ID: 1077614816

View in Genome Browser
Species Human (GRCh38)
Location 11:3667150-3667172
Sequence CGCGACAGGGCCTGGGTCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 265}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077614816_1077614825 -8 Left 1077614816 11:3667150-3667172 CCGCAGACCCAGGCCCTGTCGCG 0: 1
1: 0
2: 0
3: 15
4: 265
Right 1077614825 11:3667165-3667187 CTGTCGCGGCCCCGCCCTGGGGG 0: 1
1: 0
2: 0
3: 10
4: 124
1077614816_1077614832 12 Left 1077614816 11:3667150-3667172 CCGCAGACCCAGGCCCTGTCGCG 0: 1
1: 0
2: 0
3: 15
4: 265
Right 1077614832 11:3667185-3667207 GGGGACCCCAGCGCATCGTCAGG 0: 1
1: 0
2: 0
3: 2
4: 48
1077614816_1077614824 -9 Left 1077614816 11:3667150-3667172 CCGCAGACCCAGGCCCTGTCGCG 0: 1
1: 0
2: 0
3: 15
4: 265
Right 1077614824 11:3667164-3667186 CCTGTCGCGGCCCCGCCCTGGGG 0: 1
1: 0
2: 2
3: 17
4: 166
1077614816_1077614826 -7 Left 1077614816 11:3667150-3667172 CCGCAGACCCAGGCCCTGTCGCG 0: 1
1: 0
2: 0
3: 15
4: 265
Right 1077614826 11:3667166-3667188 TGTCGCGGCCCCGCCCTGGGGGG 0: 1
1: 0
2: 1
3: 12
4: 108
1077614816_1077614822 -10 Left 1077614816 11:3667150-3667172 CCGCAGACCCAGGCCCTGTCGCG 0: 1
1: 0
2: 0
3: 15
4: 265
Right 1077614822 11:3667163-3667185 CCCTGTCGCGGCCCCGCCCTGGG 0: 1
1: 0
2: 1
3: 30
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077614816 Original CRISPR CGCGACAGGGCCTGGGTCTG CGG (reversed) Intronic
900373726 1:2343961-2343983 CGGGACTGGGCCTGGGGCTGGGG + Intronic
900479317 1:2890394-2890416 TGGGTCAGGGCCCGGGTCTGGGG + Intergenic
902579829 1:17401433-17401455 AGCTCCAGGGCCTGGGTCTAAGG - Exonic
904042682 1:27593501-27593523 TGGGCCAGGGCCTGGGTCTTAGG - Intronic
905332984 1:37220533-37220555 TGTGACAGGGTCTGGCTCTGTGG - Intergenic
906192979 1:43910625-43910647 AGCAACAGGGCCTGGGCCTAAGG + Intronic
907797396 1:57731309-57731331 GGGGACAGGGCCTGGGGGTGGGG + Intronic
907855500 1:58299864-58299886 AGGGACAGGGCCTAGGTATGTGG - Intronic
909961828 1:81855419-81855441 TGAGACAGGGCCTCGCTCTGTGG - Intronic
912499515 1:110112787-110112809 TGCCACAGGGGCTGGGTCTGCGG - Exonic
913962970 1:143353727-143353749 CGGGACAGGGGCTGGGTGGGTGG + Intergenic
914057325 1:144179312-144179334 CGGGACAGGGGCTGGGTGGGTGG + Intergenic
914121821 1:144787054-144787076 CGGGACAGGGGCTGGGTGGGTGG - Intergenic
915945873 1:160151573-160151595 AACCACAGGGCCTGGGACTGGGG + Exonic
919385994 1:196923125-196923147 TGAGACAGGGACTGGCTCTGTGG - Intronic
920195827 1:204226402-204226424 AGCGCCAGGGGCTGGGGCTGGGG + Intronic
922730037 1:227945004-227945026 CAGGGCTGGGCCTGGGTCTGGGG - Intronic
923913672 1:238479132-238479154 TGAGACAGGGTCTGGCTCTGTGG + Intergenic
924630870 1:245739398-245739420 TGAGACAGGGTCTGGCTCTGTGG + Intergenic
924657889 1:245990085-245990107 TGAGACAGGGCCTCAGTCTGTGG + Intronic
1064957979 10:20932402-20932424 CACACCAGGGCCTGGGGCTGGGG + Intronic
1067039320 10:42940622-42940644 TGCACCAGGGCCTGGGTCTCCGG - Intergenic
1067275173 10:44827697-44827719 CCTGACAGGGCCTGGCTCTCTGG + Intergenic
1067408756 10:46046685-46046707 GCCCACCGGGCCTGGGTCTGTGG + Intergenic
1068545014 10:58335234-58335256 CGGGGCCGGGCCTGGGGCTGCGG + Intronic
1070770483 10:79079615-79079637 GGCCACAGGGCCTGGCACTGGGG + Intronic
1072362954 10:94677769-94677791 GGCAACAAGTCCTGGGTCTGAGG - Intergenic
1072758376 10:98036088-98036110 CAAGGCAGGGCCAGGGTCTGGGG - Intergenic
1075721978 10:124592713-124592735 TGGGACAGGACCAGGGTCTGAGG + Intronic
1076096345 10:127737244-127737266 CGCGCCCGGGCCTGGGCCAGCGG - Exonic
1076275025 10:129191480-129191502 CCCTACAGGGGCTGGGGCTGGGG - Intergenic
1077223188 11:1426341-1426363 GGCGACTGGGCTTGGATCTGTGG + Intronic
1077514207 11:2992058-2992080 CGCGGCGGGGCCTGGGGCTTGGG - Intronic
1077527217 11:3074425-3074447 TGAGACAGGGTCTGGCTCTGTGG - Intergenic
1077614816 11:3667150-3667172 CGCGACAGGGCCTGGGTCTGCGG - Intronic
1081665108 11:44912039-44912061 CGAGACAGGGTCTCAGTCTGTGG + Intronic
1083206231 11:61150890-61150912 TGTGACAGGCCCTGCGTCTGAGG + Intronic
1083648810 11:64188405-64188427 AGAGACAGGGTCTGGTTCTGTGG + Intronic
1083817980 11:65148119-65148141 TGTGGCAGGCCCTGGGTCTGGGG - Intergenic
1083849240 11:65355459-65355481 CGGGGGAGGGCCTGGGACTGGGG - Intronic
1083860206 11:65416379-65416401 CAGGGCTGGGCCTGGGTCTGAGG + Intergenic
1084568250 11:69943808-69943830 TGGGACAGGGCCTTGTTCTGGGG - Intergenic
1085037352 11:73308390-73308412 CGCGGCGGGGGCTGGGCCTGGGG + Exonic
1085128029 11:74015161-74015183 CAGGGCACGGCCTGGGTCTGAGG + Intronic
1088452637 11:109998205-109998227 TGAGACAGGGTCTGGCTCTGTGG + Intergenic
1088831347 11:113539534-113539556 AGTGTCAGGGCCTGGGTTTGGGG - Intergenic
1089199576 11:116715648-116715670 TGGGACAGGGGCTGGGCCTGGGG + Intergenic
1089346853 11:117796544-117796566 CGCGCCAGGGCTGGGGTCCGCGG + Intronic
1089366048 11:117921684-117921706 CTCTGCAGGCCCTGGGTCTGGGG + Intronic
1090080052 11:123606330-123606352 CAGGAAAGGGCCTGGGCCTGTGG + Intronic
1091390185 12:121536-121558 AGCGAAAGGGCCTTGGTCTTGGG - Intronic
1092667211 12:10815990-10816012 CTCACCAGGGCCTGGGACTGTGG - Intergenic
1097985212 12:65775799-65775821 CTGGCCAGAGCCTGGGTCTGTGG - Intergenic
1104633389 12:130423395-130423417 GGCGCCAGGCCTTGGGTCTGAGG - Intronic
1104874117 12:132021231-132021253 TGCGAGGGGGCCTGGGGCTGGGG - Exonic
1104989855 12:132619160-132619182 CGGGGCAGGGGCTGGGACTGGGG + Intronic
1105705943 13:22967481-22967503 GGCGGCAGGGCCTGGGTTGGGGG + Intergenic
1105858843 13:24392465-24392487 GGCGGCAGGGCCTGGGTTGGGGG + Intergenic
1109825540 13:67716379-67716401 GGCGGCAGGGCCTGAGTCTGAGG + Intergenic
1112041470 13:95552574-95552596 AGGGACAGGGCATGGGTGTGAGG + Intronic
1113523444 13:110956117-110956139 CCCGGCAGGGCCCGGGACTGCGG - Intergenic
1113701860 13:112394379-112394401 CCCGGCAGGGCCCGGGACTGCGG + Intronic
1113737930 13:112690820-112690842 CCCGCCGGGGCCCGGGTCTGGGG + Intronic
1113904038 13:113811227-113811249 TGAGAGAGGTCCTGGGTCTGTGG + Intronic
1113904088 13:113811359-113811381 TGAGAGAGGTCCTGGGTCTGCGG + Intronic
1118192632 14:63594438-63594460 CACGACAGGGCCTGGGCCCCTGG - Intergenic
1118837518 14:69487257-69487279 CCAGAGAGGGCCTGGGTGTGGGG + Intronic
1119954548 14:78782581-78782603 TGTGACAGGGACTGGGTCTAAGG + Intronic
1121510600 14:94510054-94510076 CGTCTCAGGGCCTGGGCCTGTGG + Intronic
1122115998 14:99527579-99527601 CTGGACAGGGCCTGGGACTGGGG - Intronic
1122286382 14:100655072-100655094 AGCCACAGGGCCTGGGGGTGGGG + Intergenic
1123054237 14:105561678-105561700 CCCGAGTGGGCCTGCGTCTGTGG + Intergenic
1123078821 14:105682097-105682119 CCCGAGTGGGCCTGCGTCTGTGG + Intergenic
1124046628 15:26156395-26156417 CCCAACTGGGCCTGGGTCTCAGG - Intergenic
1125332436 15:38595327-38595349 ACCGACAGGGCCTGGGCTTGGGG - Intergenic
1125442895 15:39722433-39722455 GGCGTCAGGGACTGGGTTTGTGG - Intronic
1125590610 15:40852497-40852519 CTTGACAGTGCCTGTGTCTGAGG - Intronic
1126436632 15:48644806-48644828 CGCGCCCGGGGCTCGGTCTGCGG + Exonic
1126648171 15:50895532-50895554 CCCCACAGGTCCTGTGTCTGAGG + Intergenic
1128781067 15:70359023-70359045 AGGGAGAGGGCCGGGGTCTGAGG + Intergenic
1129606526 15:77027918-77027940 AGCGCCAGGGCCTGGGGCCGCGG + Intronic
1129666375 15:77581861-77581883 TGGGCCAGGGCCTGGGGCTGGGG - Intergenic
1131254881 15:90855433-90855455 GGCGACAGCATCTGGGTCTGTGG + Intergenic
1131816043 15:96222325-96222347 TGAGACAGGGTCTGGCTCTGTGG + Intergenic
1132671021 16:1102394-1102416 TGCGACAGTGTCTGGGCCTGCGG - Intergenic
1132917299 16:2357401-2357423 TGAGACAGGGTCTGGCTCTGTGG - Intergenic
1132990746 16:2791620-2791642 TGAGACAGGGGTTGGGTCTGGGG - Intergenic
1134134174 16:11668642-11668664 CGGGGCCGGGCCGGGGTCTGCGG + Intronic
1134629374 16:15745934-15745956 AGAGACAGGGTCTGGCTCTGCGG + Intronic
1137052008 16:35722367-35722389 CGGGACTGGGACTGGGGCTGGGG + Intergenic
1139580648 16:67871889-67871911 CACAACTGGGCCTGGCTCTGTGG - Exonic
1139937140 16:70579691-70579713 GGAGCCAGGGCCTGGGTTTGGGG + Intergenic
1140676845 16:77340598-77340620 AGAGACAGGGCCTAGCTCTGTGG + Intronic
1141173584 16:81705390-81705412 GGGGACAGAGCCTGGCTCTGAGG - Intronic
1142156074 16:88533399-88533421 CGCGACGGGGCCTGGGGCCCAGG - Exonic
1142471513 17:165693-165715 TGGGACAGGGCCTGGCTCAGTGG + Intronic
1142620880 17:1165198-1165220 CGCTCCAGGGCCCGGTTCTGTGG - Intronic
1142711169 17:1724838-1724860 CGGGACAGGGGCTGGGGCGGAGG - Intronic
1142750856 17:1986808-1986830 GGGGGCAGGGCCTGAGTCTGGGG - Intronic
1143086094 17:4417181-4417203 CTCTACAAGGCCTGGGTCAGCGG + Intergenic
1143372367 17:6448261-6448283 TGAGACAGGGTCTGGCTCTGTGG - Intronic
1143411908 17:6714030-6714052 CGCGACAGCCCCTGGGACAGAGG - Intergenic
1143750121 17:9021697-9021719 CGGGACCGGGGCTGGGGCTGGGG + Intronic
1144468206 17:15513980-15514002 AGTGACAGGCCCTGGGTCTCTGG - Intronic
1145944007 17:28759498-28759520 CGGGCCAGAGCCTGGGCCTGGGG + Exonic
1147382917 17:40066072-40066094 AGCCTCAGGGCCTGGTTCTGAGG + Intronic
1148355314 17:46971930-46971952 GGGCACAGGGCCTGGCTCTGAGG + Intronic
1151405028 17:73880632-73880654 TGAGACAGGGTCTGGCTCTGTGG + Intergenic
1151703335 17:75754517-75754539 CCCCACGGGGCCCGGGTCTGGGG + Intronic
1152550501 17:81027676-81027698 GGCGAGTGGGCCTGGGACTGGGG + Intergenic
1152597379 17:81244410-81244432 AGGACCAGGGCCTGGGTCTGGGG - Intergenic
1152750638 17:82060961-82060983 CGTGACAGGGCCTCTGTCTCAGG - Exonic
1153324440 18:3803712-3803734 CGAGGCAGAGCCTGGGTCTTCGG - Intronic
1154086794 18:11313524-11313546 AGAGACAGGGTCTGGCTCTGTGG + Intergenic
1154354770 18:13616534-13616556 CGCGGCAGAGCCTTGCTCTGGGG - Intronic
1155053631 18:22167990-22168012 CGGGACAGGGCCTGGCAGTGCGG - Intergenic
1157147851 18:45183749-45183771 CAAGACAGGGCCTTGCTCTGTGG + Intergenic
1157165164 18:45352085-45352107 CTGGACAGGGCATGGGACTGTGG + Intronic
1157766298 18:50299519-50299541 TGAGACAGGGTCTGGCTCTGTGG - Intergenic
1159526198 18:69593350-69593372 AGAGACAGGGCCTTGTTCTGTGG - Intronic
1160595651 18:79972283-79972305 TGGGGCAGAGCCTGGGTCTGAGG + Exonic
1160752730 19:742135-742157 TGAGACAGGGTCTTGGTCTGTGG - Intronic
1160783959 19:891279-891301 CCAGACAGAGCCTGGGGCTGGGG + Intronic
1160801035 19:969061-969083 AGAGACAGGGTCTCGGTCTGTGG - Intronic
1160816962 19:1040519-1040541 GGCGTAAGGGTCTGGGTCTGAGG + Intronic
1160832665 19:1110989-1111011 CGCCTCTGGGCCTGGGTGTGGGG + Intronic
1162350343 19:10145109-10145131 CGCCACAGGGCCTGGGACAATGG + Intronic
1162561473 19:11420310-11420332 TGAGACAGGGTCTGGCTCTGTGG + Intergenic
1162731699 19:12722247-12722269 CCCGACATGGCCTGGCTCCGAGG + Intronic
1162782688 19:13014740-13014762 GGCCACAGGGCCTGGATTTGGGG + Intronic
1162834325 19:13306394-13306416 AGAGACAGGGCCTTGCTCTGTGG + Intronic
1163129695 19:15264836-15264858 CAAGACAGGGCCTGGCTTTGGGG - Intronic
1163456005 19:17406011-17406033 GAGGGCAGGGCCTGGGTCTGGGG + Intronic
1163690212 19:18734656-18734678 TGCGACAGGGTCTTTGTCTGTGG - Intronic
1163826595 19:19527810-19527832 AGAGACAGGGCCTGGGGTTGGGG + Intronic
1165665673 19:37625630-37625652 AGAGACAGGGCCTCAGTCTGTGG - Intronic
1166373024 19:42313046-42313068 CAGGACAGAGCATGGGTCTGGGG + Intergenic
1166512470 19:43418403-43418425 CACTTCTGGGCCTGGGTCTGAGG + Exonic
1167314638 19:48756479-48756501 TGGGCCAGAGCCTGGGTCTGAGG + Intronic
1202696808 1_KI270712v1_random:131985-132007 CGGGACAGGGGCTGGGTGGGTGG + Intergenic
925423005 2:3726778-3726800 CGCGAGGGGGTCTGGGGCTGAGG - Intronic
925923288 2:8652513-8652535 TGAGACAGGGTCTGGCTCTGTGG - Intergenic
926567965 2:14498626-14498648 CCAGACATGCCCTGGGTCTGTGG - Intergenic
928406349 2:31017975-31017997 CGCCACAGGGCCTCGGCCTTGGG + Intronic
935265999 2:101394808-101394830 CCGGACAGGGCCTCGCTCTGTGG + Intergenic
935593062 2:104857977-104857999 CGCGGCCGGGCCTGGCTCGGCGG - Exonic
936278307 2:111118899-111118921 CCCGACGCGGCCTGGGTCTCGGG + Intergenic
936293625 2:111248277-111248299 AGAGCCAGGGCCTGGGTATGGGG + Intergenic
936731541 2:115387086-115387108 CTCTGCAGGTCCTGGGTCTGTGG + Intronic
937127180 2:119482222-119482244 CGGGCCAGGGCCTGGGTTAGGGG + Intronic
937299835 2:120832409-120832431 GGCAGCAGGGCCTGGGGCTGAGG + Intronic
937434615 2:121870124-121870146 CGTGACAGAGACTGGGTCTGGGG - Intergenic
937877626 2:126837305-126837327 GGGGACAGAGCCTGGGGCTGGGG + Intergenic
938077283 2:128346517-128346539 TGCGCCAAGGCCTGCGTCTGCGG + Intergenic
938137234 2:128769577-128769599 CGGGGCAGGTGCTGGGTCTGCGG + Intergenic
938263609 2:129911511-129911533 CGCGGCATGGCTGGGGTCTGCGG + Intergenic
941638242 2:167959774-167959796 AGTGACAGTGCCTGGCTCTGAGG + Intronic
946339494 2:219058699-219058721 GGGGCCAGGGCCTTGGTCTGAGG + Intronic
946609164 2:221439505-221439527 AGAGACAGGGTCTGGCTCTGTGG + Intronic
947067043 2:226239332-226239354 AGAGACAGGGTCTGGCTCTGTGG + Intergenic
947521500 2:230849553-230849575 CGAGACAGGGTCTCGCTCTGTGG - Intergenic
947854691 2:233315124-233315146 CAGGACAGGGCCAGGGCCTGTGG + Intronic
948485359 2:238277529-238277551 CTCGACAGGGCCTCGTTATGAGG + Intronic
948594362 2:239069976-239069998 CGGGACAGGGCCAGGGTGGGTGG - Intronic
948867242 2:240782356-240782378 CACGGCAGGGCCTGGGGCGGGGG - Intronic
1168893403 20:1308426-1308448 TGGGACAGGCCCTGGGACTGTGG + Exonic
1169205752 20:3739656-3739678 CTGGACAGGGCCAGAGTCTGAGG - Intronic
1169437403 20:5604931-5604953 CGAGACAGGGTCTTGCTCTGTGG - Intronic
1171004676 20:21453015-21453037 TGAGACAGGGTCTGGCTCTGTGG + Intergenic
1172995268 20:39065715-39065737 TGAGACAGGGCCTTGCTCTGTGG + Intergenic
1173165989 20:40687784-40687806 CGCGGCAGGGACAGGGTCCGGGG + Exonic
1173616320 20:44405676-44405698 AGGGACAGGACCTGGTTCTGGGG + Intronic
1175443964 20:59007705-59007727 CCCGAAAGGGCCTGGGCCTTTGG - Intergenic
1176059939 20:63168117-63168139 GGCGTCTGGGCCTGGCTCTGAGG + Intergenic
1178333875 21:31726643-31726665 TGAGACAGGGTCTGGCTCTGTGG - Intronic
1179880990 21:44293288-44293310 AGGCACAGGGCCTGGGGCTGTGG + Intronic
1179924034 21:44522608-44522630 CACGAGCCGGCCTGGGTCTGGGG - Intronic
1180793859 22:18592343-18592365 TGGGGCAGGGCCTGGGTCTAGGG - Intergenic
1180950562 22:19718789-19718811 CGCCTCTGGGCCTGGGTCCGCGG - Intronic
1181178942 22:21054036-21054058 CGAGCCAGGGCCAGGTTCTGTGG + Intronic
1181227881 22:21402977-21402999 TGGGGCAGGGCCTGGGTCTAGGG + Intergenic
1181466252 22:23112247-23112269 CCAGGCAGGGCCTGGGGCTGTGG - Intronic
1182087213 22:27569424-27569446 CTGGAGAGGGCCTGGGGCTGGGG - Intergenic
1182460931 22:30483556-30483578 GGGGAGAGGACCTGGGTCTGAGG + Intergenic
1182835636 22:33339248-33339270 GGAGACAGGGCCTGGGACAGAGG + Intronic
1183273073 22:36874091-36874113 CGCCCCAGAGCCTGGGTGTGCGG + Intronic
1183439583 22:37815670-37815692 CACGACAGGGCCTGGGCCCCTGG + Exonic
1184072056 22:42152590-42152612 CTGGACAGGGCCAGGGACTGCGG - Intergenic
1184102361 22:42347520-42347542 CACGTGAGGGCCTGGGGCTGGGG - Intergenic
1184403401 22:44286679-44286701 GGTGACAGGGGCTGGGTTTGAGG - Intronic
1184968563 22:47998859-47998881 GGGGACAGGGGCTGGGGCTGGGG - Intergenic
1185096506 22:48808861-48808883 TGCCACAGGGCTTGGGCCTGTGG + Intronic
1185322879 22:50209902-50209924 CTCTACTGGGCCTGAGTCTGGGG + Intronic
1185374210 22:50474712-50474734 AGGGCCAGGGGCTGGGTCTGAGG - Intronic
1185396960 22:50597367-50597389 AACAACAGGGCCTGTGTCTGGGG + Intronic
950034709 3:9877134-9877156 CGCGGCAGGGCCGGGCCCTGGGG + Exonic
950265523 3:11570184-11570206 TGCCACAGGGCCGGTGTCTGTGG - Intronic
950427255 3:12931187-12931209 CGAGCCCTGGCCTGGGTCTGAGG - Intronic
950520370 3:13494601-13494623 CGCCAGAGGGCCTGGGCTTGTGG + Intronic
950767618 3:15284919-15284941 CTCCAAAGGTCCTGGGTCTGGGG - Intronic
951640427 3:24829555-24829577 CGCGGCGGGGCCGGGGGCTGGGG + Intergenic
951867681 3:27325767-27325789 CCCAACAAGGCCTGGCTCTGTGG + Intronic
954632331 3:52054387-52054409 TGAGACAGGGCCTGGGTGAGAGG + Intronic
961884406 3:130086655-130086677 AGAGACAGGGCCTTGCTCTGTGG - Intronic
962246878 3:133802891-133802913 CGGGAGAGGGCTTGGGGCTGTGG - Intronic
963091600 3:141487583-141487605 CGCGCGAAGGCCTGAGTCTGAGG - Intronic
964484818 3:157176320-157176342 AACCAGAGGGCCTGGGTCTGTGG + Intergenic
964859721 3:161187831-161187853 AGAGACAGGGTCTGGCTCTGTGG + Intronic
967849417 3:194070972-194070994 CGCAACGGGGCCTCGGTCTGTGG + Intergenic
968493077 4:900907-900929 AGCGAAAGGGCCTGGGGCTCAGG + Intronic
968829987 4:2928354-2928376 AGCCACCGGGGCTGGGTCTGGGG - Exonic
969615148 4:8247726-8247748 CCCGACAGGGCCTGGATCCAGGG + Intergenic
972483081 4:39516262-39516284 TGAGACAGGGCCTTGCTCTGTGG - Intronic
972787793 4:42343853-42343875 CGAGACAGGGTCTTGCTCTGTGG - Intergenic
974968870 4:68801700-68801722 GGCGGCAAGGCCTGGGTCTGGGG - Intergenic
975012833 4:69377678-69377700 GGCGGCAAGGCCTGGGCCTGAGG - Intronic
975321851 4:73017690-73017712 TGTCACAGGGCCTGGGTGTGAGG - Intergenic
977231836 4:94460599-94460621 TGAGACAGGGTCTGGTTCTGTGG - Intronic
977693795 4:99946298-99946320 CCCCACCGGGCCTGGGGCTGGGG + Intronic
978765100 4:112397062-112397084 CGCCACAGGGCCAGGCACTGTGG - Intronic
983533045 4:168831594-168831616 CGAGACTGGGGCTGGGACTGGGG - Intronic
983577183 4:169271511-169271533 CGCGGGAGGGGCTGGGTCCGCGG + Intergenic
984833594 4:183999022-183999044 TGAGACAGGGTCTGGCTCTGTGG - Intronic
985775608 5:1840298-1840320 GGCACCAGGGCCTGGGTCTGTGG - Intergenic
985849987 5:2381826-2381848 AGTGACTGGCCCTGGGTCTGTGG - Intergenic
987341444 5:16942975-16942997 TGAGACAGGGTCTGGCTCTGTGG - Intergenic
990715781 5:58634785-58634807 CCCCACAGAACCTGGGTCTGTGG + Intronic
990950445 5:61293294-61293316 GGCTACAGGGCCTGGGTCAGAGG + Intergenic
997356751 5:133267339-133267361 CATGAGAGGGCCTGGGGCTGGGG + Intronic
997975542 5:138439596-138439618 AGGGACAGGGCCCGGGTCTGAGG - Intronic
998614766 5:143727876-143727898 AGGGACTGGGACTGGGTCTGTGG + Intergenic
999246053 5:150155351-150155373 AGGGACAGGGCATGGGGCTGGGG + Intronic
1001342825 5:170862585-170862607 GGAGACAGGGGCTGCGTCTGGGG + Intronic
1001520292 5:172386648-172386670 TGAGACAGGGTCTGGCTCTGTGG + Intronic
1002524330 5:179806931-179806953 CGCGGCCCGGCCTGGATCTGGGG + Intronic
1002531316 5:179847596-179847618 CCCCACTGGGCCTGGGTCAGTGG - Intronic
1003269292 6:4593140-4593162 CACCGCAGGGCCTGGCTCTGGGG + Intergenic
1003504483 6:6728417-6728439 AGCGAGAGGGACGGGGTCTGGGG + Intergenic
1004871097 6:19904926-19904948 GGTGCCAGGGACTGGGTCTGGGG - Intergenic
1007474216 6:42107982-42108004 CCCGACAGGACCTGTGTCTGCGG - Intronic
1007633460 6:43285155-43285177 CGGGACAGGGACTGGCTCCGGGG - Exonic
1007637041 6:43305895-43305917 CACCAAAGGCCCTGGGTCTGTGG + Intronic
1012410189 6:98947859-98947881 CGCGAGAAGGCCTGGGTGCGGGG + Exonic
1018746310 6:166764745-166764767 CGCCACAGGGACTGGGACAGCGG + Intronic
1019078253 6:169409152-169409174 GGTGCCAGGGGCTGGGTCTGGGG - Intergenic
1019257784 7:62844-62866 GGGGCCAGGGCCTGGGTCTGGGG + Intergenic
1019696494 7:2449239-2449261 TGAGACAGGGCCTTGCTCTGTGG + Intergenic
1019701944 7:2478305-2478327 CGGTAGAGGGCCTGGGTCTCAGG + Intergenic
1024119029 7:46218978-46219000 CCCCACAGGGCCAGGGTTTGGGG - Intergenic
1026916169 7:74121409-74121431 CAAGTCAGGGCCTGGCTCTGAGG - Exonic
1029686215 7:102149821-102149843 GGAGACAGGGCCAGGCTCTGAGG - Intronic
1030266294 7:107625523-107625545 TATGAAAGGGCCTGGGTCTGAGG + Intronic
1032792550 7:135253217-135253239 AGCCACAGCGCCTGGCTCTGGGG + Intronic
1034277204 7:149829187-149829209 AGGGGCAGGGCCTGGGTCTGAGG - Intergenic
1035613947 8:988751-988773 GGGGACAGGCCCTGGGTCTAGGG - Intergenic
1036809029 8:11854505-11854527 TGAGACAGGGTCTTGGTCTGTGG + Intronic
1037759626 8:21733320-21733342 CAGGCCAGGGCCTGGGTGTGGGG - Intronic
1049250125 8:141583766-141583788 CATGGCAGGGGCTGGGTCTGGGG + Intergenic
1049385698 8:142341967-142341989 GCCGGCAGGGCCTGGGACTGGGG - Intronic
1049408911 8:142463833-142463855 GGTGCCAGGGCCTGTGTCTGCGG + Intronic
1049559813 8:143304362-143304384 CTCAACAGGAACTGGGTCTGTGG - Intronic
1049655281 8:143794463-143794485 CCAGGCAGGGCCTGGATCTGAGG - Intronic
1053425461 9:38007178-38007200 AGTCACAGGGCCTGGGTCAGGGG - Intronic
1053464949 9:38299130-38299152 AGGCCCAGGGCCTGGGTCTGGGG - Intergenic
1057905042 9:98976711-98976733 AGGGACAGAGCCTGGGTGTGGGG + Intronic
1057995890 9:99821580-99821602 CTCGCCAGGGCGTGCGTCTGCGG - Intergenic
1061038277 9:128125481-128125503 GGGGGCAGGGCCTGGGCCTGGGG - Intronic
1061810909 9:133162380-133162402 GGAGACTGGCCCTGGGTCTGGGG - Exonic
1062101381 9:134730411-134730433 GGCCCCAGCGCCTGGGTCTGTGG - Exonic
1062383722 9:136299864-136299886 AGCCACAGGGAGTGGGTCTGGGG - Intronic
1062431622 9:136529064-136529086 CACGGCAGGATCTGGGTCTGGGG - Intronic
1062453138 9:136623841-136623863 CAGGACAGGGCCAGGGTCAGCGG + Intergenic
1203669427 Un_KI270754v1:37888-37910 CCCGGCAGCGCCTGGGTCTTGGG + Intergenic
1185620156 X:1449304-1449326 GGCGTCAGGGCCAGGATCTGGGG - Intronic
1187098494 X:16169726-16169748 GTGGACAGGGCCTGGGGCTGAGG + Intronic
1187456625 X:19446933-19446955 TGAGACAGGGCCTGGCTCTGTGG + Intronic
1187673279 X:21690138-21690160 CGAGACAGGGTCTTGCTCTGTGG + Intergenic
1189229467 X:39441038-39441060 CCCCACAGGGCCTGGGACTGAGG - Intergenic
1196104347 X:111880448-111880470 CCAGACAGGGCCTGTGGCTGTGG - Intronic
1196652845 X:118186473-118186495 AGAGACAGGGTCTGGCTCTGTGG + Intergenic
1197666541 X:129230104-129230126 TGAGACAGGGTCTGGCTCTGTGG - Intergenic