ID: 1077618330

View in Genome Browser
Species Human (GRCh38)
Location 11:3695885-3695907
Sequence TTTCCTCCATTTTGTAGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1092
Summary {0: 1, 1: 1, 2: 7, 3: 140, 4: 943}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077618330_1077618332 -9 Left 1077618330 11:3695885-3695907 CCTCAGCTACAAAATGGAGGAAA 0: 1
1: 1
2: 7
3: 140
4: 943
Right 1077618332 11:3695899-3695921 TGGAGGAAAACAGCCCGGCATGG 0: 1
1: 0
2: 1
3: 15
4: 201
1077618330_1077618333 -6 Left 1077618330 11:3695885-3695907 CCTCAGCTACAAAATGGAGGAAA 0: 1
1: 1
2: 7
3: 140
4: 943
Right 1077618333 11:3695902-3695924 AGGAAAACAGCCCGGCATGGTGG 0: 1
1: 0
2: 21
3: 349
4: 5637
1077618330_1077618338 25 Left 1077618330 11:3695885-3695907 CCTCAGCTACAAAATGGAGGAAA 0: 1
1: 1
2: 7
3: 140
4: 943
Right 1077618338 11:3695933-3695955 TGTAATCCCAGCACTCTGGCAGG 0: 51
1: 9692
2: 312579
3: 264031
4: 147153
1077618330_1077618336 21 Left 1077618330 11:3695885-3695907 CCTCAGCTACAAAATGGAGGAAA 0: 1
1: 1
2: 7
3: 140
4: 943
Right 1077618336 11:3695929-3695951 TGCCTGTAATCCCAGCACTCTGG 0: 2455
1: 97230
2: 235012
3: 242185
4: 214447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077618330 Original CRISPR TTTCCTCCATTTTGTAGCTG AGG (reversed) Intronic
900747200 1:4368611-4368633 TTTCTTCCATTTTATAGGTGAGG + Intergenic
901579940 1:10233954-10233976 TTACCTCCAGTTTATAGTTGAGG - Intronic
901757643 1:11451050-11451072 TTTCCTCCATTGTATAGATGGGG + Intergenic
901766667 1:11504242-11504264 TTATCTCCATTTTATAGTTGAGG + Intronic
901792279 1:11660590-11660612 TTTGCTCCATTTTATAGATGAGG + Intronic
902180004 1:14680772-14680794 GTTCATTCATTTTGTAGCTGAGG + Intronic
902520620 1:17013622-17013644 TGCCTTCCATTTTGTAGGTGAGG - Intergenic
902655790 1:17867221-17867243 TTATCTCCTTTTTGTAGATGAGG + Intergenic
902666813 1:17945331-17945353 TTATCCCCATTTTGTAGATGTGG + Intergenic
902774696 1:18667214-18667236 TTTCCCCAATTTTATAGATGAGG - Intronic
902803780 1:18848262-18848284 TTTTCTCCATTTTATAGGTTAGG - Intronic
902922665 1:19676252-19676274 TTTCTCCCATTTTGCAGATGTGG + Intronic
902924881 1:19689500-19689522 TTTCCACCATTTCCTAGATGAGG + Intronic
903012317 1:20339860-20339882 TTCTCCCCATTTTGTAGATGAGG - Intronic
903187335 1:21636039-21636061 ACTCTCCCATTTTGTAGCTGAGG - Intronic
903677939 1:25077049-25077071 TTACCTTCATTTTATAACTGGGG + Intergenic
904137909 1:28328311-28328333 TTTTCTCCATGTTGTAGCCAGGG + Intergenic
904208347 1:28869566-28869588 TTACCTCCATTTTACAGATGGGG + Intergenic
904503097 1:30928952-30928974 TTAACTCCATTTTACAGCTGAGG + Intergenic
904516920 1:31063242-31063264 TTTCTTTCATTTTCTAGATGAGG - Intronic
904744105 1:32700730-32700752 TTATCTCCATTTTATAGATGAGG + Intronic
904912950 1:33949115-33949137 TTACCCCCATTTTATTGCTGAGG - Intronic
904929904 1:34078577-34078599 TCACCTCCATTTTATAGATGAGG + Intronic
904993330 1:34611760-34611782 GCTCTTCCATTTTGAAGCTGTGG + Intergenic
905025158 1:34844760-34844782 TTTTCTCCATTTTATAGATAGGG - Intronic
905121259 1:35683802-35683824 TCTCCCCCATTTTGCAGATGAGG + Intergenic
905282108 1:36855884-36855906 TTGCCCCCATTTTGCAGATGTGG + Intronic
905321016 1:37117394-37117416 TTATCTACATTTTGTAGCTGAGG + Intergenic
905471146 1:38192988-38193010 TTTTCTCCATTGTATAGATGCGG + Intergenic
905847671 1:41246233-41246255 TTTCTTCCATTTTATAGATGAGG - Intergenic
906066141 1:42981569-42981591 TTCTCTCCATTTTGTAGATGTGG - Intergenic
906715080 1:47962668-47962690 ATTCCTCCATTTTATAGATGAGG + Intronic
906731305 1:48083691-48083713 TTCCCTCCATTGTGTGGCTCTGG + Intergenic
906929801 1:50158217-50158239 TTAGCTCCATTTTATAGATGAGG + Intronic
907045006 1:51295200-51295222 TTACCTCCATTTTAGAGATGAGG - Intronic
907170952 1:52464093-52464115 TTTCCCCCATTTTACAGATGAGG - Intronic
907191041 1:52649278-52649300 TTACCCCCATTTTATAGCAGAGG + Intronic
907387797 1:54137221-54137243 TTTCCTCATTTTTGTATTTGTGG - Intronic
907545901 1:55259748-55259770 TTATCTCCATTTTGCAGTTGAGG + Intergenic
907736054 1:57113301-57113323 TTATCTCCATTTTATAGGTGAGG + Intronic
907822893 1:57988382-57988404 TTTTCCCCATTTTATAGGTGAGG - Intronic
907952702 1:59198940-59198962 TTGGCCCCATTTTATAGCTGAGG - Intergenic
908006223 1:59732017-59732039 TTACCTCCATTTTACAGATGAGG - Intronic
908022948 1:59917122-59917144 TTTTCTCCCTTTTATAGCTGGGG - Intronic
908115886 1:60939893-60939915 TTTCTTCCATTTTCTAAATGAGG - Intronic
908226377 1:62060224-62060246 TCATCTCCATTTTGCAGCTGAGG + Intronic
908255324 1:62298651-62298673 TTTGTACCATTTTATAGCTGAGG - Intronic
908692245 1:66795516-66795538 TTGCCACCATTTTGCAGATGAGG - Intergenic
908788686 1:67759541-67759563 TTATGTCCATTTTGTAGATGAGG - Intronic
909462401 1:75932803-75932825 TTTCCCCTATCTTGTAGTTGAGG + Intergenic
909717846 1:78731416-78731438 TTTTCTCCATTTTCTAGATGAGG + Intergenic
909830613 1:80184953-80184975 TTTCCTCCTTTTGGTTACTGGGG - Intergenic
910175527 1:84426382-84426404 TTTTCTCCATTTTACAGATGAGG - Intergenic
910399232 1:86821887-86821909 GTTGCTCCATTTAGTAGTTGGGG + Intergenic
910522552 1:88139094-88139116 TTACCTTTATTTTGTAGATGAGG - Intergenic
910931017 1:92442690-92442712 TTAGCTCCATTTTGTAGATGAGG + Intergenic
911093279 1:94034950-94034972 TTATCTCCATTTTGCAGATGGGG + Intronic
911377814 1:97072881-97072903 TCTTCTCCATTTTATAGATGAGG + Intergenic
912254648 1:108046576-108046598 TTTCCTTCATTTTGCAGATGAGG - Intergenic
912336505 1:108867535-108867557 TTATCTCCATTTTGTGGATGTGG - Intronic
912503412 1:110137477-110137499 ATTCCTCCAGTTTGTACATGGGG - Intergenic
912588632 1:110790868-110790890 TTATCTCCATTTTATAGGTGAGG + Intergenic
913062236 1:115219190-115219212 TCTTCTCCATTTTGTGGGTGAGG - Intergenic
913249479 1:116900565-116900587 TTGTCTCCATTTTATAGATGGGG + Intergenic
913279407 1:117171744-117171766 TTGTCTCCATTTTATAGATGGGG + Intronic
913328117 1:117645493-117645515 TTCTCACCATTTTGTAGATGAGG + Intergenic
913476051 1:119239195-119239217 TTATCTCCATTTTGTAGGTAGGG + Intergenic
913708015 1:121447744-121447766 GTATCTCCATTTTGTAGATGAGG + Intergenic
913956538 1:143302562-143302584 TTTGCACCAGTTTCTAGCTGAGG + Intergenic
913980906 1:143513104-143513126 TTTGCACCAGTTTCTAGCTGAGG - Intergenic
914075267 1:144339533-144339555 TTTGCACCAGTTTCTAGCTGAGG - Intergenic
914103911 1:144626963-144626985 TTTGCACCAGTTTCTAGCTGAGG + Intergenic
914858663 1:151369753-151369775 ATTCCCACATTTCGTAGCTGTGG + Exonic
915183942 1:154087918-154087940 TTTCCTCCATTTCCTAGCCCCGG - Intronic
915350235 1:155219964-155219986 TTGCCTCCATTTTCTAGGTGAGG - Intergenic
915819626 1:159008358-159008380 TTTCCCCCACTTTGTGGCAGTGG - Intronic
915997124 1:160574751-160574773 TTACCTTCATTTTAAAGCTGAGG - Intronic
916184679 1:162119280-162119302 TTTCCTCCAGTTTGGAAATGGGG + Intronic
916228440 1:162514384-162514406 TTATCTCCATTTTATAGATGAGG - Intronic
916263338 1:162864417-162864439 TTTCTTTCTTTTTGTAGCTTTGG - Intronic
916423461 1:164658860-164658882 TTATCCCCATTTTATAGCTGAGG + Intronic
916817042 1:168364265-168364287 TTTTTTCCATTTTGTAAGTGAGG + Intergenic
917015140 1:170522214-170522236 ATTATTCCATTTTGTAGATGAGG - Intergenic
917249908 1:173047305-173047327 TTTCTCCCATTTTATAGATGAGG - Intronic
917453314 1:175165284-175165306 TTAGCTTCATTTTGTAGCTGAGG - Intronic
917600770 1:176571388-176571410 TTGCCTCCATTTTACAGATGAGG - Intronic
918535761 1:185572786-185572808 TATCCTCCAGATTATAGCTGAGG - Intergenic
918849131 1:189662009-189662031 ATTTCAACATTTTGTAGCTGTGG + Intergenic
918944496 1:191045062-191045084 TTATCTCCATTTTATAGATGAGG + Intergenic
920003640 1:202816559-202816581 TTATCTCCATTTTATAGATGAGG + Intergenic
920187434 1:204169205-204169227 TTTGTTCCATATTGTTGCTGGGG - Intergenic
920200092 1:204254630-204254652 TTACCCCCATTTTACAGCTGAGG - Intronic
920259101 1:204676950-204676972 TTTCCCCCATTTTGCAGTTGAGG - Intronic
920354155 1:205357860-205357882 CTGGCTCCATTTTATAGCTGAGG - Intergenic
920880556 1:209876549-209876571 TTTCCTCCACTTTACAGATGAGG + Intergenic
920919161 1:210284065-210284087 TTCCCTCCATTTTGAAGATGAGG + Intergenic
921049911 1:211503958-211503980 TTACCTCCAAATTATAGCTGAGG - Intergenic
921132391 1:212230864-212230886 TTCCCTCCATTTTATAGATGGGG + Intergenic
921684549 1:218075027-218075049 TTACCTCCATTTTACAGATGGGG - Intergenic
921702331 1:218282694-218282716 TTTTTTCCATTTTATAGATGAGG - Intergenic
922037964 1:221867887-221867909 TGCCCTCCATTTTATAGCTGGGG + Intergenic
922439415 1:225640684-225640706 TTATCTCCATTTTATAGATGAGG - Intronic
923495532 1:234521366-234521388 TTATCTCCATTTTATAGATGAGG + Intergenic
923867726 1:237957877-237957899 CTTGCTACATTTTGTAGCTAGGG + Intergenic
923976119 1:239265400-239265422 TTCTCTCCATTTTGCAGGTGAGG + Intergenic
924029723 1:239874056-239874078 TTATCCCCACTTTGTAGCTGAGG + Intronic
924355205 1:243166002-243166024 TTTTCTTCATTTGGAAGCTGGGG + Exonic
924721194 1:246624768-246624790 TTTGCTCTGTTTTTTAGCTGGGG + Intronic
1062793966 10:328389-328411 TTGTCTCCATTTTAAAGCTGAGG - Intronic
1062811638 10:470828-470850 TATCTTCCATTTTATAGATGAGG - Intronic
1063380869 10:5584965-5584987 TTGCCTCCATTGTATAGATGAGG - Intergenic
1063657585 10:8007723-8007745 ATTACCCCATTTTGTAGATGAGG - Intronic
1063740585 10:8814488-8814510 TTACCTCCATCTTATAGTTGAGG + Intergenic
1064670820 10:17712221-17712243 TTACCCCCATTTTATAGATGGGG + Intronic
1064689922 10:17905851-17905873 TTTGCCCCATTTTATAGCTAAGG - Intronic
1065377167 10:25054985-25055007 TTTTCTCCATTTTTGAGGTGAGG + Intronic
1065751005 10:28887128-28887150 TTTTCTCCATTTTATTGATGAGG + Intergenic
1065915071 10:30347989-30348011 GTTACTCCATTTTATAGATGAGG - Intronic
1066353430 10:34658855-34658877 TTTTGTCCATTTTATAGGTGAGG - Intronic
1067000109 10:42602963-42602985 TTTCCTAGAATTTGAAGCTGTGG - Intronic
1067238784 10:44473060-44473082 TTTCCTCCCTTTTGGAGGTAGGG + Intergenic
1067350474 10:45471340-45471362 CTTCCTCCATGCTGCAGCTGAGG + Intronic
1067546310 10:47194875-47194897 TTGGCTCCATTTTGCAGATGAGG - Intergenic
1067986677 10:51155430-51155452 ATTATTCCATTTTGTAGATGAGG + Intronic
1068509222 10:57942724-57942746 TTTCCTTCATTTTGTTTCTTGGG - Intergenic
1068644190 10:59447075-59447097 TTACCTCCAGTTTATAGGTGAGG + Intergenic
1068654123 10:59556766-59556788 TTGCCACCATTTTATAGTTGAGG - Intergenic
1068707861 10:60096827-60096849 CTCCCTCAATTCTGTAGCTGTGG - Intronic
1069296296 10:66848959-66848981 TTTCCTCAATTTTCTGGCAGGGG - Intronic
1069630529 10:69894678-69894700 TTTTCTCCTTTTTGTCCCTGGGG - Exonic
1069797964 10:71065265-71065287 GCTCCTCCATTTAGCAGCTGGGG - Intergenic
1069896708 10:71684565-71684587 TTACCACCATTTTGCAGATGAGG - Intronic
1070348625 10:75570185-75570207 TTACTTCCATTTTATAGATGAGG - Intronic
1070390367 10:75965138-75965160 TTTTCTCCATTTTACAGATGAGG - Intronic
1070537959 10:77393490-77393512 TTGTCCCCATTTTGTAGATGAGG + Intronic
1070562852 10:77580941-77580963 TTTTCTCCACTTTGCAGATGAGG + Intronic
1070625270 10:78046685-78046707 TTACCCCCATTTTATAGATGAGG + Intronic
1070690658 10:78522511-78522533 TTCTGTCCATTTTGTAGGTGAGG + Intergenic
1071330083 10:84550296-84550318 GCTCCACCATTTTCTAGCTGTGG + Intergenic
1071480889 10:86064210-86064232 TTTTTCCCATTTTATAGCTGAGG + Intronic
1071517175 10:86305856-86305878 TTGTCTCCATTTTATAGTTGAGG + Intronic
1071710746 10:88046678-88046700 TTTCCTCCATTTTACAGATGTGG + Intergenic
1071806474 10:89126996-89127018 TTTTCTCCATTTTATAGCTGAGG + Intergenic
1071823649 10:89302819-89302841 TTTTCTCCAGTTTGAAGGTGGGG + Intronic
1071963983 10:90833643-90833665 TTTCCTTCATTTTGTCTCTGGGG + Intronic
1072244410 10:93529798-93529820 TTACCTCTAGTTTGTAGATGTGG + Intergenic
1072724079 10:97800882-97800904 TTATCTCCATTTTGCAGATGAGG - Intergenic
1072728030 10:97826634-97826656 TTTCTCCCATTTTATAGCTGAGG - Intergenic
1072762715 10:98070524-98070546 TTATCTCCATTTTATAGATGAGG + Intergenic
1073071549 10:100797448-100797470 TTGTCCCCATTTTGTAGATGGGG - Intronic
1073083584 10:100874577-100874599 TTTTCTCCATTTTATAGATGAGG - Intergenic
1073662579 10:105493221-105493243 TTATCCCCATTTTGTAGATGAGG + Intergenic
1074068893 10:110046682-110046704 TTACCTCCATCTTGTAGATGAGG - Intronic
1074259178 10:111834666-111834688 TTACCCCCATTTTATAGATGAGG + Intergenic
1074283625 10:112077339-112077361 TTTCCTCTATTTTCTAAGTGAGG - Intergenic
1074286089 10:112099632-112099654 TTTCCTCCTTCTTTTAGCTTTGG - Intergenic
1074810899 10:117104030-117104052 TTGTCTCCATTTTATAGATGGGG + Intronic
1075104274 10:119527615-119527637 TTTCCTCCATTTTACAGATGGGG + Intronic
1075289883 10:121219926-121219948 TTGTCTCCATTTTGCAGATGAGG - Intergenic
1075949594 10:126465294-126465316 TTACCTCAATTTTATAGGTGAGG - Intronic
1075957767 10:126538714-126538736 GTTCCTTCACTTTGGAGCTGTGG - Intronic
1077075279 11:698242-698264 TTTCCTCCTTTTTGATTCTGAGG - Intronic
1077098180 11:808798-808820 TTACCCCCATTTTATAGATGAGG - Intronic
1077424046 11:2466209-2466231 GCTGCCCCATTTTGTAGCTGGGG + Intronic
1077618330 11:3695885-3695907 TTTCCTCCATTTTGTAGCTGAGG - Intronic
1077953983 11:6993184-6993206 ATTCCTCCATTTCGTTTCTGAGG + Intergenic
1078070822 11:8108602-8108624 GTCCCTGCATTTTCTAGCTGTGG - Intronic
1078087889 11:8245096-8245118 TTGCTTCCATTTTGTGGATGGGG + Intronic
1078228291 11:9413993-9414015 TATCCTCACTTTTGTAGTTGAGG - Intronic
1078578007 11:12517600-12517622 CTTCCTCCAGTTTGCAGATGGGG + Exonic
1078596193 11:12688718-12688740 TTTTCTCCATTTTGCAGAGGAGG - Intronic
1078984791 11:16582648-16582670 TTTCTTCTTTTTTGTATCTGTGG - Intronic
1079021040 11:16909045-16909067 TTTTCTCCATTTTGTAAATGAGG - Intronic
1079240236 11:18717297-18717319 TATTCCCCATTTTGTAGATGGGG + Intronic
1079331566 11:19537377-19537399 TTATCTCCATTTTACAGCTGAGG + Intronic
1079354740 11:19720897-19720919 TCTTCTCCATTTTATAGGTGAGG - Intronic
1079542765 11:21595038-21595060 GTTCCTCCATATTGTTCCTGTGG + Intergenic
1079736722 11:24006543-24006565 TTTCCTCCATTTAATAACTTTGG - Intergenic
1080157427 11:29128183-29128205 TTTCCCCCATTTTATAGAAGAGG + Intergenic
1080278064 11:30525135-30525157 TTTTCCCCATTTTGTAAATGAGG - Intronic
1080420116 11:32102251-32102273 TTTCCCCCATTTTACAGATGAGG - Intronic
1080482708 11:32668030-32668052 TTATCTCCATTTTATAGATGAGG - Intronic
1080503222 11:32889177-32889199 TTGCCTTCCTTTTGTAGTTGAGG - Intergenic
1080695960 11:34603227-34603249 ATACCCCCATTTTATAGCTGGGG + Intergenic
1081229497 11:40567459-40567481 ATTGCTCCATTTTATAGCTATGG + Intronic
1081305635 11:41508621-41508643 TCTCCTCCATTTCTTAGCTTTGG - Intergenic
1081446416 11:43135390-43135412 TTGCCTCTGTTTTGCAGCTGAGG - Intergenic
1082669633 11:56018462-56018484 TTTCCCCCATATTTTAGATGAGG + Intergenic
1082763590 11:57149149-57149171 TTTCCTTCCTTTTGTGGATGAGG - Intergenic
1082883579 11:58061460-58061482 TTACCTTCGTTTTGTAGATGAGG + Intronic
1082990403 11:59202312-59202334 TTTCTGCCATTTACTAGCTGTGG + Intronic
1083060206 11:59861877-59861899 TTTCTTTCATTTTATAACTGAGG + Intronic
1083115592 11:60456307-60456329 TTGCCCCCATTTTATAGATGAGG - Intronic
1083139064 11:60706697-60706719 ATTTTTCCATTTTGTAGATGAGG + Intronic
1083222522 11:61262397-61262419 TTATCTCCATTTTGCAGGTGGGG - Intronic
1083261828 11:61527339-61527361 TTATCTCTATTTTGTAGATGAGG + Intronic
1083305886 11:61761790-61761812 TTTTCTTCATTTTATAGATGAGG - Intronic
1083342072 11:61964951-61964973 TTTCCTCCATTTATTTCCTGGGG + Exonic
1084043271 11:66555019-66555041 TTTACTCCATTTTACAGATGAGG + Intronic
1084522331 11:69671631-69671653 TTTTCTCCATTTTACAGATGAGG + Intronic
1085193688 11:74651965-74651987 GTACCTCCATTTTGTAGCTGAGG + Intronic
1085333275 11:75669922-75669944 TTTCCTCCATTCTACAGATGAGG - Intergenic
1085431731 11:76457024-76457046 TTACCTCCATTTTACAGATGAGG - Intronic
1085808698 11:79660607-79660629 TTTCCCCCATTTTCCAGATGAGG + Intergenic
1086010784 11:82100920-82100942 TTTCCTCTATTTTGCACCTGTGG - Intergenic
1086313808 11:85567893-85567915 TTTCCTCCATTTTATAAATATGG + Intronic
1086404743 11:86489899-86489921 TTTCCCCCATTTTTTAAATGAGG + Intronic
1086445415 11:86865965-86865987 TTTCTTCCATTTTACAGATGGGG + Intronic
1086773258 11:90796026-90796048 TTTCCTGCATTTCGTTTCTGTGG + Intergenic
1086929956 11:92682175-92682197 TTACCCCCATTTTGTAGTTGAGG - Intronic
1087159284 11:94933584-94933606 TTTTCTCCATTTCATAGATGAGG + Intergenic
1087195480 11:95300376-95300398 TTATCTTCATTTTGTAGATGAGG + Intergenic
1087456151 11:98389172-98389194 TTTCCTTTCTTTGGTAGCTGTGG - Intergenic
1087468268 11:98538068-98538090 TTTTCTCCATTTTTTAACTGAGG + Intergenic
1087673999 11:101138050-101138072 TTATCTCCATTTTGCAGATGAGG + Intergenic
1087711828 11:101562860-101562882 TTTTCTCCATTTTGCAGCTTAGG - Intronic
1087948348 11:104192956-104192978 TTGCCTCCATTTTGCAGATAAGG - Intergenic
1088157785 11:106829738-106829760 TTACCTCCATTTTGAAGTAGTGG - Intronic
1088224901 11:107609068-107609090 TTATCTCCATTTTGCAGCTGAGG - Intronic
1088313131 11:108481259-108481281 ATTCCTGCATCTAGTAGCTGAGG + Exonic
1088643014 11:111891853-111891875 TTCCCTCTATTTTGTAAATGCGG + Intergenic
1088718817 11:112573980-112574002 TTGTCTCCATTTTGTAGCATGGG - Intergenic
1088901564 11:114121613-114121635 TTATCTCCATTTTGCAGGTGAGG + Intronic
1089691713 11:120190968-120190990 ATTTCTCCATTTTGCAGATGAGG - Intergenic
1090256317 11:125287138-125287160 TTATCCCCATTTTGTAGATGAGG + Intronic
1090616184 11:128517416-128517438 TTTTCTCCATTTTTCAGATGAGG - Intronic
1090623348 11:128582292-128582314 TTACCTGCATTTTATAGTTGAGG - Intronic
1090930498 11:131293877-131293899 TTTCTTCCATTTGCTAACTGAGG + Intergenic
1090964983 11:131590727-131590749 TTTTCTCCATCTTGTAGGTGAGG + Intronic
1091795403 12:3295024-3295046 TTTCCCCCATTTTACAGGTGAGG - Intergenic
1092176996 12:6416693-6416715 TTTCCTCCACTTTTCAGATGTGG + Intergenic
1092261297 12:6954600-6954622 TTACCCCCATTTTATAGATGAGG - Intronic
1092752814 12:11734726-11734748 ATTACTCCATTTTATAGATGAGG + Intronic
1093201137 12:16187578-16187600 TTTGCTCCATTTTTTACTTGTGG - Intergenic
1093260680 12:16933679-16933701 TTTCCTTCATTTTTTAAGTGAGG + Intergenic
1093428556 12:19057264-19057286 TTTGCTCCATTTTATAGATGAGG - Intergenic
1093665807 12:21811475-21811497 TTATCTCCATTTTATAGATGAGG - Intronic
1093668019 12:21837780-21837802 TTTTCTCCATTTAATAGATGAGG + Intronic
1093817424 12:23566923-23566945 TTACCTTCATTTTGTAGTTAAGG - Intronic
1093862002 12:24177200-24177222 CTACCTGCATTTTTTAGCTGAGG + Intergenic
1094025426 12:25956796-25956818 TTTCCTCCTTTCTTTGGCTGTGG - Intergenic
1094084208 12:26571723-26571745 TTAGCTCCATTTTATAGATGGGG - Intronic
1094175677 12:27538482-27538504 TTACCTCCATTTTACAGATGAGG + Intronic
1094341794 12:29420402-29420424 TTATCTCCATTTTATAGATGAGG + Intronic
1094435743 12:30419093-30419115 TTTCCCTCATTTTTCAGCTGAGG - Intergenic
1094524419 12:31222228-31222250 TTATCTCCATTTTATAGATGAGG - Intergenic
1094761915 12:33543518-33543540 TTTCATCCATATTGTAGCATGGG - Intergenic
1095599374 12:43997809-43997831 TTCTCTCCATTTTGTATATGAGG + Intronic
1095825667 12:46528722-46528744 TTTGGCCCATTTTTTAGCTGAGG - Intergenic
1096203673 12:49704832-49704854 TTACCTCCATTTTACAGATGAGG + Intronic
1096235230 12:49921909-49921931 TCTTCTCCATTTTGCAGATGAGG + Intergenic
1096490719 12:52011335-52011357 TTACCCTCATTTTGTAGATGGGG - Intronic
1096555726 12:52402514-52402536 TATCCTCCATTTTGGAAATGGGG - Intronic
1096802307 12:54118992-54119014 TTTCCTCCCTCTTGTTACTGAGG - Intergenic
1098027870 12:66224210-66224232 TTATCTCCATTTTGCAGATGAGG + Intronic
1098086502 12:66849984-66850006 TATCCTTCATTTTGTAGATGAGG - Intergenic
1098159742 12:67638615-67638637 TTTCCCCCATTTTAGAGATGAGG - Intergenic
1098381882 12:69878737-69878759 TTATTTCCATTTTGTAGATGAGG + Intronic
1098443095 12:70538344-70538366 TTATCTCCATTTTGCAGATGAGG + Intronic
1099461826 12:82931666-82931688 GTTTCTCCATTTTGTGGCTCTGG + Intronic
1099658990 12:85531261-85531283 TTGTCTCTATTTTGTAGATGAGG - Intergenic
1099680222 12:85818332-85818354 TTTACTCCACTTATTAGCTGAGG - Intronic
1099729122 12:86475183-86475205 TTCCTTCCATTTTGCAGTTGAGG - Intronic
1099746754 12:86714490-86714512 TTTCCTCCATACTGTTCCTGTGG + Intronic
1100273399 12:93047710-93047732 TTATCTTCATTTTGTAGATGAGG + Intergenic
1100313503 12:93420574-93420596 TTACCACCATTTACTAGCTGGGG - Intronic
1100511320 12:95277183-95277205 TTTCCTGCAGTTTGTAGAAGGGG - Intronic
1101039107 12:100736378-100736400 TTTCCCCCATTTTATAAATGAGG + Intronic
1101197595 12:102401209-102401231 TTGCCCCCATTTTGCAGATGAGG + Intronic
1101283570 12:103285365-103285387 TTTCCTCCATTTTAAAGATTTGG + Intronic
1101394757 12:104336809-104336831 TTTCCCCCTTTTTATAGATGAGG + Intronic
1101407249 12:104439372-104439394 TTTCCTGCCTTTTGTTTCTGCGG + Intergenic
1101619364 12:106369750-106369772 TTTCCTGCATTTTTCAGATGAGG - Intronic
1101732862 12:107440917-107440939 TTTCTCCCATTTTATAGATGAGG + Intronic
1101992043 12:109494127-109494149 TTTTCTCCATTTTATAGATAAGG + Intronic
1102161793 12:110775043-110775065 TTACCTCCATTTTGCAGAGGAGG - Intergenic
1102195991 12:111025509-111025531 TTTCCTCCCTTTAATAGCTGAGG - Intergenic
1102670534 12:114615120-114615142 TTTGCTCCATGTTCTAGCCGTGG - Intergenic
1102785123 12:115598606-115598628 TTTCCCCCGTTTTGTAGTTAGGG - Intergenic
1103699310 12:122840472-122840494 TTGCCCCCATTTTGTAGATAAGG - Intronic
1104182732 12:126398429-126398451 TTTCCTTCATTTTGTGGCAAAGG - Intergenic
1104246468 12:127046895-127046917 TTTCCTTCATTTTGCATATGAGG - Intergenic
1104553048 12:129774899-129774921 TCATCTCCATTTTGCAGCTGGGG - Intronic
1105638439 13:22238683-22238705 TTATCCCCATTTTGTAGATGAGG - Intergenic
1105958718 13:25308878-25308900 GTTCTTCCATTTTCTAGATGTGG - Intronic
1106023290 13:25934538-25934560 TATCCTTCATTTGGTAGATGAGG - Intronic
1106470047 13:30046213-30046235 TTACCTCCATTTTACAGATGAGG - Intergenic
1106999779 13:35529139-35529161 TTTTCACCATTTTATAGATGAGG + Intronic
1107013477 13:35690610-35690632 CTTCTTCCATGTTGTACCTGAGG + Intergenic
1107074670 13:36310116-36310138 TTATCTCCATTTTGCAGATGAGG - Intronic
1107236275 13:38174697-38174719 TTTTCTCCATTTTATACATGAGG + Intergenic
1107458790 13:40580507-40580529 TTATCCCCATTTTGTAGATGAGG - Intronic
1107768044 13:43758288-43758310 TTTGTTCCATTTTATTGCTGAGG - Intronic
1108546807 13:51503212-51503234 TATCCTCCATTTTACAGGTGGGG - Intergenic
1108728905 13:53212362-53212384 ATTCCTCCATTTTACAGGTGAGG - Intergenic
1109436799 13:62313974-62313996 TTTTTTCCATTTTGTAGGTAAGG - Intergenic
1110356164 13:74570321-74570343 TTACCTACATTTTGCAGATGAGG + Intergenic
1110554046 13:76838572-76838594 TTTTCTGCATCTTGTAGATGTGG - Intergenic
1110708306 13:78621076-78621098 TTTCCCTCACTTGGTAGCTGAGG + Intronic
1110810917 13:79809686-79809708 TTACCACCATTTTGCAGATGAGG + Intergenic
1111511713 13:89273675-89273697 TTGTCTCCATTTTATAGATGAGG + Intergenic
1111896492 13:94148864-94148886 TTATCTCCATTTTATAGATGAGG - Intronic
1111902682 13:94219266-94219288 TCGCCTCCATTTTGTAAATGAGG - Intronic
1112071362 13:95854084-95854106 TTACCTCCATTTTGTAGATGTGG - Intronic
1112110167 13:96287918-96287940 TTATCTCCATTTTGCAGATGTGG + Intronic
1112203670 13:97302942-97302964 TTTTCTCCATTTTGTGGTTGAGG + Intronic
1112812156 13:103231340-103231362 TTTTGTCCATTTTATAGATGTGG - Intergenic
1113276189 13:108733373-108733395 TTTTCTGCTTTATGTAGCTGAGG + Intronic
1115296600 14:31834751-31834773 TTTCCCCCATTTTGCACATGAGG + Intronic
1115305177 14:31926392-31926414 TGTCCACCATTTTGCAGATGAGG - Intergenic
1115312539 14:31993979-31994001 TTTCATCCATTTTACAGATGAGG + Intergenic
1115592726 14:34879690-34879712 ATTCTTCCATTTTGCACCTGAGG + Intergenic
1115836953 14:37417037-37417059 GTTACCCCATTTTGTAGGTGAGG + Intronic
1116410627 14:44618144-44618166 TTACCTCCATTTTATAGATATGG - Intergenic
1116548374 14:46201151-46201173 TTTTCTCCATTTTATAAATGAGG - Intergenic
1116625682 14:47259980-47260002 ATTCTTTCATTTTGAAGCTGGGG + Intronic
1117219926 14:53593162-53593184 TTACCTCCATTTTGCAGATGAGG + Intergenic
1117320262 14:54615275-54615297 TTACTTCCATTTTGCAGTTGAGG + Intronic
1117556702 14:56893663-56893685 TTGCCCCCATTTTATAGCTGAGG - Intergenic
1117663234 14:58029925-58029947 TTTCCTCCTTTTGGCTGCTGTGG - Intronic
1117673707 14:58134028-58134050 TTATCCCCATTTTATAGCTGAGG - Intronic
1118051270 14:62030980-62031002 TTTCCTGCATTTTATAGATAAGG - Intronic
1118434352 14:65755954-65755976 TATACTCCATTTTATAGATGAGG + Intergenic
1118960959 14:70532211-70532233 TTTCCCCCATTGTGTAGTTTTGG - Intronic
1119037888 14:71246061-71246083 TTGACTCCCTTTTCTAGCTGAGG + Intergenic
1119888929 14:78168154-78168176 TTACCTCCATTTTATAGGTGAGG + Intergenic
1120029864 14:79629203-79629225 TTTCTTCTACTTTGTTGCTGGGG + Intronic
1120108893 14:80529116-80529138 TTTCACCCATTTTATAGATGAGG - Intronic
1120213613 14:81658784-81658806 TTTCCTCCATTTGACAGATGAGG + Intergenic
1120390619 14:83903029-83903051 TTTCTATCATTTTGAAGCTGAGG + Intergenic
1120522553 14:85541520-85541542 TTTCCTCCATTTTCTACTTAAGG - Intronic
1120715258 14:87834573-87834595 ATATCTCCATTGTGTAGCTGAGG + Intergenic
1120726553 14:87948423-87948445 TTTTCCTCATTTTGTAGATGAGG - Intronic
1120783704 14:88510708-88510730 TTATCTCTATTTTGTAGATGAGG - Intronic
1121252555 14:92510845-92510867 TTTCCTCCATTTTAAAGATTTGG - Intergenic
1121311330 14:92936710-92936732 TTGTCTCCATTTTATAGATGAGG - Intergenic
1121419451 14:93802492-93802514 TTGCCACCATTTTATAGATGAGG + Intergenic
1121455695 14:94037754-94037776 TTACCCCCATTTTACAGCTGAGG + Intronic
1121658992 14:95620671-95620693 TTTGCCCCATTTTTTAGGTGAGG - Intergenic
1121698602 14:95933697-95933719 TTCCCTCCATCTTATAGATGAGG - Intergenic
1122074485 14:99227368-99227390 TTAGCTCCATTTTATAGATGGGG + Intronic
1122465201 14:101928796-101928818 TTTCCTCCAATTTTAAGATGAGG - Intergenic
1122733575 14:103821077-103821099 CTTTCCCCATTTTGTAGATGAGG + Intronic
1122734629 14:103830464-103830486 TGCCCTCCATTTTATAGATGAGG + Intronic
1122833843 14:104421426-104421448 TTTCCTCCATTTCACAGATGAGG - Intergenic
1123394186 15:19912039-19912061 TTTGCACCAGTTTCTAGCTGAGG - Intergenic
1124154439 15:27213168-27213190 TCTCCTCCTTTTTGTCACTGAGG - Intronic
1124197109 15:27640831-27640853 TTTCCTTCATTTTGACACTGGGG - Intergenic
1124834574 15:33183222-33183244 TTTTCTCCATTTTATAAATGAGG - Intronic
1125816769 15:42591908-42591930 TTTACTCCATTTTGTAGATAAGG + Intronic
1126876628 15:53049468-53049490 TGTCCTCCATTCTGTAAATGTGG + Intergenic
1127409112 15:58687311-58687333 GTTCCTCTACTTTGTAGCTGTGG + Intronic
1127539614 15:59923760-59923782 TTTCCTCCATTTTATAGCTGAGG - Intergenic
1127724269 15:61732837-61732859 TTGCCTTCATTTTATAGATGAGG - Intergenic
1127966566 15:63927078-63927100 TTTTCTTCATTTTGCAGATGAGG - Intronic
1128087169 15:64894373-64894395 TTACCTCCATTTTCTAGATAAGG + Intronic
1128528562 15:68429182-68429204 TTACCCCCACTTTGTAGGTGAGG + Intronic
1128824428 15:70698844-70698866 TTTCCTTCTTGTTGTAGGTGGGG - Intronic
1128875280 15:71196526-71196548 ATGACTCCACTTTGTAGCTGTGG + Intronic
1128894347 15:71358614-71358636 TTGCCTCCATTTTACAGATGGGG - Intronic
1129487663 15:75891551-75891573 TTATCTGCATTTTGTAGATGAGG + Intronic
1129660993 15:77552815-77552837 TTCTCTCCATTTTATAGATGAGG - Intergenic
1129666836 15:77584095-77584117 TTGTCTCTATTTTGTAGGTGAGG + Intergenic
1130210225 15:81915452-81915474 TTACCTCCATTTTATAGATGCGG - Intergenic
1130876460 15:88018697-88018719 CTTTCCCCATTTTGTAGGTGAGG - Intronic
1131206184 15:90449786-90449808 GTTCCTCCAGTTTGTTGTTGTGG + Intronic
1131590453 15:93742397-93742419 TTATATCCATTTTGTACCTGAGG + Intergenic
1131651325 15:94402975-94402997 TTTCCCCCATTTTTTATATGAGG - Intronic
1132100095 15:99016664-99016686 TCTCCTCTATTTTGTAGATGAGG - Intergenic
1133632208 16:7631764-7631786 TTTCCTAAATTGTGAAGCTGAGG + Intronic
1133718503 16:8471955-8471977 TTTTTTCCATTTTCTAGCTTAGG - Intergenic
1133884321 16:9811367-9811389 TTTTCTCCATTTTATAGAGGAGG - Intronic
1134003131 16:10798370-10798392 TTATCTCCATTTTGCAGGTGAGG - Intronic
1134003394 16:10800333-10800355 CTTTCTCCATTTTGCAGATGAGG - Intronic
1134237095 16:12475112-12475134 TCAGCTCCATTTTGTAGATGAGG + Intronic
1134380742 16:13723030-13723052 TTATCCCCATTTTGTAGATGTGG + Intergenic
1134644237 16:15853631-15853653 TTTCCTCCATTGTGTGGCCAGGG + Intronic
1134644857 16:15857765-15857787 CTTCCCCCATTTTGTAGCTATGG - Intergenic
1134888073 16:17812181-17812203 TCTCTTCCATTTGGTAGCTGTGG + Intergenic
1135078478 16:19414017-19414039 TGACTTCCATTTTATAGCTGAGG + Intronic
1135157941 16:20070407-20070429 TTGCCCCCATTTTGCAGATGGGG + Intronic
1135591830 16:23710707-23710729 TTTGCCCCATTTTATAGATGAGG + Intronic
1135847558 16:25932434-25932456 TTACCTCCATTTTTTAGCCTAGG + Intronic
1135865810 16:26100877-26100899 TTATCTCCATTTTGCAGATGGGG + Intronic
1135903885 16:26492578-26492600 TTATCCCCATTTTGTAGATGAGG - Intergenic
1136334522 16:29602707-29602729 ACACCTCCATTTTATAGCTGGGG + Intergenic
1136531971 16:30875887-30875909 TTGGCTCCATTTTTTAGATGCGG + Intronic
1136566864 16:31075734-31075756 TTTCCTCCAGTTAATAGCTGAGG - Intronic
1136700206 16:32129928-32129950 TTTGCACCAGTTTCTAGCTGAGG - Intergenic
1136767444 16:32797535-32797557 TTTGCACCAGTTTCTAGCTGAGG + Intergenic
1136800704 16:33073166-33073188 TTTGCACCAGTTTCTAGCTGAGG - Intergenic
1136958600 16:34816882-34816904 TTTTCACCAGTTTCTAGCTGAGG - Intergenic
1136995266 16:35184659-35184681 CTTCTTCCTTCTTGTAGCTGAGG + Intergenic
1137085576 16:36117836-36117858 TTTGCACCAGTTTCTAGCTGAGG + Intergenic
1137377669 16:47967324-47967346 TTTCTTCCATTTTGCAGAAGAGG - Intergenic
1137719550 16:50620038-50620060 TTACCTCCATTTTCCAGATGGGG - Intronic
1137751961 16:50869920-50869942 TTTCCTCTATTTTGTTAATGTGG + Intergenic
1137761833 16:50947313-50947335 TTTCCACCATTTTGTGTCTCTGG - Intergenic
1137868110 16:51922416-51922438 TTACCCCCATTTTGTAAATGAGG + Intergenic
1138299460 16:55914219-55914241 TTTTCCCCATTTTATAGGTGAGG - Intronic
1138654157 16:58481151-58481173 TTGTCCTCATTTTGTAGCTGAGG - Intronic
1138756655 16:59494352-59494374 TCTTCTCCATTTGCTAGCTGAGG - Intergenic
1139304539 16:65973257-65973279 TTTCCTTCATTTTGTTACTATGG + Intergenic
1139458190 16:67100667-67100689 TTTCCTCTATTGTCTAGCTAAGG + Exonic
1139499370 16:67349343-67349365 TTATCTCCATTTTATAGGTGGGG - Intronic
1139722886 16:68871402-68871424 TTTTCTGCTTTTTGGAGCTGTGG + Intronic
1139767553 16:69244083-69244105 TTACTCCCATTTTGTAGATGAGG + Intronic
1140408701 16:74728118-74728140 TTACTTCCATTTTATAGCTGGGG - Intronic
1140904926 16:79401964-79401986 TTACCCCCATTTTATAGATGAGG + Intergenic
1141233493 16:82193709-82193731 TTACCTCCATTTTATAGATAAGG - Intergenic
1141283638 16:82651298-82651320 TTAACTTCATTTTATAGCTGAGG + Intronic
1141296597 16:82775577-82775599 TATCCCCCATTTTATAGCAGAGG + Intronic
1141418384 16:83895012-83895034 GTTCATCCATGTTGTAGCAGGGG + Intergenic
1141507540 16:84487839-84487861 TTACCTCCATTTTATACCTGAGG - Intronic
1141537801 16:84695147-84695169 TTTCTCCCATTTTGCAGATGAGG + Intergenic
1141570150 16:84929224-84929246 TTTTCTCCATTTTGTAGATAAGG - Intergenic
1141766349 16:86062351-86062373 TTTTACCCATTTTGCAGCTGAGG + Intergenic
1142437294 16:90069240-90069262 TTTCCTCCATTGTGTAGTCTTGG - Intronic
1203069838 16_KI270728v1_random:1059557-1059579 TTTGCACCAGTTTCTAGCTGAGG + Intergenic
1142565378 17:836681-836703 TTATCTACATTTTGCAGCTGAGG - Intronic
1143159618 17:4860641-4860663 TTTCCTCCAGGTAGGAGCTGTGG + Intronic
1143271905 17:5682092-5682114 TTACCCCCATTTTATAGATGAGG - Intergenic
1143749818 17:9020595-9020617 TTAACTCCATTTTGCAGATGAGG - Intergenic
1143757478 17:9077498-9077520 TTATCTCCATTTTATAGGTGAGG - Intronic
1144052684 17:11510424-11510446 GTTCCTGCATTTTGCAACTGTGG - Intronic
1144356865 17:14454747-14454769 TGTCTTCCATTTTGCAGATGAGG + Intergenic
1144531699 17:16045358-16045380 TTATCTCCATTTTGTAGATGAGG - Intronic
1144869896 17:18362982-18363004 TTTCCCCCATTTTACAGGTGAGG - Intronic
1144890890 17:18493712-18493734 TTAGCTCCATTTTGTAGATGAGG - Intronic
1145043763 17:19596176-19596198 TTCCCCCCATTTTGTATATGAGG - Intergenic
1145141333 17:20450606-20450628 TTAGCTCCATTTTGTAGATGAGG + Intronic
1145198135 17:20914155-20914177 TTTCCCCCATTTTAAAGATGAGG + Intergenic
1145324540 17:21791947-21791969 TTTGCACCAGTTTCTAGCTGAGG + Intergenic
1145718994 17:27050363-27050385 TTCCCTCCATATGGTGGCTGTGG - Intergenic
1145794581 17:27648322-27648344 TTAGCTCCATTTTGTAGATGAGG - Intronic
1146172016 17:30641702-30641724 TTTCCCCCATTTTATAGATGGGG - Intergenic
1146275032 17:31511124-31511146 TTAACTCCATTTTATAGATGGGG + Intronic
1146345474 17:32057738-32057760 TTTCCCCCATTTTATAGATGGGG - Intergenic
1146370008 17:32259966-32259988 TTGCCTCCATTTTATAAATGGGG - Intergenic
1146651798 17:34611735-34611757 TTAGCTCCATTTTGTAGATAGGG + Intronic
1146694940 17:34901614-34901636 TTATTTCCATTTTGTAGATGAGG - Intergenic
1146914353 17:36668758-36668780 TTTCCTCCATTTTACAGCCAGGG + Intergenic
1146943994 17:36861957-36861979 TTTCCCCCATTTTACAGATGAGG - Intergenic
1146986394 17:37223739-37223761 TTTTCTCCATTTTGTAGCTCAGG - Intronic
1147305361 17:39560447-39560469 TTATCTCCATTTTATAGATGTGG + Intronic
1147553155 17:41459321-41459343 TTGCATCCATTTTGTAAATGAGG - Intergenic
1148082159 17:44973068-44973090 TTTTCCCCATTTTATGGCTGAGG + Intergenic
1148190777 17:45677229-45677251 TTACCTCCATTTTACAGATGGGG + Intergenic
1148207537 17:45788542-45788564 TTTCCCCCATTTTATAGCTGGGG - Intronic
1148317198 17:46712363-46712385 TTGTCTCTATTTTGTAGGTGGGG + Intronic
1148587539 17:48791548-48791570 TCTGCTCCACGTTGTAGCTGTGG + Exonic
1148752180 17:49951684-49951706 TTAGCTCCATTTTGCAGATGGGG + Intergenic
1149021207 17:51966917-51966939 TTTCTCCCATTCTGTAGGTGTGG - Intronic
1149208857 17:54280616-54280638 TTCCCTCCAATCTGTTGCTGGGG + Intergenic
1149411052 17:56407391-56407413 TTAACTGCATTTTGTAGATGAGG + Intronic
1149541025 17:57468149-57468171 TTTCCTCCATTTTACAGATGCGG - Intronic
1149605385 17:57921231-57921253 TTCCCCCCATTTTATAGCAGAGG - Intronic
1149606379 17:57927880-57927902 TTTCCTCCACTTTATAGATGGGG + Intronic
1149722012 17:58854669-58854691 TTTCCTTCATTTTGTTAATGTGG + Intronic
1150479367 17:65497569-65497591 TTATCCCCATTTTGTAGATGAGG + Intergenic
1151095570 17:71493660-71493682 TTTTCCCCATTTTATAGATGAGG - Intergenic
1151143715 17:72019412-72019434 TTTTCCCCATTTTGCAGATGAGG - Intergenic
1151680672 17:75621120-75621142 ATTCCTGCATGGTGTAGCTGTGG - Intergenic
1151906362 17:77052050-77052072 TTGGCTCCATTTTACAGCTGAGG - Intergenic
1152116860 17:78393393-78393415 TTTCCTCCATGGTGAAGTTGTGG + Intronic
1152354880 17:79801934-79801956 TTACCCCCATTTTCTAGATGAGG + Intergenic
1152384267 17:79961137-79961159 TTTGCTCCTTTTTATTGCTGAGG - Intronic
1153347231 18:4040217-4040239 TTACCTCCATTTGATAGATGAGG - Intronic
1153372726 18:4337363-4337385 TTTCCTACTTTTTGTAGCGACGG + Intronic
1153609768 18:6871906-6871928 TTACGTCCATTTTACAGCTGAGG + Intronic
1153801813 18:8677870-8677892 TTTTCTACATTTTATATCTGTGG - Intergenic
1154982997 18:21519751-21519773 GTTCCTCCATTTAGTAGCCATGG - Intronic
1155346236 18:24859915-24859937 TTACCCCCATTTTGCAGATGAGG - Intergenic
1156140141 18:34098864-34098886 CTACCTCCATTTTGCAGATGGGG - Intronic
1157332854 18:46716197-46716219 TACCCTCCATTTTATAGATGAGG - Intronic
1157622188 18:49023065-49023087 TTACCTCCATTTTATAGATAAGG + Intergenic
1157741969 18:50101458-50101480 TTTCTCCCATTCTGTAGGTGAGG - Intronic
1157965975 18:52208539-52208561 TTTGCTTCATTTTGTAAATGAGG - Intergenic
1157991396 18:52500848-52500870 TTATCCCCATTTTGCAGCTGAGG - Intronic
1158053555 18:53253368-53253390 TTATCTCCATTTTGCAGATGAGG + Intronic
1158326611 18:56319877-56319899 AGCCCTCCATTTTGAAGCTGAGG + Intergenic
1158331756 18:56369980-56370002 TTTCCTCCATTTTATAGGCCAGG + Intergenic
1158642476 18:59215316-59215338 TTTACTCCATTTTATAAATGAGG - Intergenic
1158898876 18:61942322-61942344 TTTACTACATTTTGTATTTGTGG + Intergenic
1159151106 18:64524529-64524551 ATTCCTCCACATAGTAGCTGTGG - Intergenic
1159185861 18:64972926-64972948 TCTCTTCCATTTACTAGCTGGGG + Intergenic
1159474855 18:68908053-68908075 TTTCCTTCATTTTGTTAATGTGG + Intronic
1159774423 18:72586279-72586301 ATTCCTCCATTATATAACTGTGG + Intronic
1159851303 18:73529943-73529965 CTTCCTCCATTTCAGAGCTGTGG + Intergenic
1161243094 19:3233846-3233868 GGTCCTCCATTTTTTAGATGGGG + Intronic
1161612106 19:5248832-5248854 TTCCCTCCATTTTACAGATGAGG - Intronic
1162543180 19:11310627-11310649 TTTCCTCCATTTTACAGATGAGG - Intronic
1162945223 19:14039308-14039330 TTACCCTCATTTTGTAGATGAGG + Intronic
1162990411 19:14298333-14298355 TTTCCCCCATTTTATAGACGGGG + Intergenic
1164873129 19:31663629-31663651 ATTTCTCCATTTTATGGCTGAGG + Intergenic
1165342753 19:35224490-35224512 TATCCCCCATCTTGTAGTTGGGG + Intergenic
1165671799 19:37686185-37686207 TTCCCTCCATTTTACAGATGAGG + Intronic
1165719971 19:38072210-38072232 TTACCTCCATTTTACAGATGAGG - Intronic
1165824142 19:38696005-38696027 CTGCCTCCATTTTGCAGATGAGG - Intronic
1166143620 19:40819612-40819634 TTATCTCCATTTTATAGATGTGG + Intronic
1166183933 19:41127167-41127189 TTATCTCCATTTTATAGATGTGG - Intronic
1166567738 19:43775459-43775481 TTGCCCCCATTTTATAGATGTGG + Intronic
1166738549 19:45100490-45100512 TTTGCCCCAATTTGTAGATGAGG + Intronic
1166740868 19:45114124-45114146 TTGGCTCCATTTTGCAGATGAGG + Intronic
1167254022 19:48416314-48416336 TTTCTTCCATCTTGTAGATTAGG - Intronic
1168664273 19:58191501-58191523 TTTCATCCTTCTTGGAGCTGAGG + Intronic
925029230 2:636586-636608 ATGACTCCATTTTGTCGCTGCGG + Intergenic
925861961 2:8187257-8187279 TTATCTCCATTTTATAGATGAGG - Intergenic
926907430 2:17818586-17818608 TTACCTTCATTTTATAGATGGGG + Intergenic
927071940 2:19539929-19539951 TTTCCTCCAGGTTCTAACTGGGG + Intergenic
927500547 2:23580020-23580042 TTATCTCCATTTTATAGATGAGG - Intronic
927882239 2:26697051-26697073 TTACCCCCATTTTTCAGCTGAGG + Intronic
928360223 2:30656527-30656549 TTTTCTCCATTTTCCAGCTGAGG - Intergenic
928421353 2:31139453-31139475 TTCCCTCCATTTTACAGATGAGG - Intronic
929028481 2:37628211-37628233 TTTCCTCCATTTTATTCCTGTGG - Intergenic
929091883 2:38225391-38225413 TTTAATGCCTTTTGTAGCTGTGG - Intergenic
929923990 2:46194303-46194325 TATCCCCCATTTTATAGTTGAGG + Intergenic
930190146 2:48450296-48450318 TTACCTCCATTTTACAGATGAGG - Intronic
930659363 2:54038537-54038559 TTATCTCCATTTTGTAGATGAGG + Intronic
930740682 2:54829983-54830005 TTATCTCCATTTTATAGATGAGG - Intronic
931937662 2:67215927-67215949 TTTTCTACATCATGTAGCTGGGG - Intergenic
932504706 2:72217435-72217457 CTAGCTCCTTTTTGTAGCTGAGG - Intronic
932648153 2:73527040-73527062 TGTCCTCCATTTTGTTGATGAGG + Intronic
932752983 2:74383801-74383823 TTTCTTCCTTTTTGCAGTTGAGG - Intronic
932841933 2:75091305-75091327 TTTACTCCATTTTATAGATAAGG + Intronic
932860365 2:75285333-75285355 TTTTCCCCATTTTAGAGCTGAGG + Intergenic
933030561 2:77323629-77323651 TTACCTCCATTTCATAGCTAAGG + Intronic
933750699 2:85600786-85600808 TTTTCACCATTTTATAGGTGAGG - Intronic
933987179 2:87601926-87601948 CTTCCTCCACTCTGTAGCTAAGG + Intergenic
934701796 2:96447838-96447860 CTTCTTCCTTTTTGTACCTGTGG + Intergenic
934855853 2:97729446-97729468 TTATCTCCATTTTGCAGATGAGG - Intronic
934879417 2:97961760-97961782 TTTCCTCCATTGAGTTGCTTTGG - Intronic
935659704 2:105455643-105455665 TTTCTTCCAGTTTCTAGCTAGGG + Intergenic
935727964 2:106040259-106040281 TTTCCCTCATTTTGTGGATGAGG + Intergenic
935740217 2:106140646-106140668 TTTTCTTCATTTTATAGGTGAGG - Intronic
936253539 2:110888072-110888094 TTTTCTTTCTTTTGTAGCTGGGG + Intronic
936306662 2:111348882-111348904 CTTCCTCCACTCTGTAGCTAAGG - Intergenic
936636440 2:114264196-114264218 TTTCCCCCATTTCATAGCCGGGG + Intergenic
936991376 2:118370254-118370276 TTTCCTCCATTTTTTTTCTGTGG - Intergenic
937186499 2:120048801-120048823 TTTCCTCTACTTTATAGCTCTGG + Intronic
937558210 2:123186360-123186382 TTTTCTCCATTTTGTTGTTTTGG - Intergenic
937587981 2:123579182-123579204 ATTGCTCCATTTCATAGCTGAGG - Intergenic
937630757 2:124098589-124098611 TTTCCCCCATTTTACAGATGAGG + Intronic
937853239 2:126654931-126654953 TTGCCTCCATTTTATAGATGAGG + Intergenic
938038693 2:128057646-128057668 TTTTCTTCATATTGTAGCTAAGG - Intergenic
938697871 2:133851004-133851026 TTTCCCCCATGTTGTGGCTCAGG + Intergenic
938709259 2:133961474-133961496 TAACCTCCATTTTACAGCTGAGG + Intergenic
938826401 2:135009927-135009949 TTATCTTCATTTTGTACCTGAGG + Intronic
939035422 2:137125159-137125181 TTTCCTGAATTTTGGAGCAGTGG - Intronic
939131967 2:138245915-138245937 TTACCTCAATTTGGTACCTGAGG - Intergenic
939422368 2:141989652-141989674 TTTCCTCCATTCTGTTCTTGTGG + Intronic
939517512 2:143187565-143187587 TTGCCTCCATCTTGTAGATGAGG + Intronic
939552618 2:143634401-143634423 TTCCCTCCATTTTATAAATGTGG - Intronic
940336825 2:152537953-152537975 TTATCTCCATTTTGCAGATGAGG - Intronic
940356293 2:152746605-152746627 TTTACTCCATTTTAGAGATGAGG - Intronic
941946979 2:171110163-171110185 TTTAGTCCATTTTCTAGATGAGG - Intronic
942165829 2:173240132-173240154 TTTCCCCCATTTTGCAAATGAGG + Intronic
943330568 2:186553765-186553787 GTTCCTCCATTATTTTGCTGAGG - Intergenic
943529428 2:189060563-189060585 TTATCTCCATTTTGTAGATGAGG - Intronic
943712478 2:191112346-191112368 TTTCTTCCATTTTACAGATGAGG - Intronic
944923196 2:204436862-204436884 TTATCTCCATTTTGTGGATGAGG - Intergenic
945295839 2:208170743-208170765 ATTCTTCCATTTTGCAGATGAGG + Intronic
946005099 2:216518255-216518277 TTTCCCCCATTTTACAGATGAGG + Intronic
946018610 2:216623787-216623809 GTGTCTCCATTTTGTAGATGAGG + Intergenic
946021086 2:216640602-216640624 CTACCTCCATTTTGCAGGTGTGG + Intronic
946571612 2:221029906-221029928 TCTCCTTCATTTTGGAGGTGAGG - Intergenic
947077409 2:226360773-226360795 TTAGCTCCAGTTTATAGCTGAGG + Intergenic
947099061 2:226599793-226599815 TTTTCTCCATTATCTAGATGAGG + Intergenic
947367104 2:229407899-229407921 ATTCCTCCATTTTACAGATGAGG + Intronic
947543983 2:230997910-230997932 TTATCTCCATTTTATAGATGGGG + Intronic
948470864 2:238177622-238177644 GTTCATCCATTTTGTAGCATGGG + Intronic
1168768819 20:400683-400705 TCTCCTCCAGCTTGTAGCTAAGG - Intergenic
1168793826 20:597909-597931 ATTGCTCCATTTTATAGATGAGG - Intergenic
1168842988 20:921582-921604 TTTTCTCCATGTTATAGATGAGG - Intergenic
1168945547 20:1753067-1753089 TTTTCCCCATTCAGTAGCTGTGG - Intergenic
1169391509 20:5194956-5194978 TTGTCTCCATTTTATAGATGAGG + Exonic
1170247859 20:14244141-14244163 TTGTCTCCATTTTGTAGCTGGGG + Intronic
1170272836 20:14547765-14547787 TCTCCTCGATTGTGTACCTGAGG + Intronic
1170926202 20:20726601-20726623 TTATCTCCATTTTATAGGTGAGG - Intergenic
1172062946 20:32199385-32199407 TTTCCCTCATTTTGCAGGTGAGG + Intronic
1172241595 20:33416501-33416523 TCACCTCCATTTTATAGATGAGG - Intronic
1172768331 20:37362893-37362915 TTTCCCCCATTTTGCCGCTGAGG + Intronic
1172809302 20:37636037-37636059 TCACCTCCATTTTATAGCTGAGG + Intergenic
1172872527 20:38144629-38144651 TTGTCTCCATTTTATAGATGAGG + Intronic
1172876420 20:38167004-38167026 TTTCCCCCATTTTGCAGAGGAGG - Intergenic
1173145719 20:40522400-40522422 TATTCCCCATTTTGTAGGTGAGG - Intergenic
1173228846 20:41178561-41178583 TTTCCTAGATTTTGTATCTGTGG - Exonic
1173401397 20:42729299-42729321 TTTCTCCCCTTTTGCAGCTGTGG - Intronic
1174869629 20:54171218-54171240 TTACTCCCATTTTGTAGATGGGG + Intronic
1175180191 20:57140908-57140930 TTATCCCCATTTTGTAGATGGGG + Intergenic
1175181029 20:57147827-57147849 TTACATCCATTTGGTAGATGAGG + Intergenic
1175389816 20:58620005-58620027 TTATCTCCATTTTGCAGATGAGG + Intergenic
1175463988 20:59177268-59177290 TTCTCTCCATTTTGCAGATGAGG + Intergenic
1175759460 20:61551059-61551081 TTACCTGCATTTTGTATTTGAGG - Intronic
1176886385 21:14260595-14260617 TTACCTGCATTATATAGCTGAGG - Intergenic
1177305576 21:19311012-19311034 GTTCCTCCATTTTCTTACTGTGG + Intergenic
1177400708 21:20601242-20601264 TTAGCTCCATTTTGGAGCTTTGG - Intergenic
1177443535 21:21161081-21161103 ATTCCTTCATTTTGTAGCAGAGG - Intronic
1177647571 21:23918768-23918790 TTTTCTCCATTTGGGAGCTCTGG - Intergenic
1178639077 21:34331497-34331519 TCATCTCCATTTTGTAGATGCGG + Intergenic
1178819374 21:35961476-35961498 TTGTCTCCATTTTATAGATGAGG - Intronic
1179631791 21:42683462-42683484 TTTGGTCCATTTTATAGCAGAGG + Intronic
1180721736 22:17914420-17914442 TGACCTCCATTTTGCAGATGGGG + Intronic
1181155465 22:20917456-20917478 CGTCCGCCATTTTGTTGCTGTGG + Exonic
1181351929 22:22265159-22265181 TCATCTGCATTTTGTAGCTGAGG + Intergenic
1181752062 22:24995797-24995819 TTGCTTCCATTTTATAGATGAGG + Intronic
1181771628 22:25129831-25129853 TTTTCTCCATTTTAGAGCTAGGG - Intronic
1181894109 22:26091711-26091733 TTACCTCCATTTTACAGATGAGG - Intergenic
1181983191 22:26781208-26781230 TTATCTCCATTTTGTAGATTAGG + Intergenic
1182110976 22:27723310-27723332 TTTTCTCCATTTTGCAGATACGG - Intergenic
1182295068 22:29307505-29307527 TTATCTCCATTTTATAGATGAGG - Intronic
1182721017 22:32400297-32400319 GCACCTCCATTTTGAAGCTGAGG + Intronic
1182967029 22:34532041-34532063 TTATCTCTATTTTGTAGATGAGG - Intergenic
1182983546 22:34695644-34695666 TTTCCTCTATTTTCCAGATGAGG + Intergenic
1183343695 22:37295578-37295600 TCACCTCCATTTTATAGATGAGG + Intronic
1184087356 22:42272844-42272866 TTATCTCCATTTTATAGCTGAGG - Intronic
1184544191 22:45154994-45155016 TATTCTCCATTTTGGAGATGAGG + Intergenic
1184687797 22:46104361-46104383 CTGCCGCCATTTTGTGGCTGAGG + Intronic
949119778 3:372378-372400 TTTCTTCCACTTGGTAGCTTTGG + Intronic
949420352 3:3858624-3858646 TTTCCTCCATTTTATACATGAGG + Intronic
949465536 3:4339505-4339527 GTGGCTCCATGTTGTAGCTGCGG + Intronic
949488075 3:4560048-4560070 TTTTCTCCATTTTACAGATGAGG - Intronic
949500472 3:4675911-4675933 TTATTTCCATTTTGTAGATGAGG + Intronic
950504468 3:13385881-13385903 TTTCATCCATGTTGTAGCAAGGG - Intronic
950643288 3:14362019-14362041 TATCCTCCATTTTACAGATGGGG - Intergenic
950673139 3:14539162-14539184 TTCTCTCCATTTTGCAGTTGGGG - Intronic
950715846 3:14847300-14847322 TAGTCTCCATTTTATAGCTGAGG + Intronic
950930668 3:16785638-16785660 TTTTCCCCATTTTATAGATGAGG + Intergenic
950990911 3:17436233-17436255 TTTTCTCCATTTTACAGATGAGG - Intronic
952071363 3:29640621-29640643 TTTCCTCCACTTTGAACCAGTGG - Intronic
952868926 3:37880192-37880214 TTTTCTCCCTTTTACAGCTGAGG + Intronic
953080472 3:39612000-39612022 TTTCCTCTATATTGTCTCTGCGG + Intergenic
953260775 3:41337049-41337071 TTAGCTCCATTTTCTAGATGGGG + Intronic
953430813 3:42838810-42838832 TTTAATCCATTCTGTAGCTGAGG - Intronic
953453298 3:43021678-43021700 TTCTCCCCATTTTATAGCTGAGG + Intronic
953579976 3:44145001-44145023 TTTCCTCCATTCTTCAGATGTGG - Intergenic
953920445 3:46947874-46947896 TATCCTCATTTTTGTAGATGAGG - Intronic
954413850 3:50383318-50383340 TTCCCTGCATTATGGAGCTGAGG + Intronic
954483508 3:50823939-50823961 CTACCTCCATTTTTTAGTTGAGG + Intronic
954614393 3:51962192-51962214 TTCCCTCCATTTTATAAGTGAGG - Intronic
954933869 3:54308716-54308738 TTTCCCCCATTTTATAGGTTAGG - Intronic
954950377 3:54467539-54467561 TTATCTCCATTTTGCAGATGAGG - Intronic
955215245 3:56979768-56979790 TTTTCCCCATTTTCTAGATGAGG - Intronic
955430608 3:58840832-58840854 TTTTCTCCATTTTATAGATGAGG + Intronic
955445204 3:59002180-59002202 TTTGTTCCATTTTGTAGATGAGG - Intronic
955605346 3:60695809-60695831 TTACTTCCATTTTGTAGGTGAGG - Intronic
955703954 3:61709131-61709153 TTGTCTCCATTTTGCAGATGAGG + Intronic
955730041 3:61975261-61975283 TTACCCCCATTTTATAGATGAGG - Intronic
955740612 3:62087565-62087587 TTACCTCCATTTTATAGATGTGG + Intronic
955912740 3:63874558-63874580 TTTTCTCTATTTTTCAGCTGAGG + Intronic
956412096 3:68990179-68990201 TTTTCTCTATTTTGCAGATGAGG + Intronic
956481898 3:69681440-69681462 TTATCTCCATTTTATAGATGAGG - Intergenic
956501385 3:69889341-69889363 TTACCTCCATTTTATAGATGAGG - Intronic
956853102 3:73249482-73249504 ATTTCTCCATTTTATAGATGGGG + Intergenic
956907696 3:73783568-73783590 TTATCTCCATTTTGTAGATGAGG + Intergenic
957258953 3:77875713-77875735 TTTCCTCCATTCTGTTCTTGTGG - Intergenic
957341512 3:78903946-78903968 TTTCTTCTATTTTGTAGATCAGG - Intronic
957659015 3:83122081-83122103 TTTCCTCCAATTTTTTCCTGAGG - Intergenic
957994533 3:87672389-87672411 TTTCCTCCATTTTACAGATAAGG - Intergenic
958732462 3:97973456-97973478 TTACCTCCATTTTACAGTTGAGG + Intergenic
958818242 3:98942227-98942249 TTTCCTTCTTTTTATATCTGAGG + Intergenic
959083221 3:101824333-101824355 TTAGCTCCATTTTATAGATGAGG + Exonic
959557491 3:107738867-107738889 TTTTCCCCATTTTGTAAATGAGG + Intronic
959693679 3:109226587-109226609 TTTTCTCCATTTTATAGGTGAGG + Intergenic
960127277 3:114014243-114014265 TATCTTCCATTTTGTCCCTGGGG - Intronic
960851069 3:122055078-122055100 TTTATTCTATTTTGTTGCTGCGG + Intergenic
961590935 3:127981308-127981330 TTTTCTCCATTTTGTAGAAAAGG - Intronic
961727839 3:128944577-128944599 GTTCCTCCATTTTTTAGTTTTGG - Intronic
961953430 3:130774127-130774149 TTTCCTCCATTTTCTTGCACAGG + Intergenic
962016143 3:131442445-131442467 TTACCTCCATTTTACAGGTGAGG - Intergenic
962228287 3:133635124-133635146 TTTCCAACTTTTTGTAGATGTGG + Intronic
962314128 3:134348351-134348373 TTGCCTCCATTTTACAGATGAGG - Intergenic
962605029 3:137025874-137025896 TTTGCTCCATTTTCCAGGTGAGG - Intergenic
962701508 3:138004234-138004256 TTATCTCCATTTTATAGGTGAGG + Intronic
962722239 3:138187043-138187065 TTATCTCCATTTTATAGGTGGGG - Intergenic
962839868 3:139223700-139223722 TTTTCCCCATTTTGCAGATGAGG + Intronic
963026917 3:140928877-140928899 TTTCATCCATGTTGTAGCCGGGG + Intergenic
963303033 3:143620224-143620246 ACTCCTCCACTTTCTAGCTGAGG + Intronic
963393958 3:144707854-144707876 TTATCTCCATTTTATAGATGAGG - Intergenic
963715966 3:148804303-148804325 TTTCCTCCAATATTTGGCTGTGG - Intronic
963827670 3:149971545-149971567 TTTCCTCCTTTTTGTTGTGGGGG + Intronic
964027916 3:152100387-152100409 TTTTCTCCATTATATAGATGAGG - Intergenic
964408060 3:156370651-156370673 ATTCCTCCATTGTGGAGCTCAGG - Intronic
964585322 3:158292201-158292223 GTTCATCCAATTTGTAGTTGAGG - Intronic
964634704 3:158846235-158846257 TTTCCCCCATTTTACAGCTGAGG + Intergenic
964672013 3:159237034-159237056 TTTACTTCACTGTGTAGCTGTGG - Intronic
964798686 3:160529102-160529124 TTTCCTGCATTTTGTAGAGATGG + Intronic
965116400 3:164495300-164495322 TTACCACCATTTTCCAGCTGAGG - Intergenic
965697788 3:171427483-171427505 TATACTCCATTTTACAGCTGAGG - Intronic
965846196 3:172965147-172965169 ATTACTCCATTTTATAGTTGAGG + Intronic
965954615 3:174354181-174354203 TTTCCTACATTTTGTATATTAGG - Intergenic
966113958 3:176438589-176438611 TTCCCTCCTTTTTGCAGGTGAGG - Intergenic
966254745 3:177905018-177905040 TTCCCTCCATTTTCCAGGTGAGG + Intergenic
966305852 3:178533851-178533873 TTCCCTCCAATTTTTATCTGTGG - Intronic
966469058 3:180266951-180266973 TTTCCCCAATTTTATAGGTGAGG + Intergenic
966663864 3:182448409-182448431 TTACCCCCATTTTGTAGATGAGG - Intergenic
966667984 3:182494181-182494203 TGATCTCCATTTTGTAGATGAGG - Intergenic
966941624 3:184751653-184751675 TTACCTCCATTTTACAGTTGAGG + Intergenic
966966459 3:184999679-184999701 TTGCCTTCGTTTTGCAGCTGTGG + Exonic
967292238 3:187932498-187932520 TTTCCTCCATTCTGAACCAGTGG + Intergenic
967521137 3:190434330-190434352 TTTCCTCCATATTGTTCTTGTGG + Intronic
967550722 3:190792139-190792161 TTTACTCCATTTTGTAGATGAGG + Intergenic
967601184 3:191391006-191391028 CTGCCTCCATTTTGCAGATGAGG - Intronic
967878088 3:194280350-194280372 TTTTCTCCATTCTGAAGATGGGG - Intergenic
968093244 3:195910502-195910524 TTACATCCATTTTCTAGATGAGG - Intronic
968634133 4:1669166-1669188 TTTCCTCTTTTTTGGAGCAGAGG - Intronic
968905471 4:3448747-3448769 TATGCCCCATTTTATAGCTGGGG + Intronic
969053883 4:4389934-4389956 TTACCCCCATTTTGCAGATGTGG + Intronic
969081100 4:4618907-4618929 TTTGCTCCATTTCTAAGCTGAGG + Intergenic
969583459 4:8078728-8078750 TTTCCCCCATTATGCAGTTGGGG - Intronic
969621494 4:8281062-8281084 TTTCCTCTATTTTAAAGGTGGGG - Intronic
969924243 4:10571202-10571224 TTATTTCCATTTTATAGCTGAGG + Intronic
970237646 4:13974612-13974634 TTTTCTCCAATTTGTAGATGAGG - Intergenic
970974659 4:22029630-22029652 TTATCTCCATTTTGCAGATGAGG - Intergenic
970988317 4:22183984-22184006 TTATCCCCATTTTGTAGATGAGG - Intergenic
971063647 4:23002097-23002119 TTTCCTGCATTTTCCATCTGAGG + Intergenic
971219224 4:24689701-24689723 TTCTCTCCATTTTGTAAGTGAGG - Intergenic
972241954 4:37203271-37203293 TTTCCTCCATATTGTTCTTGTGG - Intergenic
972319491 4:37960156-37960178 TTACCTCCATTTTATGGATGTGG + Intronic
972523206 4:39881893-39881915 TTTCCTCCATATTGTTCTTGTGG + Intronic
972563995 4:40253587-40253609 TTTTCTCCATTTTACAGATGAGG - Intergenic
972578283 4:40372198-40372220 TTGCTTCCATTTTGCAGCTGAGG - Intergenic
972669239 4:41198045-41198067 TTGTCTCCATTTTGCAGATGTGG + Intronic
974113065 4:57547971-57547993 TTTCCCCCATTTTATAGATGAGG + Intergenic
974136524 4:57825310-57825332 TTTGTTCCATATTGTTGCTGGGG + Intergenic
975137105 4:70885680-70885702 TTATCTGCATTTTGTAGATGGGG - Intergenic
975142460 4:70932547-70932569 GTCTCTCCATTTTGTAGATGAGG + Intronic
975144320 4:70950892-70950914 TTATCTCCATTTTGTAGACGAGG + Intronic
975187062 4:71416018-71416040 GTTCTTCCATTTATTAGCTGAGG - Intronic
975609036 4:76185888-76185910 TTACCTCCATTTTACAGATGAGG - Intronic
975880204 4:78896463-78896485 TTACCCCCATTTTATAGATGAGG - Intronic
975915483 4:79320540-79320562 ATTACTCCATTTTGTGGTTGAGG - Intronic
975950112 4:79760324-79760346 CTGCCTCCATTTTGCAGATGAGG - Intergenic
976741734 4:88363802-88363824 TTTCCTCCTTTTAGTAGCTTTGG + Intergenic
977815786 4:101412241-101412263 TCTCCTCCATTTTCGGGCTGAGG - Intronic
978656004 4:111066291-111066313 TTTTCTACATTTTGCAGATGGGG - Intergenic
979058268 4:116021467-116021489 TTTCCTCCATTGTGTATCCTTGG - Intergenic
979132175 4:117060927-117060949 TTTGCTCCATTTGGTAGCATAGG + Intergenic
979246592 4:118513629-118513651 TTTTCTTCATTTGGAAGCTGGGG - Intergenic
979446959 4:120825162-120825184 TTTTCTCCATTTTACAGATGAGG - Intronic
979467955 4:121061907-121061929 TTGTCTCCATTTTGTAGATGAGG - Intronic
979532048 4:121779251-121779273 TTACCTCCATTTTATAGATGAGG - Intergenic
979616542 4:122748883-122748905 TTTTCTCCATGTTATAGATGAGG + Intergenic
979621044 4:122799209-122799231 TTTTCTCCATTTTATAGATGAGG + Intergenic
980019196 4:127688685-127688707 TTTCCTCCATTTTACAGATGAGG - Intronic
980465796 4:133178937-133178959 TTTCCTAAATTTTGTTGCTGTGG + Intronic
980590988 4:134888466-134888488 TTCCTTCCATTTTGCAGCTCTGG - Intergenic
980955466 4:139424117-139424139 ATTCCACCATTTGCTAGCTGTGG - Intergenic
981121553 4:141057053-141057075 TTACCTCCATTTTATAGATGAGG - Intronic
982128467 4:152205131-152205153 TTGCTTCCATTTTATAGATGAGG + Intergenic
982136343 4:152277415-152277437 TTACCCCCATTTGCTAGCTGTGG - Intergenic
982698814 4:158635751-158635773 TTTCCTTCTTTCTGTAACTGTGG + Intronic
982716570 4:158815140-158815162 TTATCTCCATTTTGCAGATGAGG + Intronic
982754647 4:159203871-159203893 TGTCTTCCATTTTGCAGTTGAGG + Intronic
982799064 4:159680230-159680252 TTTACTGCTTTCTGTAGCTGTGG - Intergenic
983153723 4:164318089-164318111 TTTCCTCATTTTTATAGATGAGG - Intronic
984150117 4:176119277-176119299 TTATCTCCATTTTATAGATGAGG + Intronic
984591577 4:181623237-181623259 TTTTCCCCATTTTACAGCTGAGG - Intergenic
985359838 4:189162086-189162108 CTTCCTGCATTTTGAAGCTCTGG + Intergenic
985381688 4:189401809-189401831 TTTCCACTCTTTTGTTGCTGTGG + Intergenic
986038039 5:3959846-3959868 TTTCCTCCAGCTGGTAGATGAGG - Intergenic
986590076 5:9359284-9359306 TTTCCCCTTTTATGTAGCTGAGG - Intronic
986619500 5:9657595-9657617 TGTCCTCCATGTTGTAGCATGGG - Intronic
986710294 5:10483745-10483767 TTTCCTCCATTTTCCAGAGGTGG + Intergenic
987055617 5:14188320-14188342 TTTTCTCCATTTTACAGATGAGG + Intronic
987098261 5:14568974-14568996 TTGTCTCCATTTTATAGATGAGG - Intergenic
987284733 5:16444558-16444580 TTATCCCCATTTTGTAGGTGGGG - Intergenic
987342167 5:16948871-16948893 TTTTCTTTTTTTTGTAGCTGTGG + Intergenic
987495769 5:18642693-18642715 TCCCCTCCATTTTGGAGGTGGGG + Intergenic
987863788 5:23515771-23515793 TTTCCTCCATTGTGTAGTCTTGG + Intronic
988866426 5:35340147-35340169 TTATCTGCAATTTGTAGCTGAGG + Intergenic
988888253 5:35582959-35582981 CTATCTCCATTTTATAGCTGAGG + Intergenic
988982625 5:36586529-36586551 TTACCTCCATTTTGCAGAAGAGG + Intergenic
989401166 5:41009137-41009159 TTTACTCCAGTTTATAGTTGTGG - Intronic
989415177 5:41166383-41166405 TTACCCCCATTTTATAGATGAGG - Intronic
989622007 5:43393658-43393680 TTTCCTCCATTCTTAAGATGAGG + Intronic
989777830 5:45230623-45230645 TTATCTCCATTCTGTAGATGAGG + Intergenic
989970084 5:50512956-50512978 GTATCTCCATTTTGTAGATGAGG - Intergenic
990080767 5:51911149-51911171 TTTCCTTCATTTTATGGATGAGG + Intergenic
990597822 5:57329098-57329120 TTTCCTCCATTTTGGAGTTAAGG + Intergenic
990773847 5:59283075-59283097 CTATCTCCATTTTATAGCTGAGG - Intronic
990990549 5:61679221-61679243 TTTGCTCCATGTTGGAGCTCAGG - Intronic
991218396 5:64183216-64183238 TTAACTCCATTTTATAGATGAGG - Intronic
991247124 5:64520386-64520408 TTTCCTCCTCTTAGTAGCTGAGG - Intronic
991621084 5:68545883-68545905 TGTCTTCCATTTTGGAACTGAGG - Intergenic
992321001 5:75612850-75612872 ATTCCTCCATTTTACAGATGAGG - Intronic
993132183 5:83912799-83912821 TTACCTCCATTTTGCAGATAAGG + Intergenic
993326913 5:86551415-86551437 ATTCCTCAATTTTGTAGTTGTGG - Intergenic
993496177 5:88611605-88611627 TTTCCTCCATCTTCTGGCTAGGG - Intergenic
993858365 5:93103356-93103378 TTATCTCCATTTTATAGATGAGG - Intergenic
994100500 5:95886264-95886286 TTTCATCCCTTTTGAAGATGAGG - Exonic
994121240 5:96115475-96115497 TTACCTCCATTTTATAGATGGGG + Intergenic
994255086 5:97583356-97583378 TTTTATACATTTTATAGCTGTGG - Intergenic
994998012 5:107089491-107089513 TTTCCTCTATTTTACAGATGAGG + Intergenic
994998582 5:107098106-107098128 TTACTTCCATTTTGTAGTGGAGG + Intergenic
995054077 5:107739951-107739973 TTTCTTCCATTTTGTAGATAAGG - Intergenic
995314669 5:110754867-110754889 TTTTCTCCATTTCATAGATGAGG - Intronic
995716284 5:115084518-115084540 TTTCCTTCTTTTTCTATCTGTGG - Intergenic
995733854 5:115276272-115276294 TTATCTCCATTTTAGAGCTGAGG + Intronic
995758300 5:115536408-115536430 CTTCCTCAACTTTGTAGCTGGGG + Intronic
996033762 5:118735136-118735158 TTACCTTCATTTTGTAGATGGGG + Intergenic
997592497 5:135084202-135084224 TTTCCAACATTTTGTTGCTATGG + Intronic
997621764 5:135303726-135303748 TTTTCTCCATGTTTTACCTGTGG + Intronic
997650328 5:135512807-135512829 TATCCTCCATTTTATGGATGAGG + Intergenic
998454682 5:142262381-142262403 TTCACTCCATTTTGCAGATGAGG + Intergenic
998457128 5:142281905-142281927 TTATATCCATTTTGTAGTTGAGG + Intergenic
998636049 5:143955830-143955852 TTGCCTCCATTTTGAAGATGAGG - Intergenic
998878507 5:146624121-146624143 TCTCTTCCTTTTTGCAGCTGAGG - Intronic
999245718 5:150153536-150153558 TTACCTACTTTTTGTAGATGAGG - Intronic
999246314 5:150156735-150156757 TTTGCCCCATTTTATAGATGGGG + Intergenic
999395523 5:151224441-151224463 CTTCCTCCATTTTACAGGTGAGG + Intronic
999407415 5:151319059-151319081 TCATCTCCATTTTGCAGCTGAGG - Intronic
999439750 5:151591992-151592014 TTACCTCCATTTAATAGATGGGG - Intergenic
999512402 5:152266452-152266474 ATTCCTCCATTTTTTATGTGAGG + Intergenic
1000099274 5:157999289-157999311 TTTCCTCCATTTAGTTACTACGG - Intergenic
1000183612 5:158837477-158837499 TTTCCTCCATTTTACAGTTGAGG + Intronic
1000300084 5:159948937-159948959 TTATCTCCATTTTATAGATGAGG + Intronic
1000455967 5:161449252-161449274 TTATGTCCATTTTATAGCTGAGG - Intronic
1001086666 5:168704981-168705003 CCTCCTCCATTTTACAGCTGAGG + Intronic
1001200118 5:169708392-169708414 TTTCCTTCATTTTATAGTTGAGG + Intronic
1001438608 5:171720375-171720397 TCTCCTTCATTTTGTAGGTCAGG + Intergenic
1001582405 5:172807764-172807786 ATTCTTCCATTTTATAGATGAGG - Intergenic
1001659728 5:173382367-173382389 TTTCCTCCATTTTATGGATAAGG - Intergenic
1001788995 5:174438504-174438526 TTTCCTTCATTTCGAAGTTGGGG - Intergenic
1002109016 5:176895434-176895456 TTTCCTCCATTTTACTGATGAGG + Intronic
1003436571 6:6094474-6094496 TTTGCTCCTTTTTATTGCTGAGG + Intergenic
1003442002 6:6151566-6151588 TTATCTCCCTTCTGTAGCTGAGG - Intronic
1004172355 6:13305445-13305467 TTTCCCCCATTTTAGAGATGGGG - Intronic
1004314443 6:14573626-14573648 TTACCTCCATTTCATAGGTGAGG + Intergenic
1004399157 6:15272564-15272586 TTTCCCCCAAATTGCAGCTGTGG + Intronic
1004443947 6:15680528-15680550 TTACCTCCATTTTACAGGTGAGG - Intergenic
1005030234 6:21501403-21501425 TTGATTCCATTTTGGAGCTGAGG - Intergenic
1005507720 6:26484308-26484330 CTTCCTCCTTTCTGTAGCTCAGG - Intergenic
1006241585 6:32684595-32684617 TTTCCTCTAATTTGTTCCTGAGG - Intergenic
1006304461 6:33210932-33210954 TTACCTCTATTTTATGGCTGAGG - Intronic
1006477714 6:34268590-34268612 TTAGCTCCATTTTGAAGCTAGGG + Intergenic
1006596714 6:35198810-35198832 TCTCCTGCATGTTTTAGCTGTGG + Intergenic
1006662310 6:35657755-35657777 CTTCCTCCATTTTGTACTTAGGG + Intronic
1006683316 6:35812723-35812745 TTATGTCCATTTTGTAGATGAGG + Intronic
1006707518 6:36033946-36033968 TTAACTCCATTTTATAGATGGGG + Intronic
1007093698 6:39200463-39200485 TTTTTTCCATTTTGCAACTGAGG + Intronic
1007850513 6:44798446-44798468 TCACCTCCATTTTATAGATGAGG + Intergenic
1008458142 6:51736029-51736051 TTGCCTCCATTTTATAGGTGTGG - Intronic
1008662563 6:53683147-53683169 TTTCCTTCATTTTACAGTTGAGG + Intergenic
1009499011 6:64387524-64387546 TTTCATCCATTCTTTAACTGAGG + Intronic
1009598264 6:65764159-65764181 TTTCCTCCATTTTCCAGATCTGG - Intergenic
1009779105 6:68246052-68246074 TTATCTCCATTTTATAGCTGAGG - Intergenic
1009870653 6:69449354-69449376 TTTGCCCCATTTTATAGGTGTGG - Intergenic
1010603061 6:77854835-77854857 TTTCCTCTGTTTTATAGATGAGG + Intronic
1011264768 6:85504068-85504090 TTTCTTCTATTTTATAGGTGAGG - Intergenic
1011538542 6:88404884-88404906 TTTCTTCCTTTTTGTAGTGGTGG - Intergenic
1012107951 6:95189841-95189863 TTTCAACCATTATGTAGCTATGG - Intergenic
1012289006 6:97427812-97427834 TTATCTCCAGTTTATAGCTGAGG + Intergenic
1012334258 6:98034930-98034952 TTTCCCCCATTTTGCAGATGAGG + Intergenic
1012986063 6:105877682-105877704 TTTCCTCCAATTTGTAGCATTGG - Intergenic
1013562500 6:111319701-111319723 TTTCCTTCATTTTGATGATGAGG + Intronic
1013639474 6:112059222-112059244 TATACTCCATTTTGTAAATGAGG - Intronic
1013752809 6:113426665-113426687 TTATCTCCATTTTGCAGATGTGG + Intergenic
1013867706 6:114719016-114719038 ATTCCTCCATTTTGTGGTTCTGG - Intergenic
1014198021 6:118580781-118580803 TTTCCTTCCTTTTCTATCTGTGG + Intronic
1014264437 6:119259768-119259790 GTTTTTCCATTTTGTAGATGAGG - Intronic
1014845100 6:126266099-126266121 ATTCCTTTATTTTGTAGATGGGG + Intergenic
1014947180 6:127513255-127513277 TTACTTCTATTTTGTAGATGAGG + Intronic
1015132775 6:129832692-129832714 TTTCCCCCATTTTGTAGAGAAGG + Intronic
1015307139 6:131722391-131722413 TTACTTACATTTTGTAGGTGAGG - Exonic
1015408371 6:132863163-132863185 TTATCTCCACTTTGTGGCTGAGG + Intergenic
1015508466 6:134013519-134013541 TTTTCTTTATTTTGTATCTGTGG + Intronic
1015580932 6:134724248-134724270 TTATCTCCATTTTATAGGTGAGG + Intergenic
1015750588 6:136554513-136554535 TTTCCTCCATTTCACAGATGAGG + Intergenic
1015756311 6:136610023-136610045 GTACCTCCATTTTGTAGATGAGG - Intronic
1016462129 6:144287949-144287971 TTCCCTCCATTTTATAGGTGTGG + Intronic
1016740354 6:147521593-147521615 TTACATCCATTTTATAGATGAGG - Intronic
1016939732 6:149474211-149474233 TTCCCTTCATCCTGTAGCTGGGG - Intronic
1017030981 6:150221715-150221737 TTACCTCCATTTTATAGAGGAGG - Intronic
1017440644 6:154461588-154461610 TCCTCTCCATTTTGTAGATGAGG - Intronic
1017464021 6:154678012-154678034 TTGCCTCCATTTTATGGATGAGG - Intergenic
1017491097 6:154945611-154945633 TTACCTCCATTTTATAGATGAGG - Intronic
1017881063 6:158562887-158562909 TTTTCCCCATTTTGCAGATGAGG + Intronic
1018727006 6:166620797-166620819 TTACCCCTATTTTGTAGCTGGGG + Intronic
1021397668 7:20170207-20170229 TTACCCTCATTTTGTAGATGAGG - Intronic
1021524187 7:21568400-21568422 TTTCCCTCATTTTGCAGCTAAGG + Intronic
1021612189 7:22468322-22468344 TTACCTCCATTTTATAGATTAGG + Intronic
1021880739 7:25093270-25093292 TTTCCTTCATTTTGTCATTGTGG + Intergenic
1021974902 7:26002318-26002340 TTTCCTCCATTTTATGGATGAGG + Intergenic
1022412632 7:30150896-30150918 TTGCCCCCATTTTAAAGCTGGGG - Intronic
1022593948 7:31693540-31693562 TTTTCTCCATGTTGAAGATGAGG - Intronic
1023088344 7:36594741-36594763 TTTTCTCCATTTTGCAGTTTAGG + Intronic
1023101922 7:36726611-36726633 TCACCTCCCTTTTCTAGCTGAGG - Intergenic
1023185431 7:37528369-37528391 ATTTATCCATTTTATAGCTGAGG - Intergenic
1023389546 7:39696012-39696034 TTGGCTCCATTTTATAGATGAGG + Intronic
1023974457 7:45017737-45017759 TTCCCTCCCTTTTGTAGTTCAGG - Intronic
1024049918 7:45612316-45612338 TCACCTCCATTTTATAGATGAGG + Intronic
1025117421 7:56270108-56270130 TTTACTCCATGTAGTAGCTCAGG + Intergenic
1025482803 7:61005272-61005294 TTTGCACCAGTTTCTAGCTGAGG - Intergenic
1025562929 7:62393107-62393129 TTTGCACCAGTTTCTAGCTGAGG - Intergenic
1026195284 7:68167842-68167864 TTTCCTCAATTTGGAGGCTGAGG + Intergenic
1026201368 7:68217315-68217337 TTTACTCCATGTAGTAGCTCAGG + Intergenic
1026319525 7:69256751-69256773 TTTCCTCCTTCCTGTAGCTGTGG - Intergenic
1026745772 7:73010680-73010702 TTACCTCCATTTTACAGTTGAGG + Intergenic
1026749425 7:73038621-73038643 TTACCTCCATTTTACAGTTGAGG + Intergenic
1026753073 7:73066767-73066789 TTACCTCCATTTTACAGTTGAGG + Intergenic
1026756724 7:73094893-73094915 TTACCTCCATTTTACAGTTGAGG + Intergenic
1027031879 7:74895352-74895374 TTACCTCCATTTTACAGTTGAGG + Intergenic
1027090682 7:75298535-75298557 TTACCTCCATTTTACAGTTGAGG - Intergenic
1027094327 7:75326505-75326527 TTACCTCCATTTTACAGTTGAGG - Intergenic
1027097970 7:75354430-75354452 TTACCTCCATTTTACAGTTGAGG - Intergenic
1027254076 7:76419047-76419069 TTTGCTCCATTTTACAGCTGAGG - Intronic
1027321378 7:77013117-77013139 TTACCTCCATTTTACAGTTGAGG + Intergenic
1027325011 7:77041181-77041203 TTACCTCCATTTTACAGTTGAGG + Intergenic
1027582159 7:80011413-80011435 TGTCCTTCATTTTGTTTCTGTGG + Intergenic
1027847661 7:83403284-83403306 TTTTTTCCATTTTTTAGCGGGGG + Intronic
1027896013 7:84046050-84046072 TTTCCTCCCTTCCGTAGCTCCGG + Intronic
1028858746 7:95622701-95622723 TTACCTTCATTTTTGAGCTGAGG - Intergenic
1029399077 7:100331318-100331340 TTACCTCCATTTTACAGTTGAGG - Intergenic
1029725513 7:102401137-102401159 TTTTCCCCATTTTATAGATGAGG + Intronic
1029819246 7:103129774-103129796 TTCTCTCCATTTTATAGGTGAGG - Intronic
1029969047 7:104771346-104771368 TTACCTCCATTTTGTAGGCAAGG + Intronic
1031057513 7:117009804-117009826 TTACCTCCTTTTTCCAGCTGTGG + Intronic
1031097276 7:117435297-117435319 TTATCTCCATTTTATAGATGAGG + Intergenic
1031124220 7:117755569-117755591 TTTCATCCATTTTACAGATGGGG - Intronic
1031223769 7:119007998-119008020 TTTCCTACCTTTATTAGCTGGGG + Intergenic
1031600845 7:123707267-123707289 TTTCCTCAATTTTATAGATGTGG + Intronic
1031994700 7:128222248-128222270 TTGCCTCCATTTTACAGATGAGG - Intergenic
1032060431 7:128719620-128719642 TTTCATCCATATTGTAGCATGGG + Intronic
1032305692 7:130731540-130731562 TTTCCCCTATTTTGCAGATGAGG - Exonic
1033102130 7:138483087-138483109 TTTCCTCATTTTTGTAGCGGGGG + Intronic
1033242658 7:139693184-139693206 TTTTTTCCATTCTGTAGATGAGG - Intronic
1033662895 7:143414916-143414938 TTTCCCCCATTTTGCAGATGAGG - Intergenic
1034690620 7:153010754-153010776 TTTCTTCCATTTTATTACTGGGG + Intergenic
1034830054 7:154301113-154301135 TTTCCCCCATTTTACAGGTGAGG - Intronic
1035981056 8:4372721-4372743 TTGCCTCCATTTTCTAGGTTTGG - Intronic
1036497788 8:9285227-9285249 TTATCTCCATTTTTTAGATGAGG + Intergenic
1036734564 8:11299439-11299461 TTTCCCCCATTTTACAGTTGAGG + Intronic
1036784067 8:11673949-11673971 CTTCATCCATGTTGTAGCAGGGG - Intergenic
1037259881 8:16996427-16996449 TTTCATCCATTTTGCATATGAGG - Intronic
1037757109 8:21718039-21718061 TTACCTCCATTTTGCAGATGAGG - Intronic
1037835156 8:22211287-22211309 TTTGCTCCTGTTTGTGGCTGAGG + Intronic
1038368888 8:26967917-26967939 TTATCTCCATTTTATAGATGAGG - Intergenic
1038589639 8:28824843-28824865 TTCTCTCCATTTTATAGATGAGG - Intronic
1038799349 8:30735105-30735127 TTGTCTCCATTTTATAGATGTGG + Intronic
1038995710 8:32920741-32920763 TTAGCTCCATCTTGTAGCTGGGG + Intergenic
1039032393 8:33324567-33324589 CTACCTCCATTTTACAGCTGGGG - Intergenic
1039451548 8:37678704-37678726 TTTGTCCCATTTTGTAGATGAGG - Intergenic
1039557913 8:38489954-38489976 TTCCCTCCATTTTACAGATGTGG - Intergenic
1039614978 8:38948355-38948377 TTTTCTCCACTTTATAGATGAGG - Intronic
1040114987 8:43606808-43606830 TTTCTTCCAGTTTTTATCTGTGG - Intergenic
1040496294 8:47968471-47968493 TTAACTCCACTTTGTAGGTGAGG - Intronic
1040788782 8:51200105-51200127 TTTCCTTCATTTTGTTAATGTGG + Intergenic
1041017146 8:53602053-53602075 TTGCCTCTATTTTGCAGATGAGG + Intergenic
1041367867 8:57128307-57128329 CTAGCTCCATTTTGCAGCTGAGG - Intergenic
1041677826 8:60553643-60553665 TTTCCTCCATTTTATAGATAAGG + Intronic
1041709973 8:60885616-60885638 TTACCTCCATTTTACAGCTATGG + Intergenic
1041876990 8:62700408-62700430 ATTTCTCCATTTTTTAGCTAAGG - Intronic
1042410036 8:68454771-68454793 TTTCATCCTTTTGGTAGCTTGGG + Intronic
1042734128 8:71968872-71968894 TTTCTTTCATTTTGCAACTGGGG - Intronic
1043301356 8:78737917-78737939 TTTTCTGCATTTTGTAGATAAGG + Intronic
1043394516 8:79823831-79823853 TTTCCCCCATTTTTCAGATGAGG - Intergenic
1043467234 8:80523113-80523135 TTGTCTCCATTTTATAGATGAGG + Exonic
1045341693 8:101260640-101260662 TTATCACCATTTTGTAGATGAGG - Intergenic
1045396977 8:101771012-101771034 TTTCCTTGCTATTGTAGCTGTGG + Intronic
1045476809 8:102560109-102560131 TTATCTCCATTTTGCAGATGAGG + Intronic
1046341810 8:112868742-112868764 TTTCCCCCATTTTGTATTTTTGG - Intronic
1046504783 8:115123555-115123577 TTACCTCCATTTTTCAGATGAGG + Intergenic
1046556651 8:115781629-115781651 TTATATCCATTTTGTAGATGAGG + Intronic
1046783450 8:118240526-118240548 TTACCTCCATTTTGCAGATGAGG - Intronic
1046998049 8:120545953-120545975 CTTTCTCCTTTTTGTAGATGAGG + Intronic
1047162581 8:122397203-122397225 GTTCCTCTTTTTTGTTGCTGTGG + Intergenic
1047180296 8:122581328-122581350 TTTCCTGCTTTTTTTAGCTGTGG + Intergenic
1047200168 8:122758609-122758631 TTATCTCCATTTTATAGATGAGG + Intergenic
1047314341 8:123718539-123718561 TTGCTTCCATTTTGGACCTGAGG - Intronic
1047497317 8:125417629-125417651 TTATCTCCATTTTCCAGCTGAGG - Intergenic
1047503374 8:125459642-125459664 TATCCTCCATTTTACAGATGAGG + Intergenic
1047528890 8:125657455-125657477 TTGCCCCCATTTTATAGATGAGG - Intergenic
1047643027 8:126840924-126840946 TTACATCCATTTTACAGCTGAGG + Intergenic
1047691544 8:127359947-127359969 TTACCTCCATTTTGCAGATAAGG + Intergenic
1047993368 8:130310103-130310125 TTAGCCCCATTTTGTAGATGAGG - Intronic
1048028391 8:130607893-130607915 TTTCTTCCACTTTGTAGATGAGG - Intergenic
1048066940 8:130979693-130979715 TTACCTCCATTTTATAGATGAGG - Intronic
1048216819 8:132503216-132503238 GTTTTTCCATTTTGCAGCTGGGG - Intergenic
1048233936 8:132672589-132672611 TCACCTCCATTTTGCAGATGAGG - Intronic
1048769559 8:137881368-137881390 TTATCTCCATTTAGTAGATGAGG + Intergenic
1048935670 8:139354555-139354577 CTTCCTATATTTTGTAGCTCTGG - Intergenic
1049082149 8:140451800-140451822 TCACCACTATTTTGTAGCTGAGG - Intronic
1049127145 8:140801539-140801561 TTAACCCCATTCTGTAGCTGAGG - Intronic
1049627704 8:143633414-143633436 TTATCTCCATTTTATAGATGAGG - Intergenic
1050026410 9:1338964-1338986 TTTCTCCCATGTTGTAGGTGAGG + Intergenic
1050188450 9:2999640-2999662 TTTTCTCCATTTTGTAGATAAGG + Intergenic
1050230173 9:3515639-3515661 TTTCCTCCATGTTTTAGTTGTGG - Intronic
1050596754 9:7211811-7211833 ATTCCTCCATTTTCCAGATGGGG + Intergenic
1050620676 9:7449113-7449135 TTTCCTTCATTTTAAATCTGTGG - Intergenic
1050649675 9:7762328-7762350 TTACCTCCAATTGGTAGATGGGG + Intergenic
1050788796 9:9439836-9439858 TTTATCCCATTTTGTAGATGAGG + Intronic
1050824062 9:9921864-9921886 TTACCTCCATTTTATAAATGAGG + Intronic
1050933412 9:11360922-11360944 GTTCCTCCATTCTGTAAATGTGG + Intergenic
1051111385 9:13641208-13641230 TATCCTTCATTTTGTTGATGTGG - Intergenic
1051225831 9:14898207-14898229 TTGTCTTCATTTTGTAGATGAGG - Intronic
1051422633 9:16903832-16903854 TTTCCTCTATATGGTAACTGTGG - Intergenic
1051794806 9:20854425-20854447 TTATTTCCATTTTGCAGCTGGGG + Intronic
1051975238 9:22941045-22941067 TTTCCTGCATTATTTTGCTGAGG + Intergenic
1052256309 9:26460860-26460882 TTATCACCATTTTGTAGATGAGG - Intergenic
1052490466 9:29160340-29160362 GTTCCACCATTTACTAGCTGTGG + Intergenic
1052683840 9:31729394-31729416 TTTCCCCCATTATGTGGCTTTGG + Intergenic
1054845878 9:69797602-69797624 TTTTCTCCATTGTCTAGATGAGG + Intergenic
1054952319 9:70866476-70866498 TTGTCTCCATTTTATAGATGAGG - Intronic
1055484920 9:76747467-76747489 TTTCCTTAATTTTGTAAGTGAGG + Intronic
1055634268 9:78259695-78259717 TTATCTCCATTTTATAGATGAGG + Intronic
1055831882 9:80389269-80389291 GTTACTCCATTTTGTTTCTGTGG - Intergenic
1056249708 9:84735017-84735039 TTTCTTCTTTTTTGTAGCTATGG + Intronic
1056807643 9:89741212-89741234 TTTCATCCATGTTGTAGCATGGG - Intergenic
1057306436 9:93914962-93914984 TGTCCATCATTTTGTAGCTATGG + Intergenic
1057824099 9:98359001-98359023 TTGCCCCCATTTTATAGATGAGG - Intronic
1057894826 9:98900740-98900762 TTATCCCCATTTTATAGCTGGGG + Intergenic
1058082415 9:100713923-100713945 TTTTCTCCATTGTCTAGATGAGG - Intergenic
1058477410 9:105351826-105351848 TTGCCCCCAATTTGTAGATGAGG + Intronic
1058721749 9:107770406-107770428 TTTTCTCCATTTTATAGGTGAGG - Intergenic
1058898890 9:109424299-109424321 TTACCTCCATTTTACAGATGAGG - Intronic
1059048684 9:110898707-110898729 TCTCCTTCATTTTGTAGATGAGG - Intronic
1059065863 9:111082966-111082988 TTGGCTCCATTTTATAGTTGAGG - Intergenic
1059413024 9:114145543-114145565 TTCCCCCAATTTTGTAGGTGAGG + Intergenic
1059649227 9:116299646-116299668 TTTTCGTCATTCTGTAGCTGTGG + Intronic
1059787915 9:117606779-117606801 TTACCTCCATGTTACAGCTGAGG + Intergenic
1060069182 9:120531496-120531518 TCACCCCTATTTTGTAGCTGAGG - Intronic
1060158592 9:121338531-121338553 TTATCACCATTTTGTAGATGAGG - Intergenic
1060803730 9:126562053-126562075 TTTTCTCCGTTTTTCAGCTGAGG + Intergenic
1061054897 9:128217305-128217327 TTACCCCCATTTTGCAGATGAGG - Intronic
1061744328 9:132728468-132728490 TTAGCCCCATTTTGTAGTTGGGG - Intronic
1061799192 9:133104935-133104957 ATTCCTCCATTTTCTAGATGAGG + Intronic
1061883558 9:133579672-133579694 TTATCTCCATTTTGCAGGTGGGG + Intronic
1062375794 9:136261348-136261370 TTTTCTCTATTTTCTAGCTGTGG + Intergenic
1062382985 9:136296525-136296547 TTGCTCCCATTTTGTAGATGAGG - Intronic
1186067846 X:5785628-5785650 TTTTCCCTATTTTATAGCTGAGG - Intergenic
1186156074 X:6728197-6728219 TTTCCTCCATGTTGTTCTTGTGG - Intergenic
1186859201 X:13654665-13654687 TTTCTCCCATTTTGTAGATGAGG + Intronic
1186908885 X:14140316-14140338 GTACCTCCAGTTTGTAGCTGGGG + Intergenic
1187008199 X:15252511-15252533 ATTTCTCCATTTTATAGCTGAGG - Intronic
1187735402 X:22298145-22298167 TTATCTTCATTTTGTAGATGGGG - Intergenic
1188303193 X:28530503-28530525 ATTGTTCCATTTTGTAGATGAGG - Intergenic
1188358231 X:29219640-29219662 TTTCCTCCAAATTGCTGCTGGGG + Intronic
1188393605 X:29652741-29652763 TTTACTCCCTTATGTATCTGTGG - Intronic
1188405544 X:29804481-29804503 TTTCCTCCATTCTGTTTTTGTGG + Intronic
1188432055 X:30115066-30115088 TTTTCTCCAGTTTATAGTTGAGG + Intergenic
1189659951 X:43286217-43286239 TCTCCTCCATACTGTGGCTGTGG + Intergenic
1189959780 X:46313278-46313300 TTATCTCCATTTTGCAGATGAGG - Intergenic
1190246271 X:48692567-48692589 TTACCTCCATTGTATAGATGCGG - Intergenic
1190323586 X:49192964-49192986 TTTCCTTCATTTTGCACATGAGG + Intronic
1190329210 X:49225474-49225496 TCATCTCCATTTTGTAGATGTGG + Intronic
1190357444 X:49618794-49618816 TTTCCTCCATTTTACAAATGAGG - Intergenic
1190456464 X:50632782-50632804 ATTCCTCCATTTTAGAGATGAGG + Intronic
1190689796 X:52903997-52904019 TTTCCCCCATTTTCTAGTTGGGG + Intronic
1190696187 X:52951795-52951817 TTTCCCCCATTTTCTAGTTGGGG - Intronic
1190877000 X:54467131-54467153 TTCCCCCCATTTTATAGATGAGG + Intronic
1191577608 X:62723720-62723742 TTCCCTCCAGTTTTTACCTGGGG + Intergenic
1191691532 X:63944254-63944276 TTATCTCCATTTTGCAACTGAGG + Intergenic
1191864584 X:65693746-65693768 TATCCTCCATTTTAAAGATGGGG - Intronic
1192116931 X:68420384-68420406 TTACCTCCAATTTATAGATGAGG - Intronic
1192231589 X:69269118-69269140 TTGCCTTCATTTTATAGATGGGG + Intergenic
1192234586 X:69287566-69287588 TTACCCCCATTTTGCAGATGAGG - Intergenic
1193471416 X:81908550-81908572 TTTTTTCCATTTTGGAGATGAGG + Intergenic
1193603478 X:83537580-83537602 TTTCCTTCATCTTACAGCTGAGG - Intergenic
1193794210 X:85853224-85853246 TATCCTCCATTTTATAGATGAGG - Intergenic
1193964959 X:87973839-87973861 TTATCTCCATTTTATAGATGAGG + Intergenic
1194044040 X:88979728-88979750 TTAGCTCCATTTTATAGATGAGG - Intergenic
1194060242 X:89187663-89187685 TATCTTCCATTTAGTATCTGTGG - Intergenic
1194645921 X:96458097-96458119 TTTTCTCCATTTTATAGGTGAGG - Intergenic
1194771272 X:97908799-97908821 TTATCTCCATTTTACAGCTGAGG + Intergenic
1195039244 X:100999153-100999175 GTTCCTCCATTGTGTGGCTCTGG + Intergenic
1195745947 X:108118470-108118492 TTACCTCCATTTTAGAGTTGAGG - Intronic
1195822797 X:108965227-108965249 TGTTATCCATTTGGTAGCTGAGG + Intergenic
1196045231 X:111249808-111249830 TTTCCTTCATTTTAGAGATGGGG - Intronic
1196116117 X:112001334-112001356 TTACCTCCATTTCTCAGCTGAGG - Intronic
1196393674 X:115236117-115236139 ATTCTTCCATTTTATAGATGAGG + Intergenic
1196406731 X:115370719-115370741 TTATTTCCATTTTGTAGGTGAGG + Intergenic
1196598737 X:117576043-117576065 TTATTTCCATTTTATAGCTGAGG + Intergenic
1196673504 X:118394384-118394406 TTTCCTCCATTTTATTGATGGGG - Intronic
1196753371 X:119137215-119137237 TCTCTCCCATTTTGTAGATGAGG + Intronic
1196871632 X:120117906-120117928 TTATCTCCATTTTATAGGTGAGG - Intergenic
1196934364 X:120714937-120714959 TTACCGCCATTTTATACCTGAGG - Intergenic
1197021820 X:121699400-121699422 TTTCCTTCATTTTGTTAATGTGG + Intergenic
1197206532 X:123795620-123795642 TTTCTTCAATATTGTAGCTGAGG - Intergenic
1197288433 X:124624938-124624960 CTACCTTCATTTTGTAGATGAGG - Intronic
1198156790 X:133968509-133968531 TTTCCCCCATTTTACAGATGAGG - Intronic
1198160340 X:134001785-134001807 TTTTCTCCATTTTACAGATGAGG - Intergenic
1198524332 X:137485287-137485309 TTATCTCCACTTTATAGCTGAGG - Intergenic
1198561717 X:137857521-137857543 TTTCCTCCATTTTACAGGTGAGG + Intergenic
1198633378 X:138668219-138668241 TTACCTCCATTTTATAGATGAGG + Intronic
1198686833 X:139236369-139236391 TTAGCTCCATTTTATAGATGAGG + Intergenic
1198793977 X:140376248-140376270 TTTCCCCCAATTTGGAGCTTAGG + Intergenic
1199573937 X:149294798-149294820 TTAACACCATTTTATAGCTGGGG + Intergenic
1199753862 X:150846456-150846478 TTATCTCCATTTTATAGATGAGG - Intronic
1199949536 X:152696900-152696922 TCTCCTCCATTTTGTATGTAAGG - Intergenic
1199954356 X:152731754-152731776 TCTCCTCCATTTTGTATGTAAGG - Intronic
1199960140 X:152771550-152771572 TCTCCTCCATTTTGTATGTAAGG + Intergenic