGCTGTGATGAGGGAGGG + Intergenic
937149058 2:119673469-119673491 CAGTGGGGACAGAGTAGGGAGGG - Intergenic
937340798 2:121089191-121089213 GGTGGGGCAGAGACTGGGGAAGG + Intergenic
938314260 2:130315309-130315331 CCTTGGGCAGAGTCCAGAGATGG + Intergenic
938962621 2:136356837-136356859 AATTGGGCATAGACTTGGAAAGG + Intergenic
941936016 2:170981839-170981861 CATTGGGCACAGACTAGGGAGGG + Intergenic
943143024 2:184006619-184006641 CACTGGGCATAGACAAGGGTAGG - Intergenic
944423947 2:199559971-199559993 CTTGGGGCAGAGGTTAGGGAGGG - Intergenic
944720806 2:202421715-202421737 TAATGGGCAGAGACTGGGAAAGG - Intronic
945026770 2:205627048-205627070 CATTGGCCACAGGCTAAGGAAGG - Intergenic
945178749 2:207069800-207069822 CATTGGGGTGACACTAGAGAAGG + Intergenic
945312073 2:208325562-208325584 CACAGGGCAGAGACTCAGGAGGG - Exonic
945903093 2:215560202-215560224 CATTCAGCAGTGACTAGGGAAGG + Intergenic
947462943 2:230318863-230318885 CATCAGCCAGAGACTTGGGAAGG - Intergenic
948810078 2:240470310-240470332 AAGTGGGTAGAGTCTAGGGAAGG + Intergenic
1173257384 20:41404627-41404649 CATGGGGCACAGGCTGGGGAGGG - Exonic
1175130139 20:56782592-56782614 CACAGGGCAGAGACCAGGGACGG - Intergenic
1176113840 20:63422543-63422565 CATGGGGAAGAGACGGGGGAGGG + Intronic
1176306844 21:5128144-5128166 CCTTGGGCAGAGAACAGCGAAGG + Intronic
1177063137 21:16397565-16397587 CTGGGAGCAGAGACTAGGGAGGG + Intergenic
1178500627 21:33123207-33123229 CATTGCACAGAGGCTGGGGAGGG - Intergenic
1179233255 21:39524221-39524243 CCTTGAGCAGAATCTAGGGAGGG - Intergenic
1179850213 21:44133886-44133908 CCTTGGGCAGAGAACAGCGAAGG - Intronic
1181133103 22:20745878-20745900 CATTGGGCAGTGAGGAGTGATGG - Intronic
1181864833 22:25846753-25846775 GAATGGGCTGAGACAAGGGAAGG + Intronic
1182244721 22:28947058-28947080 CATTTGGGAGAGACTAGTGAGGG + Intronic
1185402300 22:50625452-50625474 CTGTGGGCAGAGCCTGGGGAGGG + Exonic
949387994 3:3526413-3526435 AAATGGGCAGACACTGGGGAGGG + Intergenic
949590331 3:5487560-5487582 CAATGTGCAGAGAGTAGGGAAGG + Intergenic
949754474 3:7393019-7393041 CCTTGGGCCGAGACCAGAGAGGG + Intronic
949961339 3:9314823-9314845 CTCTGGGCAGAGGCCAGGGAGGG + Intronic
951894752 3:27600238-27600260 CTGGGAGCAGAGACTAGGGAGGG - Intergenic
952566347 3:34663197-34663219 AATTGAGCAGAAACTAGAGAGGG + Intergenic
955999990 3:64719514-64719536 CCTTGGGCAAAGGCTTGGGAAGG - Intergenic
956030479 3:65031563-65031585 CATTTGGCAGTGAATAGGGAGGG - Intergenic
956881868 3:73519179-73519201 CCTTGGGCAGAAAGTAGGGTGGG + Intronic
957060010 3:75474222-75474244 CACTGGGAACAGACTAGGGAGGG + Intergenic
957145800 3:76422249-76422271 CATTTGGGAGAGACTAGAGTGGG - Intronic
957652905 3:83032390-83032412 CATAGGGCAGAAACTAGGACAGG - Intergenic
958755360 3:98245142-98245164 CTGGGAGCAGAGACTAGGGAGGG - Intergenic
961293389 3:125865223-125865245 CACTGGGAACAGACTAGGGAGGG - Intergenic
962405160 3:135094303-135094325 CAGTGGGCAGAGACTGGGAAGGG - Intronic
963441931 3:145351363-145351385 CATTGTGCAGAAACTAGGGTAGG - Intergenic
963456934 3:145556170-145556192 CACTGGTCACAGACTAGGGAAGG - Intergenic
963901312 3:150735884-150735906 ATTGGGGCAGAGACTAGTGAAGG - Intergenic
964383336 3:156120515-156120537 GAGTGGGCAGGGACGAGGGAGGG + Intronic
965915570 3:173842321-173842343 GATTAGGCAGAGGCTAGGGGTGG - Intronic
966085184 3:176062068-176062090 CACCGGTCACAGACTAGGGAAGG + Intergenic
968594846 4:1477044-1477066 CAGTGGGCAGAGGCTAGACAAGG - Intergenic
968873193 4:3251878-3251900 CCTGGGGCAGAGGTTAGGGATGG + Intronic
968932991 4:3593101-3593123 CATTGCGCAGAGAGTGGGGATGG + Intergenic
969003922 4:4004406-4004428 CACTAGGAACAGACTAGGGAGGG + Intergenic
969535721 4:7755155-7755177 CATTGGGCAGTGGCAAGGGGAGG + Intergenic
969810005 4:9640418-9640440 CACTAGGAACAGACTAGGGAGGG - Intergenic
972942332 4:44212061-44212083 CATGGGATAGAGACTAGGGTTGG + Intronic
975832406 4:78383519-78383541 CATTGTGGACAGACTAGGGAAGG - Intronic
976195463 4:82527661-82527683 CACTGGGCAGAGAGTTAGGAAGG - Intronic
976558456 4:86476091-86476113 CATTGGTAACAGACTAGGGAGGG - Intronic
982837335 4:160136748-160136770 CATTTACCAGAGACTGGGGAGGG + Intergenic
984706959 4:182854606-182854628 CACTGGGCAGAGTCTTGGGCAGG - Intergenic
985420039 4:189776047-189776069 CAATGAGCAGAAGCTAGGGATGG - Intergenic
986445064 5:7814422-7814444 CAGTAGGCAGAGGCCAGGGATGG + Intronic
986545467 5:8892105-8892127 GATTTGGGAGAGACCAGGGATGG - Intergenic
988330020 5:29824632-29824654 CATTGGGTAGAGAGTAGACAAGG - Intergenic
988853496 5:35202495-35202517 AAGTAGGCAGAGAGTAGGGAGGG - Intronic
990565242 5:57021191-57021213 CTGGGAGCAGAGACTAGGGAGGG + Intergenic
993110539 5:83651786-83651808 CATTGGGCAGAGGGGAGGCAAGG + Intronic
995215069 5:109585758-109585780 CCTTGGGCAGTGACTAGGGAGGG + Intergenic
995836965 5:116408904-116408926 CCTTGAGCGGAGATTAGGGAGGG + Intronic
996347489 5:122502633-122502655 CATTAGGCAGAAAATAGTGAGGG - Intergenic
996430189 5:123366914-123366936 AATTGGGCAAGGAGTAGGGAAGG - Intronic
996575129 5:124970814-124970836 CCTTGGGAACAGACTGGGGAGGG + Intergenic
997157118 5:131572995-131573017 CTGGGAGCAGAGACTAGGGAGGG - Intronic
998387429 5:141765804-141765826 CATTGGGCAGAGAAAAGTTAAGG + Intergenic
1000456920 5:161460888-161460910 CATTGTGCAGAGAGCAGAGAAGG + Intronic
1001088860 5:168722162-168722184 CTTTGGGCAGAGAGTGGGGAAGG + Intronic
1001789597 5:174444561-174444583 CATAGTGGAGAGACCAGGGAGGG - Intergenic
1002138419 5:177122941-177122963 CATTGGGAACAGACCAGTGAAGG + Intergenic
1002996682 6:2292532-2292554 CAGGGGGCAGGGACTAGGGGAGG + Intergenic
1004302226 6:14469033-14469055 CAGTGGGCAGAGAGCAAGGAAGG - Intergenic
1004768860 6:18759148-18759170 CACTGGTCACGGACTAGGGAAGG - Intergenic
1005756675 6:28931178-28931200 CATTAGGGAGAGAGAAGGGAAGG + Intergenic
1005960595 6:30690396-30690418 AAGAGGGCAGAAACTAGGGATGG - Intronic
1007392250 6:41556268-41556290 CATGGGGGAGAGAGGAGGGAGGG + Intronic
1007618070 6:43194008-43194030 CATTGCCCAGAGAATCGGGAAGG + Intronic
1007972229 6:46063761-46063783 CATTGGGCAGAGTCCTCGGAAGG + Intronic
1008208644 6:48694083-48694105 GATTGGGAAGAGATGAGGGAAGG + Intergenic
1010655419 6:78506083-78506105 CCCTGGGCAGAGACTAGGGTAGG - Intergenic
1010928210 6:81769188-81769210 CTTTGGGCAGAGCTGAGGGAGGG - Intergenic
1011151609 6:84280142-84280164 CATAGGGCAGATTCTTGGGAAGG + Intergenic
1011368019 6:86602539-86602561 CATTGGGAACAGACTAGGGAGGG + Intergenic
1012464487 6:99502266-99502288 CATAGGGCAAAGTCTGGGGAGGG - Intronic
1014115465 6:117663901-117663923 CTGGGAGCAGAGACTAGGGAGGG + Intergenic
1015829810 6:137356600-137356622 GATTTGGCAGAGACTAGAGTGGG + Intergenic
1017148124 6:151252979-151253001 CAAAGGGCAGACACTGGGGATGG - Intronic
1017269691 6:152491709-152491731 CTGGGAGCAGAGACTAGGGAGGG - Intronic
1018167375 6:161110897-161110919 CAGTGGACAGAGACTGAGGATGG - Intronic
1019278405 7:187944-187966 AATGGGGCAGAGGCCAGGGAGGG - Intergenic
1020315927 7:6905317-6905339 CTTTGGGCACAGACTAGGAAGGG - Intergenic
1020927038 7:14342021-14342043 CATGGGGCAGAGACTATGCTTGG + Intronic
1021393497 7:20122102-20122124 CTGGGGACAGAGACTAGGGAGGG - Intergenic
1022563562 7:31374212-31374234 CATTGGACACAGACGAGGCAAGG + Intergenic
1022729640 7:33010324-33010346 CGTGGGGCAGGGACTAGCGAGGG - Intergenic
1023177690 7:37449072-37449094 CAGTGGGCAGGGACCAGGCAGGG - Exonic
1023793111 7:43769560-43769582 CAATGGGAAGAGAGAAGGGAGGG + Intronic
1026036914 7:66836605-66836627 CTCTGGGCAGGGACAAGGGAGGG - Intergenic
1026254244 7:68697026-68697048 CAATAGGCAGAGAGTAGGGATGG + Intergenic
1026921320 7:74157755-74157777 CCTTGGGCATGGATTAGGGAGGG - Intergenic
1027414649 7:77962256-77962278 CAGTGGCCAGAGAATAGAGAAGG - Intergenic
1028423607 7:90661497-90661519 AATTGGGCAGTGACTGGGTATGG + Intronic
1030163735 7:106532618-106532640 CTGGGAGCAGAGACTAGGGAGGG + Intergenic
1030724883 7:112915333-112915355 CATTGGGCAAAAACTTGTGAGGG - Exonic
1031365003 7:120890641-120890663 CACTGGTCACGGACTAGGGAAGG - Intergenic
1031777221 7:125919122-125919144 CATTGGGCACAGACTAGGAAGGG - Intergenic
1032998269 7:137473741-137473763 CACTTGGGAGAGACTATGGATGG - Intronic
1034387338 7:150751091-150751113 CTTTGGGCAGAGAGAAGTGATGG - Intergenic
1036160876 8:6387497-6387519 CATTTGGTGGAGACTTGGGAAGG - Intergenic
1037511834 8:19591085-19591107 AATAGGGCAGAGAATAGGAAGGG + Intronic
1037920549 8:22802405-22802427 CTTTGGGCAGAAACTGGAGAAGG - Intronic
1043117117 8:76271394-76271416 CATTGAGCAAAGACTAAGCAGGG + Intergenic
1043488637 8:80724827-80724849 AATGGAGCAGAGACTAGGGCAGG - Intronic
1044637076 8:94336679-94336701 GATGGGGCAGAGGGTAGGGAAGG + Intergenic
1045329148 8:101140466-101140488 CAGTGGGCAGAGGCTAGAGATGG + Intergenic
1048196516 8:132336150-132336172 CATAGGGCAGGGTCTAGGGCTGG + Intronic
1049290650 8:141799926-141799948 CGTTGTGGGGAGACTAGGGATGG + Intergenic
1050114697 9:2251695-2251717 CATAGGGCAGAGTCAAGGAAAGG + Intergenic
1051124763 9:13791669-13791691 CAGTGGGCAGAGACCATGGAGGG + Intergenic
1051220034 9:14838599-14838621 CATTTGGTAGGGACTAGGGAGGG - Intronic
1051683917 9:19637290-19637312 CAGTGGGCAGAGACTGGGCAGGG + Intronic
1053078585 9:35155423-35155445 CTGGGAGCAGAGACTAGGGAGGG + Intergenic
1053874450 9:42529187-42529209 GATTTGGCAGGGACTAGGGGTGG - Intergenic
1054267885 9:62937568-62937590 GATTTGGCAGGGACTAGGGGTGG + Intergenic
1054457138 9:65438876-65438898 CATTGGGCAGAGAGTGGGGATGG - Intergenic
1055917762 9:81424074-81424096 TTGTGGGCAGAGACTAGGGGAGG - Intergenic
1056762362 9:89424679-89424701 CATTGGGCAGAGGTGGGGGAGGG - Intronic
1058612284 9:106789713-106789735 CATTGGGAGCAGACTAGGGAGGG - Intergenic
1059295333 9:113265252-113265274 CACTCGGAAGAGACTAGGAATGG - Intronic
1059318400 9:113446848-113446870 AGTTGGGCAGAGACTCAGGAAGG + Intronic
1059710621 9:116864667-116864689 CATGAGGCACAGACCAGGGAAGG - Intronic
1061124190 9:128663388-128663410 CCTAGTGCAGGGACTAGGGAAGG + Intergenic
1061588829 9:131585004-131585026 CCTTGGGCAGCCACGAGGGAAGG + Intronic
1203736191 Un_GL000216v2:141828-141850 CTTTTGGCAGAGCCTAGAGAAGG + Intergenic
1185464142 X:345334-345356 CACGGGGCAGCGACTGGGGAAGG + Intronic
1186112994 X:6276372-6276394 CTGGGGACAGAGACTAGGGAGGG + Intergenic
1186146564 X:6630445-6630467 CATTGGCCAGTGACCAGGTAAGG - Intergenic
1188809502 X:34635519-34635541 CATGGGGAAGAGATTAGAGAAGG + Intronic
1189376485 X:40470534-40470556 CCTTGGGCAGGGTTTAGGGAAGG + Intergenic
1190333296 X:49248585-49248607 CAGTGAGCAGAGCATAGGGATGG - Intronic
1192896385 X:75447013-75447035 CATTGGGCAGTAACTGGGGTGGG - Intronic
1193344969 X:80395031-80395053 TATTTGCCAGAGACTGGGGAGGG - Intronic
1195523886 X:105863158-105863180 CACTGTGAAGACACTAGGGATGG + Intronic
1196299784 X:114040809-114040831 CACTGGTCACGGACTAGGGAAGG + Intergenic
1196584997 X:117419159-117419181 CTGGGAGCAGAGACTAGGGAGGG - Intergenic
1197157867 X:123289832-123289854 AATTTGGCAGGGACTAGGGTGGG - Intronic
1198314220 X:135450465-135450487 CAGTGGCAAGAGACTAGGGTAGG - Intergenic
1198430198 X:136557903-136557925 ACTTGGGCAGAGAGTAGGGGAGG + Intergenic
1199243597 X:145576372-145576394 CATTGGGCTAACACCAGGGAAGG - Intergenic
1199463373 X:148108841-148108863 CAGGGGACAGAGACTAGGGTAGG - Intergenic
1200007957 X:153100227-153100249 CTGGGAGCAGAGACTAGGGAGGG + Intergenic
1201125110 Y:10905886-10905908 CTGTAGGCAGAGACTAGAGAAGG - Intergenic
1201342747 Y:12951952-12951974 CAATGGACAGAGAGGAGGGATGG - Intergenic
1201420099 Y:13788756-13788778 AATTGGGCAGAGGCTAGCGCTGG - Intergenic