ID: 1077617328

View in Genome Browser
Species Human (GRCh38)
Location 11:3686665-3686687
Sequence GATCGTGATGGTGGTTTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 326}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077617328_1077617333 6 Left 1077617328 11:3686665-3686687 CCTGTAAAACCACCATCACGATC 0: 1
1: 0
2: 5
3: 35
4: 326
Right 1077617333 11:3686694-3686716 ATAAATAGAGCAAGGCGCGGTGG 0: 1
1: 0
2: 9
3: 138
4: 1292
1077617328_1077617332 3 Left 1077617328 11:3686665-3686687 CCTGTAAAACCACCATCACGATC 0: 1
1: 0
2: 5
3: 35
4: 326
Right 1077617332 11:3686691-3686713 AAAATAAATAGAGCAAGGCGCGG 0: 1
1: 0
2: 5
3: 124
4: 1908
1077617328_1077617331 -2 Left 1077617328 11:3686665-3686687 CCTGTAAAACCACCATCACGATC 0: 1
1: 0
2: 5
3: 35
4: 326
Right 1077617331 11:3686686-3686708 TCAAGAAAATAAATAGAGCAAGG 0: 1
1: 0
2: 2
3: 95
4: 820

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077617328 Original CRISPR GATCGTGATGGTGGTTTTAC AGG (reversed) Intronic
900505085 1:3026028-3026050 GATGGTGATGGTGGTGTTGATGG + Intergenic
900742069 1:4336460-4336482 GATAATGATGGTGATTTTAGTGG + Intergenic
900814132 1:4830310-4830332 GGTTGTTATGGTGGTATTACTGG + Intergenic
902673050 1:17988422-17988444 GATTGTGGTGATGGTTTTACAGG - Intergenic
904298056 1:29536134-29536156 GATTGTGGTGATGGTTTCACAGG + Intergenic
905966275 1:42099174-42099196 GATGGTGATGATGGTTTTATGGG + Intergenic
905970542 1:42138616-42138638 GATTGTGGTGATGGTTTCACAGG - Intergenic
908775480 1:67635461-67635483 GATCGTATTTGTGGTTTTAAAGG - Intergenic
909328639 1:74385303-74385325 GATTGAGATGGTGGTTTCACAGG + Intronic
909442221 1:75710155-75710177 GATTGTGGTGATGGTTTCACAGG + Intergenic
910211660 1:84799914-84799936 GATTGTGATGATGGTATTACAGG + Intergenic
910324761 1:85993634-85993656 GATCTTGGTGATGGTTTCACAGG + Intronic
911864881 1:103005891-103005913 GATGATGATGATGGTTTTACAGG - Exonic
913041150 1:115025273-115025295 GATTGTGATGATGGTTTTACAGG - Intergenic
913197177 1:116466899-116466921 GATGGTGATGGTGGTACTAGTGG + Intergenic
913598160 1:120397207-120397229 TATGGTGATGGTGGGTTCACTGG + Intergenic
914089170 1:144482113-144482135 TATGGTGATGGTGGGTTCACTGG - Intergenic
914309442 1:146452102-146452124 TATGGTGATGGTGGGTTCACTGG + Intergenic
914592669 1:149121035-149121057 TATGGTGATGGTGGGTTCACTGG - Intergenic
916605175 1:166335327-166335349 GATGGTTCAGGTGGTTTTACAGG + Intergenic
916815422 1:168347137-168347159 GATGGTGATGATGGTTTCATGGG + Intergenic
918510965 1:185314194-185314216 GATGGTGATGGTGGTTTTAGAGG - Intronic
918844293 1:189588774-189588796 GATTGTGTTGATGGTTTCACAGG + Intergenic
919365249 1:196651356-196651378 GACCTTGGTGGTGGTTTCACAGG + Intergenic
920069648 1:203293141-203293163 GATCGTGGTGGTGGTCTTCCTGG + Intergenic
921001627 1:211050039-211050061 GATGGTGATGGTGGTATTTATGG - Intronic
922118823 1:222642190-222642212 GGTTGTGATGATGGTTTCACAGG + Intronic
924132041 1:240920262-240920284 GATCGTGGTGGTGGTTTTGGTGG + Intronic
1063432358 10:6001655-6001677 TATCTTGATTGTGGTTTTAGGGG - Intergenic
1064778829 10:18810657-18810679 GATTGTGGTGATGGTTTCACAGG - Intergenic
1066122558 10:32303713-32303735 GATAGTGGTGGTGGTTATGCAGG + Intronic
1066623598 10:37383560-37383582 GATAGTGGTGTTGGTTTTATGGG + Intronic
1069716919 10:70526997-70527019 GATTATGATGATGGTTTTCCTGG - Intronic
1071488170 10:86117016-86117038 GATGGTGATGGTGGTAGTATTGG - Intronic
1073405869 10:103297413-103297435 GATGGTGTCTGTGGTTTTACAGG - Intergenic
1073862140 10:107758564-107758586 GATTGTGGTGATGGTTTCACAGG - Intergenic
1074156034 10:110800574-110800596 GACTTTGGTGGTGGTTTTACGGG - Intronic
1074270479 10:111948753-111948775 AATTGTGATGGGGATTTTACAGG + Intergenic
1074797897 10:116967515-116967537 GATGGTGGTGATGGTTTCACAGG - Intronic
1075922806 10:126227040-126227062 GATAGTGATGGTGGTAATGCTGG - Intronic
1076592199 10:131591219-131591241 GATGGTGGTGGTGGTTATAATGG - Intergenic
1077417307 11:2430589-2430611 GATGGTGGTGGTGGTTTTGGTGG + Intergenic
1077417321 11:2430664-2430686 GATGGTGGTGGTGGTTTTGGTGG + Intergenic
1077417349 11:2430784-2430806 GATGGTGGTGGTGGTTTTGGTGG + Intergenic
1077417358 11:2430826-2430848 GATGGTGGTGGTGGTTTTGGTGG + Intergenic
1077617328 11:3686665-3686687 GATCGTGATGGTGGTTTTACAGG - Intronic
1078112143 11:8404360-8404382 GATTGTGGTGTTGGTTATACAGG - Intronic
1078371911 11:10754492-10754514 GATTGTGGTGATGGTTTCACAGG - Intronic
1078644235 11:13124552-13124574 GATTGTGGTGATGGCTTTACAGG + Intergenic
1079173135 11:18115146-18115168 TACCTTGATGGTGGTTCTACTGG - Intronic
1079914858 11:26356313-26356335 GATTGTGATTGTGGTTTCATGGG - Intronic
1082670573 11:56032051-56032073 GATACTGATGGTGGTTTCACTGG + Intergenic
1084466117 11:69324021-69324043 GATGGTGATGGTGGTGGTAGAGG + Intronic
1084496557 11:69508084-69508106 GATCTTGGTGGTGGTTTCATGGG - Intergenic
1084730182 11:71067920-71067942 GATGGTGATGGTGGTGATGCTGG - Intronic
1085500170 11:77014044-77014066 GATTGTGGTGGTGGTTTCATGGG + Intronic
1088133051 11:106519243-106519265 GATTGTGATGATGGTTTCATGGG + Intergenic
1088780735 11:113131756-113131778 GATCGAGCAGGTGGTTTTAGGGG + Intronic
1088837329 11:113588859-113588881 GATTGTGGTGATGGCTTTACTGG - Intergenic
1089677551 11:120099956-120099978 GATCGTGTGGGTGGTTTGGCAGG + Intergenic
1090894246 11:130955511-130955533 TATCGTGATGATAGTTTCACAGG - Intergenic
1091154096 11:133357851-133357873 GATTGTGATGGTTGTTTTGAAGG - Intronic
1091270469 11:134308166-134308188 GATGGTGATGGTGGTGGTGCTGG - Intronic
1091270504 11:134308308-134308330 GATGGTGATGGTGGTGGTAGTGG - Intronic
1091270557 11:134308529-134308551 GATGGTGATGGTGGTGGTAGTGG - Intronic
1091270576 11:134308613-134308635 GATGGTGATGGTGGTGATAGTGG - Intronic
1094454034 12:30612341-30612363 GATTGTGGTGGTGGTTTCATGGG + Intergenic
1095263226 12:40122520-40122542 GATAGTAATGATGGTTTCACAGG + Intergenic
1095502381 12:42854634-42854656 GAAGGTGGTGGTGGTTTTCCTGG + Intergenic
1098643173 12:72863431-72863453 GATCGTGATGGTGGTAAATCTGG + Intergenic
1099749491 12:86754398-86754420 GATTGTGATGTTAGTTTTATGGG + Intronic
1100174198 12:92010783-92010805 TATCATGATGATGATTTTACTGG + Intronic
1100211315 12:92401331-92401353 GATGGTGATGGTGGTGGTAGTGG + Intergenic
1100894679 12:99168114-99168136 GATTGTGGTGATGGTTTCACAGG + Intronic
1100995789 12:100299428-100299450 GATCGTGGTGATGGTTTCACAGG - Intronic
1101569762 12:105942808-105942830 CATTGTGCTGGTGGTTGTACAGG + Intergenic
1102906610 12:116680995-116681017 GATTGTGGTGGTGGTTTCACAGG + Intergenic
1103438602 12:120946520-120946542 GATCATGGTGATGGTTTCACAGG - Intergenic
1103836567 12:123825724-123825746 GATTGTGGTGGTGCTTTCACAGG + Intronic
1104932939 12:132349563-132349585 GATGGTGATGGTGGTGATAATGG - Intergenic
1105634028 13:22200023-22200045 GATGGTGATGATGGTGTTAAAGG + Intergenic
1107041917 13:35958096-35958118 GGTGGTGATGGTGGTTATAGCGG - Intronic
1107767404 13:43751448-43751470 GATTGTGATGATGGTTTCACAGG - Intronic
1108012567 13:46034650-46034672 GATTGTGGTGGTAGTTATACAGG + Intronic
1109590108 13:64468034-64468056 GATTGTGAAGCAGGTTTTACTGG + Intergenic
1110745146 13:79043642-79043664 GATTGTGGTGATGGTTTCACTGG + Intergenic
1111187834 13:84763566-84763588 GCTGGTGATGGTTGTTTTAATGG + Intergenic
1111247568 13:85560743-85560765 GATTGTGATGATGATTTCACAGG - Intergenic
1111355578 13:87097363-87097385 GATTGTGGTGATGGTTTTATGGG - Intergenic
1111450710 13:88411346-88411368 GATTGTGTTTGTGGTTTTACAGG - Intergenic
1111928913 13:94493480-94493502 GAGTGTGATGATGGTTTCACTGG + Intergenic
1113100614 13:106713584-106713606 TAGTGTGATAGTGGTTTTACTGG + Intergenic
1113915191 13:113866427-113866449 GATTGTGATGATGGCTTCACAGG - Intergenic
1113930541 13:113966486-113966508 GATGGTGATGGTGATTATAATGG + Intergenic
1115173228 14:30531958-30531980 GATTGCGGTGGTGGTTTTACAGG + Intergenic
1116310683 14:43322481-43322503 GATTGTGGTGGTGGTTTCATAGG + Intergenic
1117020495 14:51565564-51565586 GATGGTGATGGTGGTGGTGCTGG + Intronic
1117868006 14:60169558-60169580 GATTGTGGTGATGGTTTCACAGG - Intronic
1119142747 14:72282681-72282703 GATTGTGATGATAGTTTCACAGG - Intronic
1120278625 14:82410564-82410586 GATGGTGGTGATGGTTTCACAGG - Intergenic
1120716068 14:87841934-87841956 GATGGTTAGGGTGGTGTTACAGG + Intronic
1120901905 14:89582708-89582730 GATCATGGTGATGGTTTCACAGG - Intronic
1121761926 14:96453193-96453215 GATCCTCATGGTGGCTGTACTGG + Intronic
1121826727 14:97016325-97016347 GAGCTTGATGCTGGGTTTACAGG + Intergenic
1121841308 14:97136327-97136349 GATGGTGATGGTGGTGATATTGG - Intergenic
1122180697 14:99952415-99952437 GATGGTGATGGCGGTGTTAGTGG + Intergenic
1122224279 14:100264486-100264508 GATAGAGATGGAGGGTTTACTGG + Intronic
1122342652 14:101038394-101038416 GGTTGTGATGGTGGTGGTACTGG + Intergenic
1126145197 15:45467277-45467299 GATTGTGGTGATGGTTTCACAGG - Intergenic
1127183177 15:56447730-56447752 GATTGTGGTGATGGTTTCACAGG - Intronic
1127444867 15:59050680-59050702 GATTGTAATGATGGTTTTACAGG - Intronic
1128873267 15:71180487-71180509 GATTGTGGTGGTGGTTTCAGGGG + Intronic
1129498246 15:76008051-76008073 GATGGTGGTGGTGATTTCACAGG + Intronic
1130524147 15:84689317-84689339 GATTGTGATGATGGTTTCACAGG + Intronic
1133447947 16:5878235-5878257 GATGGTGGTGGTGGTTATAGCGG + Intergenic
1135073738 16:19375353-19375375 GATCCAGATGCTGGTTTTACAGG - Intergenic
1138262438 16:55634746-55634768 GATAGTGGTGGTTGTTTTGCGGG - Intergenic
1138444937 16:57057856-57057878 GGTGGTGATGGTGGTAATACTGG + Intronic
1138444946 16:57057898-57057920 GGTGGTGATGGTGGTGATACTGG + Intronic
1139668612 16:68475764-68475786 GATTGTGGTGGTGGTTTCACAGG - Intergenic
1140318577 16:73924280-73924302 GATTGTGGTGGTAGTTTCACTGG - Intergenic
1141006342 16:80356490-80356512 GATGGTGGTGGTGGTGTTGCTGG - Intergenic
1142118202 16:88371831-88371853 GATGGTGATGGTGGTGATAATGG - Intergenic
1142208887 16:88798107-88798129 GATGGTGATGGTGGTGATAATGG + Intergenic
1143752532 17:9039583-9039605 GATTGTGGTGATGGTTTCACAGG - Intronic
1143927706 17:10387243-10387265 GATTGAGATGATGGTTTCACAGG - Intergenic
1150727042 17:67659838-67659860 GATTGTGGTGATGGTTTCACAGG - Intronic
1151022483 17:70633503-70633525 GATTGTGATGATGGTTTTACAGG - Intergenic
1151514411 17:74583082-74583104 GATCATGGTGGTGGTGTTACCGG - Intronic
1152054332 17:78011255-78011277 GATCATGGTGATGGTTTAACAGG - Intronic
1152165540 17:78702604-78702626 GGCTGTGATGGTTGTTTTACAGG - Exonic
1152171854 17:78755994-78756016 TATTGTGATAGTGGTTTCACTGG + Intronic
1152324001 17:79625070-79625092 GATGGTGGTGATGGTTTCACGGG - Intergenic
1152441888 17:80314465-80314487 GATGGTGATGGTGGAGGTACTGG + Intronic
1152441959 17:80314741-80314763 GATGGTGATGGTGGAGGTACTGG + Intronic
1153098199 18:1433877-1433899 GATTGTGGTGGTGCTTTCACAGG + Intergenic
1153221923 18:2869367-2869389 GATTGTGATGTTGGTTTCACGGG - Intronic
1153599008 18:6760723-6760745 AATGGTGATGGAGGTTTTAAAGG - Intronic
1154039760 18:10842726-10842748 GATTGTGATGATGGTTTCAATGG + Intronic
1154299311 18:13179197-13179219 GATTGTGGTGATGGTTTCACTGG - Intergenic
1156206521 18:34892047-34892069 GATTGTGGTGATGGTTTCACAGG + Intergenic
1156569344 18:38235239-38235261 GATGATGATGATGGTTTTACTGG + Intergenic
1156591404 18:38493278-38493300 GATGTTGGTGATGGTTTTACAGG + Intergenic
1158088347 18:53681155-53681177 GATCGTGATGATGGTGTTGTTGG - Intergenic
1158388812 18:57025949-57025971 CATCGAGATGGAGGTTATACTGG + Intronic
1158425105 18:57332553-57332575 GATTGGGATTGTGGTTTCACAGG + Intergenic
1158749029 18:60237193-60237215 GATTGTGATGATTGTTTCACAGG - Intergenic
1158982351 18:62775766-62775788 GACTGTGGTGGTGGTTTCACAGG - Intronic
1161926924 19:7307760-7307782 GATGGTGGTGGTGTTTTCACAGG + Intergenic
1164452379 19:28377973-28377995 GATGGTGGTGATGGTTTCACAGG - Intergenic
1164980451 19:32609734-32609756 GATGGTGGTGATGGTTTCACAGG + Intronic
1165249883 19:34521739-34521761 GATCATTATGGTGGTTGTTCTGG - Intergenic
1165440730 19:35825471-35825493 GATTGTGGTGGTGGTTGCACGGG - Intergenic
1166721360 19:44998375-44998397 GATGGTGATGGCAGTATTACAGG - Intergenic
1168586026 19:57592853-57592875 GATCATGATTATGGTTTCACAGG - Exonic
927609205 2:24520673-24520695 GATTGTGGTGATGGTTTTATTGG + Intronic
928711126 2:34006831-34006853 GATTGTGGTGATGGTTTCACAGG - Intergenic
929626247 2:43410786-43410808 GACAGTGATGATGGTTTTATGGG + Intronic
930524956 2:52516814-52516836 TATAGTGGTGGTGGTTTCACAGG + Intergenic
931242732 2:60467395-60467417 GATGGTGATGGTGATGGTACTGG + Intronic
931242760 2:60467524-60467546 GATGGTGATGGTGATGGTACTGG + Intronic
931451039 2:62367867-62367889 AATGTTGATGGTGGTTTTCCCGG + Intergenic
931640299 2:64375703-64375725 GATGGTGATGGTGGTGGTAGTGG - Intergenic
931703763 2:64929677-64929699 GATTGTGGTGATGGTTTCACTGG - Intergenic
934990417 2:98916402-98916424 GATCATGGTGTTGGTTTCACAGG + Intronic
935103170 2:100016074-100016096 GATGGTGATGGTGGTGGTAGTGG + Intronic
935103240 2:100016451-100016473 GATGGTGATGGTGGTGGTAATGG + Intronic
936339864 2:111621600-111621622 GATCTTGGTGGTGGTTTCATGGG + Intergenic
936344728 2:111666617-111666639 GATGGTGATGGTGGTGTTACTGG + Intergenic
936419047 2:112346528-112346550 GGTGGTGATGGTGGTGTTGCTGG - Intergenic
936419119 2:112346867-112346889 GGTGGTGATGGTGGTGTTGCTGG - Intergenic
938239892 2:129735407-129735429 GATGGTGATGGTGGTGATAGTGG + Intergenic
942283816 2:174393780-174393802 GATTGTGATGATGGTTTCACAGG - Intronic
942348126 2:175024837-175024859 GATTGTGGTGATGGTTTCACAGG - Intergenic
942358008 2:175140554-175140576 GATTGTGGTGATGGTTTTATGGG + Intronic
943824948 2:192377725-192377747 GGTGGTGATGGTGGTAGTACTGG + Intergenic
943965038 2:194321606-194321628 GTTAGTGATGGTGGCTTCACTGG - Intergenic
944734408 2:202548949-202548971 GACTGTGATGATGGTTTTATGGG - Intronic
944969259 2:204973080-204973102 GAGGACGATGGTGGTTTTACTGG - Intronic
945669181 2:212781947-212781969 GATTGTGATGTTGGTTTCATGGG - Intergenic
946383975 2:219370456-219370478 GATTGTGGTGGTGGTTTCCCAGG + Intergenic
948729329 2:239953140-239953162 GATCTTGATGGGGGGTTTCCTGG + Intronic
1171280413 20:23891424-23891446 GATGGTGATGATGGTTTTGAAGG - Intergenic
1171939069 20:31307105-31307127 GATTGTGATGATGGTTTCATGGG - Intronic
1172562425 20:35901031-35901053 GATCTGCATGGTGGTTATACAGG + Intronic
1172940806 20:38653115-38653137 GATTGTGATGGTGGTGTTGGTGG + Intergenic
1173284156 20:41655322-41655344 GAGGGTGATGATAGTTTTACTGG - Intergenic
1174086345 20:48010766-48010788 GATATTGATGGTGGTTGTAGTGG - Intergenic
1174259533 20:49283787-49283809 GATGGTGATGCTGTTTTGACTGG + Intergenic
1174846270 20:53946187-53946209 GATTTGGATGGTGGTTTTAGGGG - Intronic
1175305828 20:57974895-57974917 GATAGTGATGGTGGTATTTGTGG - Intergenic
1176118288 20:63442803-63442825 GATGGTGATGGTGGTGGTAATGG - Intronic
1176118345 20:63443084-63443106 GATGGTGATGGTGGTGATAATGG - Intronic
1176948556 21:15015308-15015330 AATGGTGATGATGGTTTCACAGG + Intronic
1178846575 21:36178881-36178903 GATTGTGGTGATGGTTTCACAGG - Intronic
1179710984 21:43262796-43262818 GGTGGTGATGGTGGTGATACTGG + Intergenic
1179725050 21:43337329-43337351 GATGGTGATGGTGGTGGTAGTGG - Intergenic
1179911779 21:44454749-44454771 GATTGTGGTGATGGTTTCACAGG + Intergenic
1181757397 22:25033976-25033998 GACTGTGATGGTGGTTTCACAGG - Intronic
1183244149 22:36680628-36680650 GATAATGATGGTGGTGTTAGTGG - Intronic
1183974853 22:41505822-41505844 GATTGTGGTGCTGGTTTCACAGG + Intronic
1184519440 22:44984107-44984129 GATGGTGATGGTGGTTATGGTGG - Intronic
1184519748 22:44986385-44986407 GATGGTGATGGTGGTGCTCCTGG - Intronic
1184552935 22:45214574-45214596 GATTGTGACGCTGGTTTCACAGG + Intronic
1185003443 22:48261197-48261219 GATGGTGATGATGGTGTTAATGG - Intergenic
1185078823 22:48698074-48698096 GATGGTGATGGTGGTGATAATGG + Intronic
1185215416 22:49597244-49597266 GATGGTGATGGTGGTAATAATGG + Intronic
1185308718 22:50140316-50140338 GATTGTGCTGATGGTTTTATGGG + Intronic
949302835 3:2604757-2604779 GATTGTGATGATGGTTTCATGGG - Intronic
949336900 3:2984704-2984726 GATCGTGATACTGTTTTTAATGG + Intronic
951041269 3:17991166-17991188 GGTGGTGATGGTGGTTTTTAAGG - Intronic
951081419 3:18454531-18454553 GATCATGGGGGTGGTTTTAATGG - Intergenic
951440697 3:22719940-22719962 GATCGTGGTGATGGTTCCACAGG - Intergenic
951479601 3:23145662-23145684 GATTGTTGTGGTGGTTTTATGGG - Intergenic
951797739 3:26559889-26559911 GATTGTGGTGGTGATTTCACAGG + Intergenic
952065667 3:29566819-29566841 GATCGTTATGGTGGTTATGCAGG + Intronic
952442795 3:33349927-33349949 GACCCGGATGGTGGTTTTACTGG + Intronic
952798491 3:37265630-37265652 GATGGTGGTGATGGTTTCACAGG - Intronic
955633963 3:61005413-61005435 GATGGTGATGGTGATGGTACTGG + Intronic
956016778 3:64892344-64892366 GGTGGTGGTGGTGGTGTTACTGG - Intergenic
958588858 3:96126977-96126999 GATGGTGGTGATGATTTTACAGG + Intergenic
958768445 3:98397809-98397831 GTTCTTGATGGTGCTTTTAGGGG - Intergenic
959482003 3:106885135-106885157 GATTGTGGTGGTGGTTTTGTAGG + Intergenic
962056592 3:131878533-131878555 AATCTGGATGCTGGTTTTACAGG + Intronic
962551637 3:136498590-136498612 GCTTGTGGTGGTGGTTTTATAGG + Intronic
963377267 3:144484217-144484239 CATTATGGTGGTGGTTTTACTGG - Intergenic
964651763 3:159019414-159019436 GATCTGGATGGTGGTTACACAGG - Intronic
965165089 3:165187785-165187807 GATCGTGAGGATGGAGTTACTGG + Exonic
965208036 3:165747190-165747212 GATTGGGATGGTGGTTTTGCAGG + Intergenic
965569968 3:170162576-170162598 GATCATGATGGTGATATTAGAGG - Intronic
967121290 3:186385052-186385074 GATGGTGTTGGTGGTTATAGTGG + Intergenic
967617950 3:191595917-191595939 TATTGTGATGGTGGTTTTATGGG - Intergenic
969104342 4:4793722-4793744 GATGGTGATGGTGGTGGTAATGG + Intergenic
969281105 4:6171171-6171193 GATGGTGATGGTGGTGGTAATGG - Intronic
969336183 4:6511791-6511813 GATGGTGATGGTGGTGTTGGTGG + Intronic
969347578 4:6579096-6579118 GATGGTGATGGTGGTGGTGCTGG - Intronic
969347600 4:6579189-6579211 GATGGTGATGGTGGTGGTGCTGG - Intronic
970328149 4:14950115-14950137 CTTCGTGTTGGTGATTTTACTGG + Intergenic
970923232 4:21419384-21419406 GATGGTGATGGTGATTTTGGTGG + Intronic
972447626 4:39160832-39160854 GATTGTGTTGATAGTTTTACAGG + Intergenic
973620952 4:52725308-52725330 GATTGTGCTGATGGTTTTAAGGG - Intronic
975590303 4:75993219-75993241 GATTGTGATGATGGTTTTATGGG - Intergenic
976211683 4:82677535-82677557 GTTCGTGAAGCTGGCTTTACCGG - Intronic
976900965 4:90175440-90175462 GATTGTGGTGATGGTTTCACAGG + Intronic
977697865 4:99986941-99986963 GATTGTGGTGATGGTTTCACAGG + Intergenic
978779066 4:112530813-112530835 GATTGTGATGGTGGTTACAAAGG + Intergenic
979768265 4:124489811-124489833 GATTGTGATGGTGATTTCATAGG + Intergenic
984377638 4:178953491-178953513 GATGGTGATGGTGGTGGTAGTGG - Intergenic
985332443 4:188853534-188853556 GATTGTGGTGGTTGTTTCACAGG - Intergenic
985978960 5:3446646-3446668 GATGGTGATGGTGGTGTTGATGG + Intergenic
986736284 5:10669918-10669940 GATCATGATGGTGGTGATAGTGG + Intergenic
986816584 5:11419119-11419141 GATGGTGGTGGTGGCTCTACAGG + Intronic
987398709 5:17451962-17451984 GATGGTGATGGTGATCTTACAGG - Intergenic
987765223 5:22218642-22218664 GATTATGATGGTGGCTTCACAGG + Intronic
989237814 5:39169815-39169837 GGTTTTGATGGTGGTTATACTGG + Intronic
989715739 5:44460236-44460258 GATAGTGGTGATGGTTATACAGG - Intergenic
991577258 5:68117794-68117816 GATCGTGGTGATGGATTTATAGG + Intergenic
991901660 5:71466913-71466935 GTTTGTGATGATGATTTTACTGG + Intronic
992973566 5:82087885-82087907 GATTGTGGTGATGGTTTTATGGG + Intronic
998649028 5:144096870-144096892 GATCTGGATGGTGGTTACACAGG - Intergenic
999436380 5:151566689-151566711 GACCCTGATGCTGGTTTTAATGG - Exonic
999528357 5:152433600-152433622 GATCATAGTGATGGTTTTACAGG + Intergenic
1000732059 5:164847218-164847240 GATTGTGATGATGGTTTTACAGG - Intergenic
1001780435 5:174364171-174364193 GATGGTGATGGTGGTGGTAATGG + Intergenic
1001809108 5:174613542-174613564 GATTGGGATGGTGCTTCTACAGG + Intergenic
1002317697 5:178354502-178354524 GATCATGGGGGTGGTTTTAATGG + Intronic
1002627925 5:180545230-180545252 GATTGTGGTGATGGTTTCACGGG - Intronic
1002654154 5:180729611-180729633 GATCACGAAGGTGGTTTTCCAGG + Intergenic
1003055304 6:2812872-2812894 GATTGTGATGATGATTTCACAGG - Intergenic
1003111824 6:3257379-3257401 GATTGTAATGATGGTTTCACTGG - Intronic
1003111871 6:3257784-3257806 GATTGTGATGATGATTTCACTGG + Intronic
1003240654 6:4342989-4343011 GGTTGGGGTGGTGGTTTTACTGG + Intergenic
1003323571 6:5074790-5074812 GATGGTGATGGTGGTCATAATGG + Intergenic
1003362092 6:5436982-5437004 GATTGTGGTGATGGTTTCACTGG - Intronic
1003519344 6:6844257-6844279 AATCGTGATTGTAATTTTACAGG + Intergenic
1003684751 6:8291113-8291135 GATCATGATGCTGGTTTCATGGG - Intergenic
1005769046 6:29046652-29046674 GATTGTGTTGATGGTTTCACAGG + Intergenic
1007015406 6:38461233-38461255 GATTGTGGTGATGGTTTTACAGG - Intronic
1010207779 6:73338221-73338243 GATCGTGGTGATGGTTTCATGGG + Intergenic
1010276551 6:73974131-73974153 GATTGTGATGTTAGTTTCACAGG - Intergenic
1011046554 6:83089859-83089881 GATTGTGGTGATGGTTTTATGGG + Intronic
1014994519 6:128125264-128125286 GATCATGGTGGTGGTTTCTCAGG + Intronic
1016768153 6:147818367-147818389 GATGGTGGTGATGGTTTTGCAGG + Intergenic
1016878619 6:148888291-148888313 GATCATGAGGGTGGATTTTCAGG - Intronic
1016982656 6:149866962-149866984 GATTGTGGTGATGGTTTCACTGG + Intergenic
1017307921 6:152940692-152940714 GATTGTGATGATGATATTACAGG - Intergenic
1017724989 6:157270535-157270557 GATGGTGGTGGTGGTTGTGCTGG - Intergenic
1018042721 6:159939412-159939434 GATGGTGCTGATGGTTTTACGGG + Intergenic
1018110820 6:160535419-160535441 GATGGTGATGGTGGTAGTAGTGG + Intronic
1018110836 6:160535532-160535554 GATGGTGATGGTGGTAGTAGTGG + Intronic
1018245266 6:161816426-161816448 GACTGTGATAGTGGTCTTACCGG + Intronic
1019182096 6:170193803-170193825 CATCGTGAGGGTGCTTTTTCTGG - Intergenic
1019310068 7:355899-355921 GATGGTGATGGTGGTGATAGTGG - Intergenic
1020124413 7:5525370-5525392 GATTGTGGTGGTGGTCTTGCAGG - Intergenic
1020778117 7:12482082-12482104 GATAGTGATGATGGTTTTAAAGG + Intergenic
1022151323 7:27610307-27610329 GAATGTGGTGGTGGTTTTATGGG - Intronic
1024015558 7:45311475-45311497 GATGGTGGTGGTGGTTATAATGG + Intergenic
1024336021 7:48205941-48205963 AATCATGATGGTGGTTACACAGG - Intronic
1024982306 7:55167456-55167478 GGTGGTGATGATGGTGTTACTGG + Intronic
1026438448 7:70420835-70420857 GATCGTGGTGATGGCTTCACAGG + Intronic
1028117369 7:87014879-87014901 GATTGTTATGATGGTTTCACAGG + Intronic
1029918180 7:104233752-104233774 GATGGTGGTGATGGTTTCACAGG - Intergenic
1030343521 7:108407777-108407799 GATTGTGTTGATGGTTTCACAGG + Intronic
1033060626 7:138102990-138103012 GATTGTAATGATGATTTTACAGG + Intronic
1033967476 7:146993674-146993696 GATTGTCATGATGATTTTACAGG + Intronic
1034758628 7:153649171-153649193 GATGATGCTGGTGGCTTTACTGG - Intergenic
1034826137 7:154265012-154265034 GATAGTGATGATGGTGTTAATGG + Intronic
1034826145 7:154265114-154265136 GATAGTGATGATGGTGTTAATGG + Intronic
1034826151 7:154265189-154265211 GATAGTGATGATGGTGTTAATGG + Intronic
1035380934 7:158440592-158440614 GGTGGTGATGGTGGTAATACTGG + Intronic
1036782045 8:11656492-11656514 GATTGTGGTGATGGTTTCACGGG - Intergenic
1037530750 8:19770432-19770454 GATTGTGGTGATGGTTTCACGGG + Intergenic
1037596167 8:20356133-20356155 GATTGTGGTGATGGTTTCACAGG - Intergenic
1039680094 8:39725252-39725274 GATGGTGATGATGGTTTAAAGGG - Intronic
1039767196 8:40641605-40641627 GATTGTGATGATGGTTTCAAAGG - Intronic
1040418979 8:47221637-47221659 GATGGTGATGGTGCTGATACTGG - Intergenic
1040419113 8:47222515-47222537 GATGGTGATGGTGATGATACTGG - Intergenic
1041000760 8:53449279-53449301 GATAGTGGTGGTGGTTGCACAGG + Intergenic
1042494175 8:69437192-69437214 GATGGTGATGATGGTTTCATGGG + Intergenic
1042757607 8:72234292-72234314 TATCTTCATGGTGATTTTACAGG - Intergenic
1043964432 8:86457045-86457067 GATTGTAATGGTGGTTACACAGG + Intronic
1044593254 8:93934360-93934382 TATTTTGATGGTGGTTATACAGG - Intergenic
1045099344 8:98828712-98828734 GATGATGCTGGTGGTTTGACTGG - Intronic
1045244023 8:100426864-100426886 GATGGTGATGGTGGTTGTGGTGG - Intergenic
1045650215 8:104335249-104335271 GATTGTGATGATGTTTTCACGGG + Intronic
1045990630 8:108302800-108302822 GCTTGTGGTGATGGTTTTACAGG - Intronic
1047670587 8:127142028-127142050 GCTTGTGGTGGTGGTTTGACTGG - Intergenic
1049228496 8:141469757-141469779 GATGGTGATGGTGGTGATAATGG + Intergenic
1049296037 8:141839582-141839604 GGTGGTGATGGTGGTGGTACTGG + Intergenic
1049417559 8:142502232-142502254 GATGGTGATGGTGGTGGTGCTGG + Intronic
1049417641 8:142502655-142502677 GATGGTGATGGTGGTAGTAAGGG + Intronic
1049421804 8:142520045-142520067 GATTGTGATGGTGGTGATAGTGG + Intronic
1050811490 9:9753594-9753616 CAGAGTGATGGTGGTTTTAATGG + Intronic
1052510910 9:29418862-29418884 AATTGTGATGATGGTTTCACAGG - Intergenic
1053244272 9:36521748-36521770 GATTGTGTTGATGGTTTCACAGG + Intergenic
1053536318 9:38930097-38930119 GATAGTGATGTTGGTTTCATAGG - Intergenic
1054629816 9:67433851-67433873 GATAGTGATGTTGGTTTCATAGG + Intergenic
1054747309 9:68867625-68867647 GATTGTGGTGATGGTTTCACAGG + Intronic
1055405866 9:75973240-75973262 GATGTTGATGGTTGTTTTTCAGG - Intronic
1056849318 9:90068887-90068909 GATTGTGGTGATGGTTTCACAGG - Intergenic
1059536586 9:115086532-115086554 GAGTGTGATGATGGTTTCACTGG - Exonic
1059718516 9:116936104-116936126 GGTAGTGGTGGTGGTTTTAGTGG - Intronic
1059718535 9:116936188-116936210 GATGGTGATGGTTGTGGTACTGG - Intronic
1059797701 9:117716785-117716807 GATTGTGGTGATGGTTTGACAGG + Exonic
1059964980 9:119604733-119604755 GATGATGATGATGGTTGTACAGG + Intergenic
1061493397 9:130958609-130958631 GATGGTGATGGTGGTGGTGCTGG - Intergenic
1061493445 9:130958804-130958826 GATGGTGATGGTGGTGGTTCTGG - Intergenic
1062098349 9:134714454-134714476 GATGGTGATGGTGGTTGTGATGG + Intronic
1062236526 9:135512597-135512619 GATCGTGCTGGTGGCTGCACAGG + Intergenic
1062409013 9:136412351-136412373 GATTGTGCTGATGGTTTCACAGG - Intronic
1186227492 X:7416526-7416548 GTTTGTGATAGTGGTTTTATGGG - Intergenic
1186385771 X:9109035-9109057 GATTGTGGTGATGGTTTCACAGG - Intronic
1186661398 X:11671105-11671127 GATCGTGGTAGTGGTTTCATGGG - Intergenic
1187510647 X:19914802-19914824 TATTCTGTTGGTGGTTTTACTGG - Exonic
1188702357 X:33280620-33280642 GATTGTGGTGATGGTTTCACAGG + Intronic
1188892012 X:35623213-35623235 GATTGTGATGATGGTTTCACAGG + Intergenic
1189028621 X:37427361-37427383 GATGGTGATGGTTGTTTCATAGG - Intronic
1192303496 X:69932269-69932291 GATTGTGATGATGGTTTCACAGG + Intronic
1193239562 X:79151437-79151459 GATTGTGGTGGTGGTTTCCCAGG - Intergenic
1193892014 X:87059702-87059724 GATTGTCATGGTAGTTTTACAGG + Intergenic
1193911465 X:87311759-87311781 GATGGTAGTGGTGGTTTTATGGG - Intergenic
1194824743 X:98547945-98547967 GATTGTGATGATGGTTTCATGGG - Intergenic
1196115246 X:111992268-111992290 GATTGTGGTGATGGTTTCACAGG + Intronic
1196567294 X:117223849-117223871 GATGGTGGTGATGGTTTCACTGG - Intergenic
1197180218 X:123527320-123527342 GATGGTCGTGGTGGTTTCACAGG - Intergenic
1198594129 X:138217624-138217646 GATTGTGATGATGATTTTACAGG + Intergenic
1199212099 X:145224516-145224538 GATCGTGGTGGCGGTTTCATGGG + Intergenic