ID: 1077616255

View in Genome Browser
Species Human (GRCh38)
Location 11:3676201-3676223
Sequence AAGGCTGCGCAGTTCGTCCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 59}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077616247_1077616255 27 Left 1077616247 11:3676151-3676173 CCTGGGGCTCACAGGCTCCCAAC 0: 1
1: 0
2: 2
3: 25
4: 271
Right 1077616255 11:3676201-3676223 AAGGCTGCGCAGTTCGTCCATGG 0: 1
1: 0
2: 0
3: 4
4: 59
1077616249_1077616255 9 Left 1077616249 11:3676169-3676191 CCAACAGCCAGTTCTCGCAGATA 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1077616255 11:3676201-3676223 AAGGCTGCGCAGTTCGTCCATGG 0: 1
1: 0
2: 0
3: 4
4: 59
1077616251_1077616255 2 Left 1077616251 11:3676176-3676198 CCAGTTCTCGCAGATAGGACTGG 0: 1
1: 0
2: 0
3: 6
4: 46
Right 1077616255 11:3676201-3676223 AAGGCTGCGCAGTTCGTCCATGG 0: 1
1: 0
2: 0
3: 4
4: 59
1077616248_1077616255 10 Left 1077616248 11:3676168-3676190 CCCAACAGCCAGTTCTCGCAGAT 0: 1
1: 0
2: 0
3: 8
4: 58
Right 1077616255 11:3676201-3676223 AAGGCTGCGCAGTTCGTCCATGG 0: 1
1: 0
2: 0
3: 4
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077616255 Original CRISPR AAGGCTGCGCAGTTCGTCCA TGG Exonic
900101961 1:965835-965857 AAGGCAGAGCTGTGCGTCCAGGG + Intergenic
901632754 1:10655940-10655962 AAGGCAGCCCAGATTGTCCAAGG + Intronic
907905714 1:58782699-58782721 CTGGCTGTGCAGTTCGGCCAGGG + Exonic
912226288 1:107738005-107738027 ATGGCTGCACAGTTATTCCATGG - Intronic
915687754 1:157652297-157652319 GAGGTTGAGCAGTTTGTCCAAGG + Intergenic
921105009 1:211967949-211967971 AAGGCTTCGAAATTCTTCCATGG + Exonic
1066589816 10:36982398-36982420 AAGGCTGCCCATTGCCTCCATGG - Intergenic
1073305221 10:102497943-102497965 AAGGCTGAGCAGGTGGTACACGG + Intronic
1074082127 10:110176306-110176328 AAGGCTTCCCAGCTCGTCCCAGG - Intergenic
1074599505 10:114899597-114899619 AAGGGTGGGCAGTTGATCCAAGG - Intronic
1077616255 11:3676201-3676223 AAGGCTGCGCAGTTCGTCCATGG + Exonic
1095714036 12:45322231-45322253 AAGGCTTGGAAGTTCTTCCAAGG + Intronic
1096244754 12:49978127-49978149 AAGGCTGCCCAAGTCTTCCAAGG + Intronic
1099047322 12:77737568-77737590 AAGGGTGAGCATTTCATCCAGGG + Intergenic
1101736830 12:107469405-107469427 AAGGCTGGACAGCTTGTCCAAGG - Intronic
1107351067 13:39515224-39515246 AAGGCAGCGCAGCTCATCCCTGG - Intronic
1119427479 14:74545238-74545260 AAGGCTGAGGAGCTTGTCCAAGG - Intronic
1121887203 14:97554389-97554411 AAGGCTGAGTACTTTGTCCAAGG + Intergenic
1129752641 15:78076972-78076994 AAGGCTGCACAGGACATCCACGG + Intronic
1131108663 15:89750908-89750930 AAAGCGGCGCAGCTCGTGCAGGG + Exonic
1133233964 16:4379164-4379186 CAGGCTGTGCAGGTAGTCCAGGG - Intronic
1139048108 16:63088046-63088068 GAGGCTGAGCAGTACATCCAAGG + Intergenic
1141094583 16:81153999-81154021 GAGGCTCCGCAGTTCTCCCAGGG + Intergenic
1143810706 17:9469129-9469151 AAGGCTGGGCAGCTCAGCCAAGG + Intronic
1144269652 17:13603254-13603276 AAGGCTGCGAAGTTCCTGCATGG - Intergenic
1144783952 17:17821684-17821706 CAGGCTGCACAGTTGGTCCTTGG - Intronic
1156452622 18:37275179-37275201 AAGGCGGCGCACGTCGTCCTCGG + Exonic
1158831024 18:61278680-61278702 AAGGCTGAGAAATTTGTCCAAGG - Intergenic
930003075 2:46874336-46874358 CAGCCAGCGCAGTTGGTCCAAGG - Intergenic
937555992 2:123156623-123156645 AAGGCTGAGAAGTCCCTCCAAGG - Intergenic
938904616 2:135826163-135826185 ATGGCTGCTAAGTTTGTCCAGGG + Intronic
1169414972 20:5408497-5408519 TGGGCTGCGCAGATCTTCCATGG - Intergenic
1174849112 20:53974680-53974702 AAGACTGCGCACTTCTTTCAAGG + Intronic
1181821068 22:25476080-25476102 AAGGCTGAGCAGTGGGTACAAGG - Intergenic
1182159170 22:28104627-28104649 AAGGCTGCACAGTTGGACCTTGG - Intronic
1183279149 22:36922904-36922926 CAGGCTGCACAGTCGGTCCAGGG + Intronic
1184931304 22:47683166-47683188 AAGGCTGAGCAGTGGGCCCAAGG - Intergenic
949917696 3:8977310-8977332 AAGGCTGCTGTGTTCATCCATGG - Intergenic
956813928 3:72890470-72890492 AAGGGTTAGCAGTTTGTCCAAGG + Intronic
961379373 3:126487241-126487263 GAGGCTGAGCAGTTTGCCCAGGG - Intronic
969491216 4:7500201-7500223 CAGGCTGGGCAGCTCGTGCAGGG - Intronic
970212327 4:13722494-13722516 AAGGCTGCTCAGCTCTGCCAAGG + Intergenic
973802548 4:54493411-54493433 GAGGCTGGGCAGGTGGTCCAGGG + Intergenic
984844598 4:184098815-184098837 AAGGATGGGCCGTTCGTCCTTGG - Intronic
986170908 5:5313836-5313858 AACGCTGCGCAGTCCATCCCAGG + Intronic
997652871 5:135535337-135535359 CACGCTGCGCAGTGCGTCCAGGG + Exonic
998041860 5:138955591-138955613 AAGGCAGCCCAGCTCGGCCAGGG + Intronic
999107821 5:149089216-149089238 GAGGCTGAGCAGCTTGTCCAAGG + Intergenic
1003194332 6:3901775-3901797 TAGGCTGGGCAGTTCGTGCTTGG + Intergenic
1004188163 6:13440128-13440150 CAGGCTGTTCAGTTCTTCCACGG + Intronic
1006516440 6:34548215-34548237 GAGGCTGTGCAGCTTGTCCAGGG + Intronic
1018895306 6:168012698-168012720 AAGGCTGCTCAGCTCGTCTGGGG + Intronic
1019125085 6:169833079-169833101 TAGGCTGAGCAGTTCTTACACGG - Intergenic
1026582982 7:71633387-71633409 GAGGCTACGCAGTTTGTCCTGGG + Intronic
1026972084 7:74474609-74474631 AAGGCTGAGCAACTCGCCCAAGG - Intronic
1034139984 7:148806367-148806389 ATGGCTGCCCAGTTTGCCCAGGG + Intergenic
1036034465 8:5004034-5004056 AGGGCTGAGCAGTGCCTCCAAGG + Intergenic
1037829838 8:22180913-22180935 CAGGCTGAGCAGTTCATCCAAGG - Intronic
1187196739 X:17093496-17093518 AAGTCTGAGAAGTTCCTCCAAGG + Intronic
1192561990 X:72133203-72133225 AAGGCAGCTCATTTCTTCCACGG - Intergenic
1196641621 X:118068934-118068956 GAGGCTGCGCAGTCCCTCCTGGG + Intronic
1199089292 X:143672162-143672184 AAGGCTGCACATTTCGACCATGG - Intergenic
1200130198 X:153838283-153838305 AAGGCTGCTCTTTTCTTCCATGG + Intergenic
1201510059 Y:14749294-14749316 CAGGCTGCACAGTGTGTCCAGGG - Intronic