ID: 1077612067

View in Genome Browser
Species Human (GRCh38)
Location 11:3649433-3649455
Sequence GCATTGGGCAGAGACTAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 4, 2: 6, 3: 44, 4: 230}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077612067 Original CRISPR GCATTGGGCAGAGACTAGGG AGG (reversed) Intronic
900365976 1:2312144-2312166 GGGTGGGGCAGAAACTAGGGAGG - Intergenic
900368617 1:2321627-2321649 GCAGTGGGCTGAGGCCAGGGAGG - Intronic
900523063 1:3115554-3115576 GCAGTGTGCACAGACTATGGGGG - Intronic
901770237 1:11526497-11526519 GCCCTGGGCAGAGGCTTGGGAGG - Intronic
902773718 1:18661033-18661055 GCAGGGGGCATAGAATAGGGAGG + Intronic
903036282 1:20494743-20494765 GCATGGGTGAGGGACTAGGGAGG - Intergenic
903608460 1:24592049-24592071 ACCTTGGGCAGGGACTGGGGAGG + Intronic
904329303 1:29747486-29747508 GCATCGGGCAGAGGCTTGGCAGG + Intergenic
904371202 1:30048523-30048545 GCATCGGGCAGAGGCTTGGCAGG + Intergenic
904419461 1:30382263-30382285 CCATTGAGCAAACACTAGGGTGG + Intergenic
905876739 1:41436225-41436247 GCAGTGGGGAGAGACTGGGTGGG + Intergenic
907736427 1:57117080-57117102 GAATTGGAGAGCGACTAGGGAGG - Intronic
911510735 1:98805458-98805480 GCATTGGGAACAGACTAGGGAGG + Intergenic
911865237 1:103010577-103010599 GCAATGAGCAGAAACAAGGGAGG - Intronic
912345558 1:108960328-108960350 GCAATGGGCAAAAACTAAGGAGG + Intronic
913182495 1:116335672-116335694 TCATTGGGCAGAGAAAAAGGAGG - Intergenic
914474472 1:148011908-148011930 GCATTGGGGTGCGACTACGGTGG + Intergenic
916664043 1:166949184-166949206 CTAGTGGGTAGAGACTAGGGAGG - Intronic
918515963 1:185363551-185363573 CCTTTGGGCAGAAACTATGGGGG - Intergenic
921302498 1:213764521-213764543 GCATTGGGAAGAGACAGAGGAGG - Intergenic
922039493 1:221882676-221882698 GCATTGGGTAGAGTCTACAGAGG - Intergenic
1062830110 10:599877-599899 ACACTGAGCAGAGACTGGGGAGG - Intronic
1063509716 10:6633774-6633796 GCAATGGGCACAGACTAGGAAGG + Intergenic
1063527795 10:6801271-6801293 GCACTGGGCACAGACTAGGAAGG + Intergenic
1068360591 10:55972217-55972239 GCATTGGTCACAGACTTGGGAGG + Intergenic
1069867516 10:71512875-71512897 TCATTGTGCAGAGACCTGGGAGG + Intronic
1069932797 10:71894045-71894067 GCAGTGGCCACAGACTAGGCAGG + Intergenic
1070759211 10:79012965-79012987 TCTTTGGGCAGAGTTTAGGGAGG - Intergenic
1071364373 10:84883700-84883722 CCATTGGGCAGTGACAGGGGTGG + Intergenic
1072275385 10:93817501-93817523 GCAGTGAGCAGGGAATAGGGTGG - Intergenic
1072810559 10:98458133-98458155 GCCTAGGGCAGAGACTAGGGAGG - Intronic
1073137118 10:101226236-101226258 GCCTTGGGTACAGTCTAGGGAGG + Exonic
1073656576 10:105423669-105423691 CCATTGGGCAATGACTGGGGTGG + Intergenic
1075091605 10:119446931-119446953 GCATTGGGAAAAGACAAGGCTGG + Intronic
1076719211 10:132385865-132385887 GCACTGGCCAGAGAGCAGGGAGG - Intergenic
1077076119 11:703011-703033 GAAGTGGGCAGAGAGGAGGGCGG - Exonic
1077612067 11:3649433-3649455 GCATTGGGCAGAGACTAGGGAGG - Intronic
1077766502 11:5164498-5164520 GCATTGGGAAGAGACTAGGGAGG + Intronic
1081065363 11:38534095-38534117 ACATTGGGCAATGACAAGGGTGG + Intergenic
1083495054 11:63044484-63044506 CCTTTGGGCAGAGACTATGGAGG - Intergenic
1085015875 11:73173821-73173843 GCAGTGGGAGGAGGCTAGGGAGG - Intergenic
1086040644 11:82473147-82473169 GTATTGGGGAGGGAATAGGGAGG - Intergenic
1088269087 11:108015589-108015611 GCATTCGACACAGCCTAGGGAGG + Intronic
1088905870 11:114155252-114155274 GGATGGCGCAGAGACTGGGGCGG + Intronic
1089317338 11:117600928-117600950 GCACTGGGAAGAGTCTTGGGAGG + Intronic
1089464440 11:118675580-118675602 GCATGGGGCAAGGTCTAGGGGGG + Intronic
1091797780 12:3307063-3307085 GCACTGGGCAGAGCTGAGGGAGG + Intergenic
1092416287 12:8292732-8292754 GCACTGGGAACAGACTAGGGAGG + Intergenic
1092478912 12:8842558-8842580 ACAGTGGGCACAGACTAGGAGGG + Intronic
1092652021 12:10645239-10645261 GCAGTGGCCAGAGAGCAGGGTGG + Intronic
1093578704 12:20764923-20764945 GCATTGGGCAGAGACTAGGAAGG - Intergenic
1093584631 12:20821167-20821189 GCATTGGGCAGAGACTAGGAAGG + Intronic
1093812963 12:23510226-23510248 ACTGTGAGCAGAGACTAGGGAGG + Intergenic
1094818399 12:34207444-34207466 GCAATGAGCTGAGACTCGGGTGG - Intergenic
1096241566 12:49962595-49962617 GCATTGGAGAGAGACCAGGGTGG - Intronic
1097464564 12:59906434-59906456 GAATTTGGCAGAGACTCTGGTGG + Intergenic
1100083407 12:90879005-90879027 CCATTGGGCAAGGACTGGGGTGG - Intergenic
1102215118 12:111155615-111155637 GCAGTGGACAGAGGCTAGGGTGG - Intronic
1102694714 12:114789801-114789823 CCAGAGGACAGAGACTAGGGTGG - Intergenic
1104342117 12:127960121-127960143 GGAATGGCCATAGACTAGGGTGG + Intergenic
1105984726 13:25554133-25554155 GGATTGGTCAGAGAATGGGGTGG + Intronic
1107075467 13:36317973-36317995 GCACTGGGCACAGACTAGGAAGG - Intronic
1107993253 13:45837009-45837031 GCATGGGGCTGGCACTAGGGCGG - Intronic
1111108891 13:83681650-83681672 GCATAGGGAAAAGACTAGAGAGG - Intergenic
1111399952 13:87721247-87721269 TCAATGTGCACAGACTAGGGTGG + Intergenic
1111652868 13:91114960-91114982 GCATGGGGCAGAAAACAGGGAGG - Intergenic
1111996197 13:95168245-95168267 GCAGAGGGCTGAGACTAGTGTGG - Intronic
1114452576 14:22836885-22836907 GCTTTGGGCCGAGCCGAGGGAGG - Exonic
1117156841 14:52950688-52950710 GCTTTCGGCAGAAACTCGGGAGG + Intronic
1125767410 15:42144774-42144796 GCATTGGTCAGAGGCTTGGGAGG - Intronic
1129259316 15:74355413-74355435 GCATTGGAAATAGACTAGGGAGG - Intronic
1131821349 15:96277584-96277606 GCATTGGCCAGAGAGCAGGAGGG - Intergenic
1134570225 16:15284367-15284389 GCATTGGGCAGAGAGGGGAGTGG + Intergenic
1134732150 16:16471686-16471708 GCATTGGGCAGAGAGGGGAGTGG - Intergenic
1134935287 16:18240277-18240299 GCATTGGGCAGAGAGGGGAGTGG + Intergenic
1135056528 16:19236661-19236683 GCATAGGGCAGAGTCCAGGAGGG + Intronic
1136341327 16:29645603-29645625 TCATTGGGCAGGCACTAGGTGGG + Intergenic
1136617967 16:31410353-31410375 GGGCTGGGCAGAGACTAGAGCGG - Intronic
1138062927 16:53910405-53910427 GCATTGTGGATAGACTAGAGAGG + Intronic
1139251533 16:65501094-65501116 GCATGAGGAAGAGATTAGGGTGG + Intergenic
1140669959 16:77268734-77268756 GAACTGGGCTGAGACTGGGGTGG - Intronic
1141681210 16:85545043-85545065 GCATTGTGCAGAGCCAATGGGGG - Intergenic
1144285970 17:13775082-13775104 GCGCTGGGGAGAGGCTAGGGAGG - Intergenic
1145090869 17:19985066-19985088 GCATAGGGCAAAGCCCAGGGAGG + Intergenic
1146184232 17:30714632-30714654 CCATCGGGAAGAGGCTAGGGTGG - Intergenic
1146582946 17:34055917-34055939 GCATTGGGAATAGAGTAGAGGGG + Intronic
1147918003 17:43900199-43900221 GCATTGGTCAGAGACCTGCGAGG + Intronic
1149712253 17:58754534-58754556 GCATTATGCAGAGACTAAAGAGG + Intergenic
1153712162 18:7810603-7810625 GTGTTGGGGAGAGACTGGGGTGG + Intronic
1153923437 18:9811524-9811546 GCAGTGGGGAGAGAGCAGGGAGG - Intronic
1155892815 18:31288442-31288464 GCATTGGGAGCAGACTAGGGAGG + Intergenic
1155972530 18:32094718-32094740 GCATTGGGTAGATAAAAGGGAGG + Intronic
1157297946 18:46459507-46459529 GCCTGGGGCAGAGAATTGGGAGG - Exonic
1158688618 18:59639740-59639762 CTTTTGGGCAGAGACTATGGGGG - Intronic
1159112274 18:64073332-64073354 GCATAGGGCAGAGTCCAGGATGG + Intergenic
1159164349 18:64683163-64683185 GCACTGGGCACAGACTAGGGAGG - Intergenic
1159946753 18:74449608-74449630 GCATTGGGCGGGGATGAGGGGGG + Intronic
1160299876 18:77669775-77669797 GCATGGAGCAGAGACTGGTGTGG + Intergenic
1160299889 18:77669826-77669848 GCATGGGGCAGAGACTGGTGTGG + Intergenic
1160299895 18:77669860-77669882 GCATGGAGCAGAGACTGGTGTGG + Intergenic
1160299901 18:77669894-77669916 GCATGGAGCAGAGACTGGTGTGG + Intergenic
1160299911 18:77669945-77669967 GCATGGGGCAGAGACTGGCATGG + Intergenic
1160299915 18:77669962-77669984 GCATGGGGCAGAGACTGGCGTGG + Intergenic
1160299919 18:77669979-77670001 GCGTGGGGCAGAGACTGGTGTGG + Intergenic
1160299927 18:77670013-77670035 GCATGGGGCAGAGACTGGTGTGG + Intergenic
1160299935 18:77670047-77670069 GCATGGGGCAGAGACTGGCGTGG + Intergenic
1160299943 18:77670081-77670103 GCGTGGGGCAGAGACTGGCGTGG + Intergenic
1160299947 18:77670098-77670120 GCGTGGGGCAGAGACTGGTGTGG + Intergenic
1160299959 18:77670166-77670188 GCATGGAGCAGAGACTGGCGTGG + Intergenic
1160299967 18:77670200-77670222 GCATGGGGCAGAGACTGGCGTGG + Intergenic
1160299971 18:77670217-77670239 GCGTGGGGCAGAGACTGGTGTGG + Intergenic
1160299979 18:77670251-77670273 GCATGGGGCAGAGACTGGTGTGG + Intergenic
1160299987 18:77670285-77670307 GCATGGGGCAGAGACTGGCATGG + Intergenic
1160299991 18:77670302-77670324 GCATGGGGCAGAGACTGGCGTGG + Intergenic
1160299995 18:77670319-77670341 GCGTGGGGCAGAGACTGGTGTGG + Intergenic
1160300003 18:77670353-77670375 GCATGGGGCAGAGACTGGTGTGG + Intergenic
1160300009 18:77670387-77670409 GCATGGAGCAGAGACTGGCGTGG + Intergenic
1160300017 18:77670421-77670443 GCATGGGGCAGAGACTGGCGTGG + Intergenic
1160300021 18:77670438-77670460 GCGTGGGGCAGAGACTGGTGTGG + Intergenic
1160300029 18:77670472-77670494 GCATGGGGCAGAGACTGGTGTGG + Intergenic
1160300037 18:77670506-77670528 GCATGGGGCAGAGACTGGCATGG + Intergenic
1160300041 18:77670523-77670545 GCATGGGGCAGAGACTGGCGTGG + Intergenic
1160300045 18:77670540-77670562 GCGTGGGGCAGAGACTGGTGTGG + Intergenic
1160300053 18:77670574-77670596 GCATGGGGCAGAGACTGGTGTGG + Intergenic
1160300061 18:77670608-77670630 GCATGGGGCAGAGACTGGCATGG + Intergenic
1160300065 18:77670625-77670647 GCATGGGGCAGAGACTGGCGTGG + Intergenic
1160300069 18:77670642-77670664 GCGTGGGGCAGAGACTGGTGTGG + Intergenic
1160300075 18:77670676-77670698 GCATGGAGCAGAGACTGGTGTGG + Intergenic
1160300081 18:77670710-77670732 GCATGGAGCAGAGACTGGCGTGG + Intergenic
1160300087 18:77670744-77670766 GCATGGAGCAGAGACTGGCGTGG + Intergenic
1160300095 18:77670778-77670800 GCATGGGGCAGAGACTGGCGTGG + Intergenic
1160300099 18:77670795-77670817 GCGTGGGGCAGAGACTGGTGTGG + Intergenic
1160300107 18:77670829-77670851 GCATGGGGCAGAGACTGGCATGG + Intergenic
1160300111 18:77670846-77670868 GCATGGGGCAGAGACTGGCATGG + Intergenic
1160300115 18:77670863-77670885 GCATGGGGCAGAGACTGGCGTGG + Intergenic
1160300127 18:77670931-77670953 GCATGGAGCAGAGACTGGTGTGG + Intergenic
1160300133 18:77670965-77670987 GCATGGAGCAGAGACTGGTGTGG + Intergenic
1160300139 18:77670999-77671021 GCATGGAGCAGAGACTGGTGTGG + Intergenic
1160300149 18:77671050-77671072 GCATGGAGCAGAGACTGGCGTGG + Intergenic
1160300157 18:77671084-77671106 GCGTGGGGCAGAGACTGGCGTGG + Intergenic
1160300161 18:77671101-77671123 GCGTGGGGCAGAGACTGGTGTGG + Intergenic
1160300169 18:77671135-77671157 GCATGGGGCAGAGACTGGCATGG + Intergenic
1160300175 18:77671169-77671191 GCATGGGGCATAGACTGGCGTGG + Intergenic
1160300181 18:77671203-77671225 GCATGGAGCAGAGACTGGTGTGG + Intergenic
1160715497 19:574684-574706 GCCTTGGGCAGAGGCTGGGGAGG + Intronic
1161999392 19:7733543-7733565 GCAGTGGGCAGTGGCTAGGGTGG + Intronic
1162974543 19:14201045-14201067 CCATCGGGAAGAGGCTAGGGTGG + Intronic
1163781393 19:19250855-19250877 GCAATGGCCAGGGACAAGGGTGG - Exonic
1164004200 19:21133977-21133999 GCTGGGAGCAGAGACTAGGGAGG + Intergenic
1164167148 19:22690854-22690876 GCTTGGGGCAGCTACTAGGGAGG - Intergenic
1164412532 19:28017848-28017870 GCATTGTGTAGTGACAAGGGTGG - Intergenic
1164830056 19:31313487-31313509 GCACCTGGCAGGGACTAGGGTGG + Intronic
1165129469 19:33622739-33622761 GCGGCGGGCAGAGACTATGGGGG + Intronic
1167348885 19:48963013-48963035 GAAGGGGACAGAGACTAGGGAGG - Intergenic
1167385530 19:49160861-49160883 GCATGGGGCAAAGACTCAGGGGG + Intronic
1167694263 19:51005042-51005064 GCATTGGGCTGAGTCAATGGAGG - Intronic
1168434191 19:56304429-56304451 CCAGTGGGCAGAGGCCAGGGAGG + Intronic
929793988 2:45044511-45044533 GCCTTGGAAAGAGACTAGGATGG + Intergenic
931236831 2:60419171-60419193 GCACTGGGCAGAGACTAGGAAGG - Intergenic
934560066 2:95308561-95308583 GCAGTGTGCAGAGACCAGTGGGG + Intronic
937149059 2:119673470-119673492 GCAGTGGGGACAGAGTAGGGAGG - Intergenic
941366712 2:164619350-164619372 GAATTGGGCAGAGGCTGGGACGG - Intronic
941705996 2:168658449-168658471 GCACAGAGCAGAGACTAGAGAGG - Intronic
941936015 2:170981838-170981860 GCATTGGGCACAGACTAGGGAGG + Intergenic
943902638 2:193460462-193460484 GCATTGGGCAGGCCTTAGGGAGG - Intergenic
944423948 2:199559972-199559994 GCTTGGGGCAGAGGTTAGGGAGG - Intergenic
944436952 2:199700148-199700170 CCTTTGGGCAGAGACTATGGGGG - Intergenic
1169199892 20:3703781-3703803 GTATTGGCCAGAGAATAGGGAGG - Intronic
1169661232 20:7980508-7980530 GAAATGGGCAGTGACTAAGGGGG + Exonic
1170501656 20:16980922-16980944 GCATTGTGCAGAGATTGGGATGG - Intergenic
1172033253 20:31995893-31995915 GGGTTGGGCAGGGACTAGGTTGG - Intronic
1172379008 20:34472858-34472880 GAAATGGGCAAGGACTAGGGTGG - Intronic
1172390129 20:34560203-34560225 GCGGTGGGCAGAGCCTCGGGTGG - Exonic
1174565947 20:51464582-51464604 GCATTGGGCAGAGAGCAGGTTGG - Intronic
1175220793 20:57415275-57415297 GCATAGGGCACAGCCTGGGGTGG + Intergenic
1176036739 20:63043303-63043325 GCATTGGGCTGAGGCCTGGGCGG + Intergenic
1177754498 21:25329690-25329712 GGATTGGGAAGAGACTAGGCAGG - Intergenic
1178500628 21:33123208-33123230 GCATTGCACAGAGGCTGGGGAGG - Intergenic
1179242613 21:39605361-39605383 GCACTGGGCAGAGCCCAAGGTGG + Intronic
1181000825 22:19987090-19987112 GCATCGGGCCGGGACTCGGGGGG + Intronic
1181663215 22:24369243-24369265 GCATTGGCCAGAGAATATGGAGG + Exonic
1181685244 22:24523489-24523511 GCATTTGGCAGACACTGGGGAGG + Intronic
1182212051 22:28684891-28684913 GCACTGTGCAGAGACTGGAGTGG - Intergenic
1182244720 22:28947057-28947079 TCATTTGGGAGAGACTAGTGAGG + Intronic
1182921495 22:34084143-34084165 GCATTGGGCAGAGCTAAGGAGGG + Intergenic
1184643979 22:45886266-45886288 GCATGGGGCAGAGACTGCTGAGG - Intergenic
950391570 3:12700941-12700963 GCAGTGGGCAGAGGCTAGACAGG + Intergenic
953083259 3:39641399-39641421 GCATCGGGCAGAGACTGCGTGGG - Intergenic
953908457 3:46880412-46880434 GCAGTGGGCACAGAGAAGGGAGG + Intronic
955068348 3:55551670-55551692 TCATTGAACAGAGACTAGGGAGG - Intronic
955478459 3:59364198-59364220 GCATTGGGCAGAGGCCAGAAAGG + Intergenic
956030480 3:65031564-65031586 TCATTTGGCAGTGAATAGGGAGG - Intergenic
956221637 3:66910241-66910263 GCAATGTGAAGAGAATAGGGGGG + Intergenic
956881866 3:73519178-73519200 CCCTTGGGCAGAAAGTAGGGTGG + Intronic
957060009 3:75474221-75474243 GCACTGGGAACAGACTAGGGAGG + Intergenic
957085230 3:75671130-75671152 GCAATGAGCGGAGACTCGGGTGG + Intergenic
957145801 3:76422250-76422272 ACATTTGGGAGAGACTAGAGTGG - Intronic
957247465 3:77733104-77733126 CCATTGGGCAAAGACAGGGGTGG + Intergenic
960156558 3:114302276-114302298 TCATAGGGCACAGAATAGGGTGG + Intronic
960789546 3:121413158-121413180 ACATTGGGCGAAGACTAGGTAGG - Exonic
961293390 3:125865224-125865246 GCACTGGGAACAGACTAGGGAGG - Intergenic
961320442 3:126069400-126069422 GCACTGGGCAGAGACTGCCGTGG + Intronic
962405161 3:135094304-135094326 CCAGTGGGCAGAGACTGGGAAGG - Intronic
963168933 3:142231861-142231883 GCATAGTGCAGAGATTAGGAGGG - Intergenic
964383335 3:156120514-156120536 GGAGTGGGCAGGGACGAGGGAGG + Intronic
965612036 3:170554652-170554674 CCGTGGGGCAGAGAATAGGGAGG - Intronic
967377681 3:188823458-188823480 TTATTGGGCACAGACTTGGGGGG + Intronic
968941418 4:3640658-3640680 GCCTGGGGCAGACGCTAGGGCGG + Intergenic
968945241 4:3660176-3660198 GCTTTGGGCAGAGCCTGGAGGGG + Intergenic
969003921 4:4004405-4004427 GCACTAGGAACAGACTAGGGAGG + Intergenic
969283049 4:6184354-6184376 GCAGTGGGCTGGGAGTAGGGAGG - Intronic
969810006 4:9640419-9640441 GCACTAGGAACAGACTAGGGAGG - Intergenic
972187876 4:36553799-36553821 GCATTAGGCAGAGTTTAGAGAGG - Intergenic
976558457 4:86476092-86476114 ACATTGGTAACAGACTAGGGAGG - Intronic
978286920 4:107090020-107090042 CTTTTGGGCAGAGACTACGGGGG - Intronic
979618064 4:122767327-122767349 GCATAGGGCAGGGTCTAGGCAGG - Intergenic
980411023 4:132419213-132419235 GCATTGGGCAGCGCTTAGGAGGG + Intergenic
982837334 4:160136747-160136769 GCATTTACCAGAGACTGGGGAGG + Intergenic
985542742 5:494347-494369 GCTTTGGGAAGAGACATGGGTGG + Intronic
985890291 5:2710143-2710165 GCCTAGGGCAGAGGCGAGGGAGG + Intergenic
986751410 5:10791299-10791321 GATTTGGGCAGGGACTAAGGTGG - Intergenic
988292360 5:29304752-29304774 CCATTGGACAGGGACTAAGGAGG - Intergenic
989803687 5:45577905-45577927 GCATTAACCAGAGAGTAGGGTGG + Intronic
992230498 5:74658718-74658740 GCATAGGGCAGAGTTTAGGAAGG - Intronic
993603842 5:89962463-89962485 GAATTGGCCAGACACTAAGGTGG - Intergenic
995215067 5:109585757-109585779 ACCTTGGGCAGTGACTAGGGAGG + Intergenic
996575127 5:124970813-124970835 GCCTTGGGAACAGACTGGGGAGG + Intergenic
997066067 5:130560591-130560613 CCTTTGGGCAGAGACTATGAGGG - Intergenic
997456156 5:134019000-134019022 GCATGGGGCAGAGTCAAGGAGGG - Intergenic
997778707 5:136635467-136635489 GCTTTGGGCAGAGACTTTTGGGG + Intergenic
998488814 5:142528080-142528102 GGATTGGACAGAGCCCAGGGTGG - Intergenic
999121407 5:149212394-149212416 GCATTGTGGAGAGACTGGGAAGG + Intronic
999728741 5:154459411-154459433 CCATGGGGCAGAGACTAAGATGG - Exonic
1001541564 5:172543156-172543178 ACCTTGGGCGGAGACTAGGGGGG + Intergenic
1002666186 5:180827231-180827253 GCATTGGCCAGAGACTTGAAAGG + Intergenic
1003050016 6:2771500-2771522 GCATTTGTCAGAGCCTAAGGGGG + Intronic
1004456450 6:15796217-15796239 CAATTGGGCAGAGACTTGAGGGG + Intergenic
1004781618 6:18914707-18914729 GCATAGGGCAAAGTCTAGGAAGG + Intergenic
1005830429 6:29666821-29666843 GCATTGGGGAGACACTTGGTAGG - Intronic
1007392249 6:41556267-41556289 GCATGGGGGAGAGAGGAGGGAGG + Intronic
1010804007 6:80213603-80213625 GCTTTGGGCAGAGAGTGAGGGGG - Intronic
1011368018 6:86602538-86602560 GCATTGGGAACAGACTAGGGAGG + Intergenic
1012464488 6:99502267-99502289 GCATAGGGCAAAGTCTGGGGAGG - Intronic
1015829809 6:137356599-137356621 TGATTTGGCAGAGACTAGAGTGG + Intergenic
1015906794 6:138125535-138125557 GCTTTGGGCCAAGACTAGGGAGG - Intergenic
1020221234 7:6239306-6239328 GTGGTGGGCAGAGACTAGGAAGG - Intronic
1020315928 7:6905318-6905340 GCTTTGGGCACAGACTAGGAAGG - Intergenic
1023177691 7:37449073-37449095 GCAGTGGGCAGGGACCAGGCAGG - Exonic
1023793110 7:43769559-43769581 GCAATGGGAAGAGAGAAGGGAGG + Intronic
1025223690 7:57138127-57138149 CCTGTGGGCAGAGACTAGGAGGG - Intronic
1025745988 7:64243292-64243314 CCTGTGGGCAGAGACTAGGAGGG + Intronic
1029523175 7:101077444-101077466 CCAGTGGGCAGAGCCTGGGGAGG - Intergenic
1031777222 7:125919123-125919145 GCATTGGGCACAGACTAGGAAGG - Intergenic
1031865562 7:127035499-127035521 GAATTGGGAAGAGACTACTGTGG - Intronic
1032327193 7:130940957-130940979 GAATTGTGCAGAAACTAGGTGGG - Intergenic
1033557951 7:142505351-142505373 GCAGTGGGGAGATACTAGAGTGG + Intergenic
1037543138 8:19891096-19891118 CCATAGAGCAGAGACTAGTGAGG - Intergenic
1039482101 8:37881837-37881859 GTATTGGACAGACACTAGGCTGG - Intronic
1042000957 8:64123199-64123221 CCATTGGGCAGTGACAGGGGAGG + Intergenic
1043117116 8:76271393-76271415 GCATTGAGCAAAGACTAAGCAGG + Intergenic
1046307312 8:112386149-112386171 GAAGTGGGCAGGGACGAGGGAGG + Intronic
1047790016 8:128193661-128193683 GCAGTGTGAAAAGACTAGGGAGG + Intergenic
1048601247 8:135920962-135920984 GAATATGGTAGAGACTAGGGTGG + Intergenic
1051124762 9:13791668-13791690 ACAGTGGGCAGAGACCATGGAGG + Intergenic
1051220035 9:14838600-14838622 ACATTTGGTAGGGACTAGGGAGG - Intronic
1051304537 9:15694717-15694739 GCACTGGACAGAGACTAAGATGG - Intronic
1051683916 9:19637289-19637311 TCAGTGGGCAGAGACTGGGCAGG + Intronic
1053042917 9:34890084-34890106 GCCTTGAGCAGAGACTAGCAAGG - Intergenic
1056181500 9:84087667-84087689 CTTTTGGGCAGAGACTATGGGGG + Intergenic
1057222110 9:93263008-93263030 GCAGTGCCCAGAGACTAGGAGGG + Intronic
1058612285 9:106789714-106789736 GCATTGGGAGCAGACTAGGGAGG - Intergenic
1060297505 9:122352993-122353015 GTATAGGGCAGAGCCCAGGGGGG + Intergenic
1061950097 9:133931337-133931359 GCAAGGGGCAGGGACCAGGGAGG + Intronic
1062038243 9:134392271-134392293 GCCTGGGGCAGAGGCTAGGAGGG - Intronic
1062434191 9:136539294-136539316 GCCTGGGGCGGAGACTGGGGTGG - Intronic
1203444679 Un_GL000219v1:44486-44508 GCAATGAGCCGAGACTCGGGTGG - Intergenic
1187447923 X:19374188-19374210 GGATTGGGAAGAGAGTGGGGAGG - Intronic
1192311401 X:70017950-70017972 CTTTTGGGCAGAGACTATGGGGG - Intronic
1192896386 X:75447014-75447036 CCATTGGGCAGTAACTGGGGTGG - Intronic
1193344970 X:80395032-80395054 GTATTTGCCAGAGACTGGGGAGG - Intronic
1196183031 X:112715811-112715833 GCATTGGGGAGAGAGAAAGGTGG - Intergenic
1196729675 X:118928230-118928252 GCATTGGACAGAGTCCAGAGAGG + Intergenic
1197157868 X:123289833-123289855 GAATTTGGCAGGGACTAGGGTGG - Intronic
1199284469 X:146040584-146040606 CCTTTGGGCAGAGACTATGGAGG - Intergenic
1199429920 X:147747227-147747249 GAATGGGGGAGAGAGTAGGGAGG + Intergenic