ID: 1077613841

View in Genome Browser
Species Human (GRCh38)
Location 11:3661151-3661173
Sequence AGAGTAGACCCTGGCTCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077613835_1077613841 -2 Left 1077613835 11:3661130-3661152 CCCAGGGAGCAGGAGTGCCCCAG 0: 1
1: 1
2: 0
3: 34
4: 376
Right 1077613841 11:3661151-3661173 AGAGTAGACCCTGGCTCTGATGG 0: 1
1: 0
2: 0
3: 19
4: 161
1077613836_1077613841 -3 Left 1077613836 11:3661131-3661153 CCAGGGAGCAGGAGTGCCCCAGA 0: 1
1: 0
2: 1
3: 37
4: 329
Right 1077613841 11:3661151-3661173 AGAGTAGACCCTGGCTCTGATGG 0: 1
1: 0
2: 0
3: 19
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077613841 Original CRISPR AGAGTAGACCCTGGCTCTGA TGG Intronic
900571434 1:3360618-3360640 AGAGTGGCACCTGGCTCTGATGG - Intronic
901496786 1:9626999-9627021 AGCGTAAACCCTGGCGCTGCTGG - Intergenic
902605100 1:17564706-17564728 AGAGTGGCCCCTGTCTCAGAGGG + Intronic
906279641 1:44544243-44544265 AGAGCAGTCCTTGGCTCAGATGG - Intronic
907336762 1:53704720-53704742 AGTTTAGCCCCTGGCTCTGTGGG + Intronic
914724995 1:150320076-150320098 AGGATAAAGCCTGGCTCTGAAGG - Intergenic
916192265 1:162191257-162191279 AGAGTAGTGCCTGTCTCTTAGGG - Intronic
917978729 1:180256341-180256363 AAACTAGACACTGGCTCTAATGG - Intronic
919332879 1:196193372-196193394 AGATTATATCCTGGCTCAGAGGG - Intergenic
919754969 1:201061018-201061040 AGACTAGACTGTGGGTCTGAAGG + Intronic
920230849 1:204468804-204468826 AGACTAGTCCCTGTTTCTGAAGG + Intronic
921670962 1:217923687-217923709 AGAGTAGACCCTGGATGGCAAGG - Intergenic
922408369 1:225342851-225342873 AGTGTGGACCCAGGCTGTGAGGG - Intronic
922612726 1:226941919-226941941 AGATAACACACTGGCTCTGAGGG - Intronic
1063363869 10:5478181-5478203 AGAGGTGACTCTGGCTCTGGTGG - Intergenic
1063964789 10:11338545-11338567 AGAGTGGACAGTGTCTCTGAAGG - Intergenic
1067767640 10:49099001-49099023 AGAATGGATCCTGTCTCTGAAGG + Intronic
1069092256 10:64214541-64214563 ATAGAAGACTCTGACTCTGAAGG + Intergenic
1069432281 10:68348499-68348521 AGAGGAAACTCTGTCTCTGAGGG + Intronic
1069720040 10:70544122-70544144 AGAGCAGACACTGGTTCTAAGGG + Intronic
1070289412 10:75104862-75104884 AGAGCAGTTCCTGTCTCTGAAGG - Intronic
1072494051 10:95936824-95936846 AGGGCAGACCTTAGCTCTGAAGG + Intronic
1073483241 10:103800069-103800091 GGAGTGGACCCTGGCTGTGAGGG + Intronic
1074183398 10:111082104-111082126 AGGGAAGACCATGGCTCTGAGGG + Intergenic
1074324827 10:112439695-112439717 GGAGGAGGACCTGGCTCTGAAGG - Intronic
1074995351 10:118753463-118753485 AGAGAAAAACCTGGCTGTGATGG + Intronic
1077235652 11:1480923-1480945 CGGGCAGACCCTGGGTCTGATGG - Intronic
1077613841 11:3661151-3661173 AGAGTAGACCCTGGCTCTGATGG + Intronic
1078016332 11:7618068-7618090 AGAGGATACCCTGGCTCTGTAGG + Intronic
1080165445 11:29230950-29230972 AATGTTGACCCTGCCTCTGATGG + Intergenic
1084208370 11:67609169-67609191 AGAGTAGAATCTGGCTCTCAGGG + Intronic
1084534086 11:69746584-69746606 AGACTAGACCCTGGCAATGTCGG - Intergenic
1087181428 11:95146108-95146130 AGAGTAGCTCAGGGCTCTGAGGG - Intergenic
1090033772 11:123230505-123230527 AGAGTAGACCTGAGCTCTGGTGG + Intergenic
1090158243 11:124464198-124464220 GGAGTGGCCCCTGGGTCTGACGG + Intergenic
1090878595 11:130813688-130813710 AGGGCAGGCCCTGGTTCTGAAGG + Intergenic
1091254266 11:134169980-134170002 ACAGCAGACACTGGCTCTGGAGG + Intronic
1092501108 12:9049117-9049139 AGAGTAGGTCCCTGCTCTGAAGG - Intergenic
1093977850 12:25442186-25442208 ATAGTACACACTGTCTCTGAGGG - Intronic
1094486340 12:30928430-30928452 AGCGTTGGCCCTGGGTCTGAAGG - Intronic
1095058380 12:37648186-37648208 AGAGTTGAACCTGTCTTTGATGG + Intergenic
1095058654 12:37653273-37653295 AGAGTTGAACCTGTCTTTGATGG + Intergenic
1096613960 12:52821248-52821270 AGAGGAGACCAAGGCTCAGAGGG - Intergenic
1096634543 12:52949872-52949894 GGAGGAGACACTGGCTCTGGCGG + Intronic
1096970250 12:55659767-55659789 AGGGGAGGCCCTGGCACTGAGGG + Intergenic
1100382032 12:94071228-94071250 AGAGTAGACCATGGTGCTAAAGG + Intergenic
1104284871 12:127415830-127415852 AGGGAAGACCCAGGCTCTGGGGG + Intergenic
1104735631 12:131134302-131134324 AGAGGGGTCCCTGGATCTGAAGG - Intronic
1108684219 13:52804773-52804795 AGTGTCTTCCCTGGCTCTGATGG + Intergenic
1108832779 13:54500065-54500087 AGCATAGACCCTGGGTCTGCTGG - Intergenic
1113456765 13:110454977-110454999 AGAGTAGCCCAGGGCTCTGCTGG - Intronic
1119089207 14:71764891-71764913 AGGGAAAATCCTGGCTCTGAAGG + Intergenic
1120695849 14:87644056-87644078 AGAGTAGACCATTGCTTTGGTGG + Intergenic
1202904950 14_GL000194v1_random:64770-64792 AGAGTAGACACTTTCACTGAAGG - Intergenic
1126777885 15:52114764-52114786 AGAGAAGACCCTGAATCAGATGG + Intergenic
1127270668 15:57398566-57398588 AAAGTAGACGCTGGCACTGTGGG + Intronic
1132383371 15:101382224-101382246 GCAGGAGAGCCTGGCTCTGAAGG - Intronic
1132746345 16:1437927-1437949 AGAGAAGAGCCGGGCTCTGGAGG - Exonic
1133045493 16:3086408-3086430 AGCAGAGACCGTGGCTCTGATGG + Intergenic
1135100165 16:19598160-19598182 ATCGTAGACCCTGCCTCTAAGGG + Intronic
1136085891 16:27884741-27884763 AGAATAGAACCTGGTTCTGGGGG + Intronic
1136493198 16:30624494-30624516 GGAGCAGACCCTTGCTTTGAGGG + Intergenic
1137637501 16:49999634-49999656 GGAGGTGACCCTGGCTGTGAAGG + Intergenic
1142077493 16:88128616-88128638 AGAGAAGCCCCTGCCTCTGCGGG - Intergenic
1142344346 16:89544615-89544637 AGAGCAGACAGTGGCTCTGAGGG - Intronic
1149990232 17:61379102-61379124 AGAGGAGAGCCTGGCTCTGGGGG - Intronic
1151515382 17:74591057-74591079 AGAGCACACCCTGTCTCAGAAGG + Intronic
1152262179 17:79273167-79273189 AGAGAACACCCTGGATCTGCTGG - Intronic
1152325016 17:79631000-79631022 TGAGTGGACTCTGGCTCTGACGG - Intergenic
1156706227 18:39886032-39886054 AGAGTTAACTCTGGCTCTAAAGG + Intergenic
1157912753 18:51633947-51633969 ACAGTAGTCCCTGGGTCTCAAGG - Intergenic
1160170033 18:76545206-76545228 TGATCAGACCATGGCTCTGATGG + Intergenic
1160287188 18:77554713-77554735 AGAGGAAAGCCTGACTCTGATGG - Intergenic
1160710687 19:549688-549710 AGTGCAGACCCTGGAGCTGAAGG - Exonic
1161311400 19:3596005-3596027 GGAGTGGACCCTGGATCTCAAGG - Intronic
1162376434 19:10308245-10308267 AGAGTGGACCCTGGGTTCGAGGG - Exonic
1162938369 19:13993451-13993473 AGCCTAGACCCTGGGTGTGAAGG - Intronic
1163205682 19:15800922-15800944 AGAGTCCAACCTGGGTCTGAAGG - Intergenic
1163584455 19:18156240-18156262 AGAGGAGACCAAGGGTCTGAGGG - Intronic
1167422862 19:49414220-49414242 GGAGTAGACCCTGGGCCTGTAGG - Intronic
925257588 2:2503354-2503376 AGAGGAGACCCTGGCCTGGAAGG + Intergenic
927502421 2:23591552-23591574 AGAGTAGTCACTGGCTGTGGGGG - Intronic
933747291 2:85580433-85580455 AGGGCAGACCCTGGGACTGAGGG - Intronic
935698017 2:105786735-105786757 AGAGTAGAAGCTGGACCTGAAGG - Intronic
935965449 2:108468527-108468549 AGAGAATAACCTGTCTCTGAGGG + Intronic
936959184 2:118055801-118055823 TAAATAGACCCTGGCTCTGCTGG + Intergenic
937479540 2:122244060-122244082 CCTGTAAACCCTGGCTCTGAGGG - Intergenic
937690550 2:124750128-124750150 AAAATAGTCCCTGGCTCTAAAGG - Intronic
938109280 2:128553233-128553255 CAAGTAGACCCAGGCTCAGATGG - Intergenic
940633395 2:156266647-156266669 AGAGGAGACCCTGTCTCAAAAGG - Intergenic
940847684 2:158659464-158659486 AGACTAGATCCCTGCTCTGATGG + Intronic
942607627 2:177709372-177709394 AGAGGAGGCACTGGCTTTGAGGG + Intronic
946026967 2:216677727-216677749 AAAGGAGAGCCTGGCTGTGAAGG + Intronic
947324529 2:228959961-228959983 AGAGCAGACCGTGCTTCTGAGGG + Intronic
1168763764 20:367881-367903 AGAGCAGATCCTGTCTCAGAGGG - Intronic
1172240244 20:33408303-33408325 AGAGTGGACTCTGCCTGTGATGG - Exonic
1174259121 20:49280600-49280622 TGAGTAGACACAGGCTCTGGAGG + Intergenic
1175485686 20:59344427-59344449 AGTGTAGACCCTGGCCCTAGTGG + Intergenic
1176326096 21:5502453-5502475 AGAGTAGCCCAGGGCTCTCAAGG + Intergenic
1176401661 21:6318498-6318520 AGAGTAGCCCAGGGCTCTCAAGG - Intergenic
1176435496 21:6670606-6670628 AGAGTAGCCCAGGGCTCTCAAGG + Intergenic
1176459758 21:6997676-6997698 AGAGTAGCCCAGGGCTCTCAAGG + Intergenic
1176483319 21:7379454-7379476 AGAGTAGCCCAGGGCTCTCAAGG + Intergenic
1176624312 21:9079528-9079550 AGAGTAGACACTTTCACTGAAGG - Intergenic
1178618197 21:34152496-34152518 AGAGCAGAACCAGGCTCTGGGGG - Intergenic
1181090857 22:20471593-20471615 AGAGAAGAACCTGGCGCTGGTGG + Intronic
1181463746 22:23099835-23099857 AGTGAAGACCCAGGCTCTGCTGG - Intronic
1181751049 22:24989471-24989493 AGAGTTGACCAGGGCTATGAAGG - Intronic
1182343875 22:29645643-29645665 AGAGCAGACCCAGCCTCTCAAGG + Intronic
1182878311 22:33711428-33711450 TGAATAGACCATGGGTCTGAAGG + Intronic
1182958688 22:34451900-34451922 AGATTAGACTCAGTCTCTGAAGG - Intergenic
1183756081 22:39766453-39766475 AGAGCAAGCCCTGGCGCTGAGGG - Intronic
1184227599 22:43138255-43138277 ACAGTAGCCCATGTCTCTGATGG - Intronic
950541707 3:13617069-13617091 AGACTTGGACCTGGCTCTGATGG + Intronic
950793878 3:15494945-15494967 AGAGTAGTACCTAGCTCTTAGGG - Intronic
953874795 3:46660590-46660612 AGAGAAGAGCTTGCCTCTGAAGG + Intergenic
954211802 3:49101867-49101889 TGACCAGACCCTGTCTCTGATGG - Exonic
955893582 3:63675605-63675627 TTAGTAGACACTGGATCTGAAGG + Intronic
959985029 3:112562362-112562384 AGGGTAGTCCCTGACTGTGAAGG + Intronic
961616644 3:128188073-128188095 AGAGTTTACCCTGGCATTGATGG + Intronic
962405616 3:135097384-135097406 AGACAGGACCCTGGCTCTGAAGG + Intronic
963747024 3:149134919-149134941 AGAGCTGACTCTGGCTATGATGG + Intronic
964590394 3:158356735-158356757 TGAGTAAACCCTTGCTTTGAAGG + Intronic
965695089 3:171400089-171400111 AGAGTGGACCCGGGACCTGATGG + Intronic
969681129 4:8644160-8644182 AGCGTCCACCCTGGCTCTGTAGG + Intergenic
970576879 4:17436818-17436840 AGAGTGGACCCCGGCAGTGAGGG - Intergenic
978821557 4:112972486-112972508 AGAGGAGACCCTGGGCCTGGTGG + Intronic
979073065 4:116235854-116235876 AGAGCATACTCTGACTCTGAAGG + Intergenic
979194172 4:117900228-117900250 TGAGTAGATCCAGGCTCTAAGGG + Intergenic
979974014 4:127173449-127173471 AGAGGAGACCCTGAGTCTGGAGG + Intergenic
985050143 4:185982092-185982114 AGAGCCTACTCTGGCTCTGAAGG + Intergenic
985495308 5:200972-200994 TGTGTAGACGCTGGCTGTGATGG - Exonic
985615536 5:918316-918338 AAAGCAGAGCCTGGCTCTGGGGG + Intronic
985731886 5:1553977-1553999 TGAGGGGACCCTGGCTCTGTGGG + Intergenic
986717895 5:10537463-10537485 AGAGCAACGCCTGGCTCTGAGGG - Intergenic
987429355 5:17813329-17813351 AGAGTTGAGGCTGACTCTGAAGG + Intergenic
990007079 5:50956059-50956081 AGAGTTGACCCAGTCTTTGATGG - Intergenic
990286763 5:54308325-54308347 AGAGTAGCCACTGGCTTTTATGG + Intronic
993016384 5:82539233-82539255 AGACTAGAGTCTGGCTTTGAGGG + Intergenic
993109387 5:83637251-83637273 AGAATGGACCCTGTCTATGATGG - Intergenic
997610946 5:135215333-135215355 GGAGAAGTCCCTGGCTCTGAGGG - Intronic
997699368 5:135885626-135885648 AGACTCAGCCCTGGCTCTGAAGG - Intronic
999325299 5:150640028-150640050 AGAGAAGACGCTGGCTCAGAGGG - Intronic
1001298814 5:170518758-170518780 AGAACAGACCCTACCTCTGAGGG - Intronic
1006257938 6:32845804-32845826 AGGGTAGTCCCCGGCTCTGACGG - Intronic
1008620868 6:53270438-53270460 AGAGCAGCCCCTGCCTCTGGGGG - Intronic
1010474872 6:76274806-76274828 AGAGGAGACCATTGCCCTGAAGG - Intergenic
1012424868 6:99102752-99102774 AGAGTAGACCACAGATCTGATGG - Intergenic
1015769645 6:136755344-136755366 AGAGGAGACCCTGTGTCTGAGGG - Intronic
1017025665 6:150178355-150178377 ACAGTGGACGCTGGCTCTGTGGG + Intronic
1018868168 6:167761221-167761243 TGGGAAGACCCTGGCCCTGAAGG + Intergenic
1019777204 7:2918835-2918857 GGAGGAGACCGTGGCTCAGAGGG - Intronic
1020280844 7:6649278-6649300 AGAGGAGACCCTGGGACTGACGG - Intronic
1021527854 7:21608996-21609018 ATGGTGGACCCTGGTTCTGAAGG + Intronic
1024084252 7:45880694-45880716 ACAGGTGACCCTGGCTCTGCAGG - Intergenic
1024558450 7:50623504-50623526 AGAGTAGCCCCTCTCGCTGAGGG - Intronic
1025153384 7:56579090-56579112 AAAGGAGACTCTGGCTCTCATGG - Intergenic
1030312327 7:108081240-108081262 ACAGTTGACCCTTGCTCTGGAGG + Intronic
1033368611 7:140689780-140689802 AGAGCAGATCCTGGGTCTAAGGG + Intronic
1038440684 8:27569132-27569154 ACAGTAGACCCTGGCTCTTCAGG + Intergenic
1040478206 8:47799528-47799550 AGAGTCCACCCTGGCTGTGAAGG + Intronic
1044513149 8:93107578-93107600 AAATTAGAACCTGCCTCTGATGG + Intergenic
1044828057 8:96217533-96217555 AGATTTGACCCTTGCTCTGGAGG + Intergenic
1047536586 8:125725647-125725669 AGGGCAGTCCCTGGCTCTGAAGG - Intergenic
1049682145 8:143924135-143924157 GGAGGAGATCCTGGCGCTGAAGG - Exonic
1051401572 9:16689391-16689413 CAAGTGGACCCTGGCTCTGCAGG - Intronic
1054744756 9:68843334-68843356 TGAGTAGAACATGGCGCTGAGGG - Intronic
1057027328 9:91744783-91744805 AGAGAAGACAATGGCTCTGAGGG + Intronic
1058398938 9:104590925-104590947 TGAGTAGACCCTGGTTCTGGAGG + Intergenic
1061394200 9:130334356-130334378 AGAGCAGACACAGGCTCTGCTGG + Intronic
1061970718 9:134043707-134043729 AGAGGAGACCCTGAGGCTGATGG - Intronic
1203747490 Un_GL000218v1:49960-49982 AGAGTAGACACTTTCACTGAAGG - Intergenic
1203562228 Un_KI270744v1:67786-67808 AGAGTAGACACTTTCACTGAAGG + Intergenic
1186525721 X:10246468-10246490 CGGGTAGACCCTGGCTTTGTAGG + Intergenic
1188445640 X:30250550-30250572 AGAGGAGACCCAGGGTCTCAAGG + Exonic
1190285910 X:48961351-48961373 AGAGTATCTCCTGGCTCTGTGGG - Intergenic
1193724347 X:85021493-85021515 AGAATGGACCCTGGGTCTGCTGG - Intronic
1193860269 X:86657066-86657088 AGAGTAGAAGGTGGCTCAGAAGG + Intronic
1195538485 X:106035649-106035671 AGAGGAAACTATGGCTCTGATGG - Intronic
1197954843 X:131934990-131935012 ATTGTAGTCCCTGGCTCTCAGGG + Intergenic
1201160818 Y:11164944-11164966 AGAGTAGACACTTTCACTGAAGG - Intergenic