ID: 1077617328

View in Genome Browser
Species Human (GRCh38)
Location 11:3686665-3686687
Sequence GATCGTGATGGTGGTTTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 326}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077617328_1077617333 6 Left 1077617328 11:3686665-3686687 CCTGTAAAACCACCATCACGATC 0: 1
1: 0
2: 5
3: 35
4: 326
Right 1077617333 11:3686694-3686716 ATAAATAGAGCAAGGCGCGGTGG 0: 1
1: 0
2: 9
3: 138
4: 1292
1077617328_1077617332 3 Left 1077617328 11:3686665-3686687 CCTGTAAAACCACCATCACGATC 0: 1
1: 0
2: 5
3: 35
4: 326
Right 1077617332 11:3686691-3686713 AAAATAAATAGAGCAAGGCGCGG 0: 1
1: 0
2: 5
3: 124
4: 1908
1077617328_1077617331 -2 Left 1077617328 11:3686665-3686687 CCTGTAAAACCACCATCACGATC 0: 1
1: 0
2: 5
3: 35
4: 326
Right 1077617331 11:3686686-3686708 TCAAGAAAATAAATAGAGCAAGG 0: 1
1: 0
2: 2
3: 95
4: 820

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077617328 Original CRISPR GATCGTGATGGTGGTTTTAC AGG (reversed) Intronic