ID: 1077626314

View in Genome Browser
Species Human (GRCh38)
Location 11:3774921-3774943
Sequence CAGAAAATGAAGAATTTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 589
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 545}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077626314_1077626316 23 Left 1077626314 11:3774921-3774943 CCTGACAAATTCTTCATTTTCTG 0: 1
1: 0
2: 1
3: 42
4: 545
Right 1077626316 11:3774967-3774989 TTCTGCCAAAGATTTCCATTAGG 0: 1
1: 0
2: 1
3: 23
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077626314 Original CRISPR CAGAAAATGAAGAATTTGTC AGG (reversed) Intronic
900218007 1:1492022-1492044 CAAAAAATGAAAAAATTGGCCGG + Intronic
901367792 1:8768651-8768673 AAGAAAATGAAGAAATTTACAGG + Intronic
901615581 1:10536822-10536844 CAGACAATATTGAATTTGTCAGG - Intronic
903386030 1:22927275-22927297 CAGAAAATAATGAATTAGGCTGG - Intergenic
903460932 1:23520580-23520602 CAAAAAATAAAGAATTAGCCAGG + Intronic
903635706 1:24813713-24813735 AAGAAAATAAATAAATTGTCCGG - Intronic
903903571 1:26666737-26666759 TAGAAAATGAATTATTTGGCTGG - Intergenic
903979695 1:27176901-27176923 AAGAAGATGAAGAAGTTTTCAGG + Intergenic
904095666 1:27975340-27975362 CAAAAAATAAAGAATTAGCCAGG - Intronic
904547989 1:31291682-31291704 TAAAAAAAGAAAAATTTGTCTGG + Intronic
904640372 1:31922781-31922803 CAGAAAATCAAAAATTAGCCTGG - Intronic
905822454 1:41004184-41004206 CTGAAAATCTAGTATTTGTCGGG - Intronic
906379486 1:45323360-45323382 CAGAAAAAGAAAAATTAGCCAGG - Intergenic
906392609 1:45431943-45431965 CAGAAAATAAAAAATTTTTAGGG + Intronic
907062677 1:51446812-51446834 CAGAATCTGAAGAATTCTTCTGG - Intronic
907247245 1:53116032-53116054 CAGATAAAGAAGTATTTGTCTGG + Intronic
907748587 1:57239782-57239804 CAGAAAAGAGAGAATTTATCTGG - Intronic
910309262 1:85805000-85805022 CAGAAAATTTAAAAATTGTCTGG - Intronic
910365672 1:86462348-86462370 CAAAAAATCAAAAATTTATCGGG + Intergenic
910826489 1:91413681-91413703 AAGGAAATGAAGAATTTGGCGGG - Intergenic
911378880 1:97087446-97087468 CAGAAAATGAAGTATTAGATTGG + Intronic
911395381 1:97300546-97300568 CAGCAACTGAAGATTTTGGCAGG - Intronic
912018490 1:105072569-105072591 CAGAAAGTAAGGACTTTGTCTGG - Intergenic
914232493 1:145776323-145776345 CTGAAAATAAAAAATTAGTCGGG - Intronic
914694589 1:150065367-150065389 CAAAAAATGCAGTATTGGTCAGG - Intergenic
915125032 1:153657972-153657994 CAGAAAATGAAAAATTAGTCAGG + Intergenic
915150716 1:153829042-153829064 AAAAAAATTAAAAATTTGTCAGG + Intronic
915169650 1:153968854-153968876 CTGAAAATGAAGCATAAGTCAGG + Intronic
915423511 1:155804620-155804642 CAAAAAATAAAAAATTAGTCGGG + Intronic
916354079 1:163884711-163884733 CACAAAATGAAGTGTTTCTCAGG + Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916632248 1:166628951-166628973 GAGAAAATTCAGAGTTTGTCAGG - Intergenic
917591158 1:176478498-176478520 AAGAACATGAAGTATTTGGCAGG + Intronic
918032498 1:180829033-180829055 CAAAAAATGAAAAATTAGTGGGG + Intronic
918078459 1:181188365-181188387 CAAAAAATAAAAAATTTGCCTGG + Intergenic
918648212 1:186926539-186926561 CAGAAAGTGAAGACTTTGATAGG - Intronic
919590631 1:199497779-199497801 CAGAAAAAGAAGAACTAGGCCGG + Intergenic
919736096 1:200952101-200952123 TAGAAAATTAAGACTTCGTCTGG - Intergenic
920003473 1:202815313-202815335 CTAAAAATGAAAAATTAGTCAGG - Intergenic
920573735 1:207039780-207039802 AAGATAGTGAAGAATTTGGCAGG + Intronic
920697655 1:208193724-208193746 CAAAATATAAAAAATTTGTCTGG + Intronic
920939488 1:210468166-210468188 CAGAAAATTATCAATTTCTCAGG - Intronic
921516512 1:216098859-216098881 GAGAATATGAAGGATTTGGCGGG + Intronic
922337295 1:224628115-224628137 GAGAAAATGAATAACTTGACAGG - Intronic
922494624 1:226046946-226046968 CTTAAAATGAAAGATTTGTCTGG - Intergenic
922630587 1:227105513-227105535 CAGAAAATTAAGAAATTAGCTGG - Intronic
922671892 1:227515645-227515667 AAGAAAATGAAGAAGTTAGCAGG - Intergenic
923592959 1:235336391-235336413 AAAAAAAAGAAGAACTTGTCTGG + Intronic
924168754 1:241314516-241314538 CAGAAACCAAAGAATTTGTGTGG + Intronic
1062846155 10:707391-707413 AAAATAATGAAGAATTTGTGTGG - Intergenic
1062886406 10:1019926-1019948 CAGAAAATGAACACTTTCTTTGG + Exonic
1063050461 10:2441754-2441776 CAGAAAATAAAAAATTTAGCTGG + Intergenic
1063465355 10:6239968-6239990 CTGACAATGAAGAATTTCTGAGG + Intergenic
1064090650 10:12380438-12380460 CATAAAAGGAAGGATTTGTTTGG - Intronic
1064716812 10:18184998-18185020 CAAAAAATGAAAAATTGGCCAGG - Intronic
1065201864 10:23320328-23320350 AGGAAAATGAAGCATGTGTCTGG + Intronic
1065714564 10:28553341-28553363 CAGAAAATGAATACTGTATCTGG - Intronic
1066556607 10:36621313-36621335 AAGAAAATGAATATTTTGTTAGG + Intergenic
1066988655 10:42491447-42491469 CAGAGAATGAATCATTTGACAGG - Intergenic
1067784294 10:49231875-49231897 CAAAACATGTAGAATTTGTTTGG + Intergenic
1068291392 10:55006071-55006093 CAAAAAATGATAAATTTGTGTGG - Intronic
1068902380 10:62282466-62282488 CAAAAGATGAAGAAATTGTTAGG - Intergenic
1069480533 10:68777768-68777790 CAGAAAATAAAAAATGTATCCGG + Intronic
1070058057 10:72954230-72954252 TAAACAACGAAGAATTTGTCAGG + Intronic
1070093777 10:73315725-73315747 CAAAAAATAAAAAAGTTGTCTGG - Intronic
1072176921 10:92934648-92934670 TAGAAAATGAAGAATTAAGCAGG + Intronic
1072983745 10:100121764-100121786 AAAAAAAAGGAGAATTTGTCAGG + Intergenic
1073128571 10:101169380-101169402 CAGAAAGTGTTGAATTTGACTGG - Intergenic
1073383987 10:103107377-103107399 TAGATATTGAAGAATTGGTCAGG + Intronic
1073920332 10:108451105-108451127 CAGAGAATGAAGCATTGGGCTGG - Intergenic
1074331735 10:112518843-112518865 CTGAAAATGGAGAATCTTTCAGG + Intronic
1075496360 10:122922758-122922780 CAGTAAGTGATGAATTTTTCTGG - Intergenic
1075639250 10:124052870-124052892 CTAAAAATAAAAAATTTGTCAGG + Intronic
1077626314 11:3774921-3774943 CAGAAAATGAAGAATTTGTCAGG - Intronic
1078362771 11:10682069-10682091 GAGAAAATGGAGACTTTGTGAGG - Intronic
1078974729 11:16460353-16460375 TAGAAAAGGAAGAATTAGTCTGG - Intronic
1079181566 11:18198240-18198262 CAAAAAATTAAAAATTAGTCAGG + Intronic
1079199258 11:18361096-18361118 CAGAAAATAAAGTATTGGCCGGG - Intronic
1080140305 11:28910428-28910450 AAAAAAATGAAGAATTTGGAGGG - Intergenic
1080486038 11:32707794-32707816 GAGACAATTAAGAATTTTTCTGG + Intronic
1081031698 11:38092425-38092447 CAAAAAATAAAAAATTAGTCAGG + Intergenic
1081554857 11:44149198-44149220 CAGAAAATGAAAAACTTAGCTGG + Intronic
1083206746 11:61154941-61154963 CAAAAAATAAAAAATTTGCCTGG + Intronic
1083316566 11:61818210-61818232 TATAAAATGAAGAATTTGGATGG - Intronic
1083461577 11:62816439-62816461 AAGAAAATGAAAAATTAGCCTGG - Intronic
1086353541 11:85968160-85968182 CAAAAAATTAAAAATTAGTCAGG + Intronic
1086522096 11:87680721-87680743 CAGAAAATGATGACATTGTTTGG + Intergenic
1086822431 11:91450463-91450485 CAGAAAATTAAGAGTTTTCCTGG + Intergenic
1087947937 11:104187162-104187184 ATGAAAATGAAGCACTTGTCTGG + Intergenic
1088070312 11:105775508-105775530 CAGAAAATTAAAATTTTTTCAGG - Intronic
1088245883 11:107817761-107817783 CAAAAAATAAACAATTTGCCAGG + Intronic
1089801160 11:121028977-121028999 TAGAAAATAAAGAATTGGTAGGG - Intronic
1090067122 11:123512554-123512576 CAAAAAATGAAAAATTAGCCAGG + Intergenic
1090223585 11:125053609-125053631 CAGAATTTGAAGAATATTTCAGG - Intergenic
1090361465 11:126175596-126175618 CAGGAAATGAAGACATTGCCAGG + Intergenic
1090558383 11:127901409-127901431 AAGACAATGAAGAACTGGTCAGG + Intergenic
1092197667 12:6559520-6559542 TAGAAATAGTAGAATTTGTCTGG - Intronic
1092815498 12:12309313-12309335 CAGAAAATAAAAAATTTGCCAGG + Intergenic
1093031221 12:14290778-14290800 CAAAAAATGAAAAATTAGCCAGG - Intergenic
1093119094 12:15246018-15246040 TAGAAAATGTAGAATGTATCTGG + Intronic
1093267397 12:17019768-17019790 CAGAGAATGAAGAAAGTATCAGG - Intergenic
1093866284 12:24230626-24230648 AAGAAAATGGACAATCTGTCAGG + Intergenic
1093999293 12:25677106-25677128 CAGAGGATGATGAGTTTGTCGGG + Intergenic
1094181018 12:27592754-27592776 AAGAAAATAAAGAATATGTTAGG + Intronic
1094249119 12:28339243-28339265 CAGTAAATGGAAAATTTTTCAGG - Intronic
1096135055 12:49193301-49193323 CAGAAAATGTAGAGTTTTTGAGG - Intronic
1096296225 12:50386569-50386591 CAGAAAAAGAACATTTTGGCCGG + Intronic
1096329513 12:50698212-50698234 GAGAAAATGGAGAATTTTTTTGG + Intronic
1097877729 12:64658907-64658929 CAGAAAATAAAAAATTAGCCAGG + Intronic
1098628002 12:72697080-72697102 CTGAAAATACAGAATTAGTCAGG - Intergenic
1099653605 12:85460683-85460705 CAGATACAGAAGAATTTGACAGG + Intergenic
1100207021 12:92361583-92361605 CTGAAATTGAATAATTTTTCTGG - Intergenic
1101368484 12:104100414-104100436 CAAAAAATAAAGAAGTTTTCTGG + Intronic
1101578957 12:106024568-106024590 AATAAAATGAAGAACCTGTCTGG + Intergenic
1101721788 12:107356710-107356732 GAGATAGTGCAGAATTTGTCTGG - Intronic
1102640571 12:114362824-114362846 CAAAAAATAAAAAATTAGTCTGG - Intronic
1103163493 12:118750571-118750593 GAGGGAAGGAAGAATTTGTCAGG - Intergenic
1104808136 12:131602580-131602602 AAGGAGATGAGGAATTTGTCGGG - Intergenic
1105777206 13:23674376-23674398 AAGAAAATGCACAATTTGTAGGG + Intronic
1106066458 13:26356560-26356582 CAGAAATTGAAGAATTTGAAAGG - Intronic
1106201302 13:27539429-27539451 CAAAAAATAAAAAATTTGCCAGG - Intergenic
1106268629 13:28132861-28132883 CAAAAAATAAAAAATTTGCCAGG + Intergenic
1106632452 13:31490192-31490214 AAGAAAAAGAAAAATCTGTCAGG - Intergenic
1106786188 13:33110108-33110130 CAGAAGCTGAAGAGGTTGTCTGG + Intronic
1107088957 13:36455281-36455303 CAGAACAAGAAGAAAATGTCAGG + Intergenic
1107505388 13:41028288-41028310 CAGATAAAGAAGAGTATGTCTGG + Intronic
1107596724 13:41971030-41971052 CATATAATCAATAATTTGTCTGG + Intergenic
1108333469 13:49414100-49414122 TAGAAAATGCAGAATTTGTTTGG - Intronic
1109237090 13:59836276-59836298 GAGAAAATTAAGAATATGCCAGG - Intronic
1109347696 13:61135733-61135755 CAGAAAATACAGAGTTTGTGGGG + Intergenic
1109870277 13:68323804-68323826 CAAAAGATGAGGAATTTGTTGGG - Intergenic
1110503538 13:76258199-76258221 CAGGCAATGCAGAATTTGTATGG - Intergenic
1110990151 13:82031166-82031188 AAAAAAATGAAGAAGTTGTATGG + Intergenic
1111217571 13:85163996-85164018 ATGAAAATGAAGAATTTCTTGGG - Intergenic
1111540381 13:89660624-89660646 CTATCAATGAAGAATTTGTCAGG - Intergenic
1112007622 13:95267622-95267644 CATATAATAAAGAATTTGGCTGG + Intronic
1112277496 13:98034842-98034864 CAAAAAATGAAAAAATTATCTGG - Intergenic
1112459095 13:99587420-99587442 TAGAAAACAAAGAAATTGTCTGG - Intergenic
1112481647 13:99781464-99781486 CAAAAAATAAAAAATTTGGCTGG - Intronic
1112763838 13:102719715-102719737 CAGAAAATAAAAAATTGGCCAGG + Intergenic
1113013211 13:105794515-105794537 CAAAAAGTTAAGAATTTGTTTGG - Intergenic
1113672806 13:112186317-112186339 GAGTGAATGAAGCATTTGTCAGG + Intergenic
1114010028 14:18356863-18356885 GAGAAAATGGAGATTATGTCAGG - Intergenic
1114149175 14:20015990-20016012 GAGAATATGAAGATTTTTTCAGG + Intergenic
1114723065 14:24903946-24903968 AAGAAAATGAAGATTTGGTCAGG - Intronic
1115831728 14:37350230-37350252 TAAAAATTAAAGAATTTGTCAGG - Intronic
1116286976 14:42986369-42986391 ATGAAGATGAAGAACTTGTCTGG - Intergenic
1116766864 14:49083229-49083251 CAGAAAATGGGGAAAATGTCTGG - Intergenic
1116882395 14:50184700-50184722 CAAAAAATGCAAAATTAGTCGGG + Intronic
1117046453 14:51817719-51817741 TAAAAAATAAAGAATTTGGCAGG + Intergenic
1117747785 14:58888820-58888842 CAGAGAATGAAGAGTTTGAAAGG - Intergenic
1118015343 14:61655005-61655027 CAGAAAAAGCAGCATTTGGCCGG + Intronic
1118385083 14:65249517-65249539 GAGAAAAGGAAGAGTTTGTCTGG - Intergenic
1118694439 14:68370747-68370769 TAAAAAATGAAGAATTGGCCGGG + Intronic
1118980842 14:70715542-70715564 AAGAAAAAGAAAAATTAGTCGGG + Intergenic
1119056946 14:71432233-71432255 CAAAAAATAAAAAATTAGTCAGG - Intronic
1119074283 14:71620472-71620494 CAGAAAAGGAAGAATATGATGGG - Intronic
1119098413 14:71855913-71855935 CAGAGAATGAAGAAATTGGAAGG - Intergenic
1119684688 14:76622303-76622325 CAAAAAATGAAAAATTAGCCAGG - Intergenic
1119861036 14:77936253-77936275 CAAATAATAAAGAATTTGCCTGG - Intergenic
1120764413 14:88315724-88315746 TAGAAAATGAAAATTTGGTCGGG - Intronic
1120808966 14:88782916-88782938 CAAAAAATACAGAATTAGTCAGG + Intronic
1121789403 14:96687566-96687588 CTGAAAGTGGAGAATTTTTCCGG + Intergenic
1124828276 15:33121825-33121847 CAGAAAAACAAAAATTTGGCCGG - Intronic
1124930335 15:34113504-34113526 CAGAAAATAAACAATTAGCCAGG - Intergenic
1125148742 15:36505978-36506000 AAGAAAATGCAGAATGTCTCAGG + Intergenic
1125477557 15:40057638-40057660 CAAAAAGTGAAAAATTAGTCGGG - Intergenic
1125740979 15:41964439-41964461 CAAAAAATGAATAAATTGGCTGG + Intronic
1125814542 15:42573685-42573707 CAGAAAATGAAGCTTTTATGTGG + Intergenic
1125819161 15:42613239-42613261 CAGAAAATGAAGCACTAGACAGG + Intronic
1126389314 15:48128993-48129015 CAAAAAATGAAGTAATTGTTAGG + Intronic
1127068427 15:55264348-55264370 CACAAAATAAAGATTTTGGCTGG - Intronic
1127502051 15:59562952-59562974 CAGATAATGAAAAGATTGTCAGG - Intergenic
1127598013 15:60506554-60506576 CAGAAAAGGAAGAGATTGGCTGG + Intronic
1129347816 15:74935332-74935354 AAGAAAAAGAAAAATTTGGCTGG + Intronic
1129611441 15:77061882-77061904 CAGGCAAGCAAGAATTTGTCAGG - Intronic
1130422957 15:83766672-83766694 AAGAAAATGCAGGCTTTGTCTGG + Intronic
1130970960 15:88731997-88732019 CAAAAAATAAAGAAATTATCTGG + Intergenic
1130978682 15:88797215-88797237 GAGAAAATGAAGAATATGTAAGG - Intergenic
1131604855 15:93891448-93891470 AATAAAAGGAAGAATTTCTCTGG + Intergenic
1131875877 15:96806001-96806023 CAGAACATAAATGATTTGTCAGG + Intergenic
1133192470 16:4144442-4144464 CAGAAAATGGAATGTTTGTCAGG - Intergenic
1133772812 16:8877484-8877506 AAAAAAAAGAAGAATGTGTCTGG + Intergenic
1135061406 16:19274207-19274229 GAGAAAAGGAAAAATATGTCTGG - Intergenic
1135594006 16:23727664-23727686 CAAAAAAAGAAAAATTAGTCGGG - Intergenic
1135626236 16:23997255-23997277 GAGAAAAGGAAAAATGTGTCTGG + Intronic
1135905717 16:26510064-26510086 CAAAAAATTAAAAATTAGTCAGG + Intergenic
1136575705 16:31123503-31123525 CAAAAAATGAAAATTTTGGCTGG - Intronic
1137630640 16:49941323-49941345 CAAAAAATTAAAAATTAGTCAGG + Intergenic
1137945461 16:52729815-52729837 GGTAAAATAAAGAATTTGTCTGG + Intergenic
1138659914 16:58510821-58510843 CAGAAAAGCAAGAATCTGTGGGG - Intronic
1139764423 16:69215002-69215024 CTGAAAATACAGAATTAGTCAGG - Intronic
1140266349 16:73424581-73424603 CAAAAAATGAAAAATTGGTGAGG + Intergenic
1140823888 16:78688388-78688410 CTGAAAAAGTAGGATTTGTCAGG - Intronic
1141131604 16:81441365-81441387 CAGAAAATGACAGGTTTGTCTGG + Intergenic
1143880643 17:10027049-10027071 AAGAAAATGAAGACTCTGCCGGG - Intronic
1144870719 17:18368924-18368946 CAGAAAATAAAAAATTAGCCAGG - Intergenic
1145763136 17:27439103-27439125 CAAAAAATAAAAAATTAGTCAGG + Intergenic
1146358559 17:32155701-32155723 CAGAAAATAAAAAATTAGCCAGG - Intronic
1146468001 17:33102175-33102197 CAAAAAATGTAGACTTTTTCAGG - Intronic
1147715803 17:42507484-42507506 CAGAAAGAGTAGAATTTGCCTGG - Intronic
1147846184 17:43405431-43405453 AAGAAAATGAAGAAACTGGCTGG + Intergenic
1148082194 17:44973289-44973311 CAAAAAATAAAAAATTAGTCGGG + Intergenic
1148375807 17:47145427-47145449 TATATAATAAAGAATTTGTCTGG + Intronic
1149097952 17:52867336-52867358 CAGAATATGTAGACTTTATCAGG - Intronic
1149728832 17:58924387-58924409 CAGAAAATTAAAAATTTAGCTGG + Intronic
1149891797 17:60396236-60396258 CAGAAAATAAAAAATTAGTCAGG - Intronic
1150258589 17:63770267-63770289 CAGAAAAAAAAAAATTAGTCCGG - Intronic
1150340259 17:64360981-64361003 CAAAAAATAAAGAATTAGCCAGG - Intronic
1150590779 17:66560247-66560269 AAAAATATGAAGAAATTGTCAGG + Intronic
1153012072 18:548280-548302 ATGAAGATGAAGAATTTGTTGGG - Intergenic
1153031701 18:719486-719508 CAGTTAATCAAGAATTTGTCAGG + Intergenic
1153839811 18:8996623-8996645 CAGAAAATACAAAAATTGTCTGG - Intergenic
1154096846 18:11425078-11425100 CAGGAAATGAGGAACATGTCTGG - Intergenic
1154339512 18:13491640-13491662 CAAAAAAAGAAGCATTTGTGTGG + Intronic
1155020768 18:21894896-21894918 CAAAAAATAAAAAATTAGTCAGG - Intergenic
1155295316 18:24379605-24379627 GAGAAAATAAAGAATTTATTTGG + Intronic
1155555502 18:27014743-27014765 CAGAAAAGGGGGAATTTTTCTGG + Intronic
1155628193 18:27860700-27860722 GAGAAGAAGAAGAAGTTGTCTGG - Intergenic
1155666364 18:28314516-28314538 GAGAAACTGAAGAATTTGGAGGG - Intergenic
1155774863 18:29748137-29748159 CTGAAAATGAAGGACTTGACTGG - Intergenic
1155935724 18:31751570-31751592 TACAAAATCAAGAATTTGCCCGG + Intergenic
1156379779 18:36547385-36547407 CAGAAAAACAAGAATTTTTTTGG - Intronic
1156716671 18:40020727-40020749 CAGAAAAAAAAAAATTTGCCTGG - Intergenic
1157227966 18:45885040-45885062 CAGAAAATGCTGAGTTAGTCCGG + Intronic
1157402106 18:47397246-47397268 GAGAAAATGAAGAATAGATCTGG + Intergenic
1158606829 18:58902967-58902989 GAGAAAGTGAAGAAGTTGTGAGG - Intronic
1158902671 18:61980733-61980755 CAGGAAGTGCAGAATTTATCAGG - Intergenic
1159172862 18:64795530-64795552 CAGAAAATGAATTATTGTTCTGG - Intergenic
1159345220 18:67193551-67193573 CAGAAACTGAACAATTTCTGAGG - Intergenic
1159420079 18:68206392-68206414 CAGACAATGGAGAATGTGTAGGG - Intergenic
1159853952 18:73561917-73561939 GAGAAGATGAAGAATTGTTCTGG - Intergenic
1160186932 18:76682995-76683017 TAGAAAAAGAAAAATTAGTCGGG - Intergenic
1162659578 19:12158437-12158459 GAGAAAATTAAGGATTTATCTGG - Intergenic
1163358127 19:16828314-16828336 AAGAAAATGAAAAAATTGGCTGG - Intergenic
1163471226 19:17498206-17498228 CAGAAAATAAAAAATTAGCCAGG + Intronic
1163555429 19:17989686-17989708 CAGAAAAAGAACAATTCCTCAGG - Intronic
1164629932 19:29755358-29755380 CAAAAAATTAAGAATTAGACAGG + Intergenic
1164778140 19:30870745-30870767 AAGAAAATTAAGAAATTATCGGG - Intergenic
1165002538 19:32776845-32776867 CAGAAAATAAAGATATTTTCAGG + Intronic
1165460625 19:35942175-35942197 TAGAAAATAAAAAATCTGTCGGG - Intronic
1165983227 19:39744214-39744236 CAGAAAAGGAAGATTTTATAGGG - Intergenic
1166099719 19:40564674-40564696 CAGAAAATGAAAAATTAGTTGGG + Intronic
1167030637 19:46957450-46957472 CAAAAAATAAAAAATTTGCCAGG + Intronic
1167805555 19:51781440-51781462 GAGATAATGAAGAACATGTCTGG + Intronic
1168119675 19:54244702-54244724 CATAAAGTGAAAAATTTGACCGG + Intronic
1168166255 19:54549955-54549977 CACAAAATGAACATTTTGACTGG + Intergenic
1168265393 19:55220787-55220809 CTGAAAATGACAAACTTGTCAGG - Intergenic
1168283469 19:55318966-55318988 CAAAAAATAAAGAATTAGCCAGG - Intronic
926985219 2:18615243-18615265 CAAAACATGAAAAATATGTCAGG + Intergenic
927084788 2:19663813-19663835 TAGAAAATGAGGAAATTGGCAGG - Intergenic
927585368 2:24298710-24298732 GAGAACAAGAAGAAATTGTCAGG - Exonic
929737976 2:44571278-44571300 AAAAGAATGAAGAATTTGTGAGG + Intronic
929840557 2:45457662-45457684 CAGAACATGAAGTGTTTGTCGGG - Intronic
929995547 2:46824027-46824049 TTAAAAATGAAGAATTTGGCTGG + Intronic
930278783 2:49344425-49344447 CAGAAAATGGACAACTTGTTTGG + Intergenic
930404395 2:50936873-50936895 TAAAAAATGAATAAATTGTCAGG + Intronic
932106692 2:68949713-68949735 CAGAAAAAGAACAATTGGTCAGG - Intronic
932154805 2:69406731-69406753 CAGAAAATAAAAAAATTGCCTGG - Intronic
932155707 2:69415279-69415301 AGGAAAATGAAGAATTAGACTGG - Exonic
933426640 2:82121664-82121686 CAGAAAATGTAAAATATTTCTGG - Intergenic
933563923 2:83925704-83925726 AAGAAAATGAAGAATTATCCAGG - Intergenic
934868710 2:97839481-97839503 CTAAAAATAAAGAATGTGTCAGG - Intronic
935973765 2:108557236-108557258 CAAAAAATGAAAAATTAGCCAGG - Intronic
938319599 2:130354296-130354318 CAGAAAATAAAGACATTTTCTGG - Intergenic
938553072 2:132398583-132398605 AAGATAATAAATAATTTGTCTGG + Intergenic
939312316 2:140497526-140497548 AAGAAAATGAGAAATTTGACAGG + Intronic
941345886 2:164369088-164369110 CATAACATGAACATTTTGTCAGG + Intergenic
941779191 2:169426526-169426548 CAGCAAATGCAGAATTGGCCAGG + Intergenic
941855774 2:170228913-170228935 CTGAAATTGAAGTATTTGGCAGG - Intronic
941963570 2:171277609-171277631 CAGAAAATGGCGAAGTTGTCAGG + Intergenic
942787477 2:179716379-179716401 CAGAAAATGGAAAATAGGTCAGG - Intronic
943241770 2:185393622-185393644 CAGAAAATTGAGAATTTAACAGG - Intergenic
943332779 2:186579821-186579843 AATGAAATGAAGTATTTGTCAGG - Intergenic
943603683 2:189950995-189951017 CAGAATATGGGGAATTTTTCTGG + Intronic
943803940 2:192098399-192098421 CAGATAATGAAGAAATTTTTTGG - Intronic
943824693 2:192374067-192374089 CTGAAAATGAATGATTTGTCTGG - Intergenic
944456189 2:199897288-199897310 AATAAAATGAAGAATTTGGAAGG - Intergenic
944564194 2:200970815-200970837 CAGAAAAAAAAAAATTAGTCGGG + Intergenic
945645138 2:212482775-212482797 CAAAAAAAGAAAAATTTGCCGGG - Intronic
947123810 2:226845577-226845599 CAGAATATAAAGAAGTTGTCAGG - Intronic
947643161 2:231718448-231718470 CAAAAAATTAAAAATTAGTCAGG + Intergenic
949020362 2:241737727-241737749 CAGAAAATTAAAAATTAGCCGGG + Intronic
1169156013 20:3330401-3330423 CAGAAAATAAAAAATTAGCCAGG - Intronic
1169529347 20:6467365-6467387 CAAAAAATGAACAATTTAGCTGG + Intergenic
1169582227 20:7036522-7036544 GAGAAAGAGAACAATTTGTCTGG + Intergenic
1170718271 20:18851201-18851223 CAGAAAATGTAAAAATTGGCTGG - Intergenic
1171396883 20:24840381-24840403 AAGAAAAAGAGGAATGTGTCTGG - Intergenic
1171995420 20:31727169-31727191 CAGAAAAAGAACAATTAGCCAGG + Intergenic
1172013488 20:31860052-31860074 CAGCAAATAAAAAATATGTCAGG - Intronic
1172658719 20:36552137-36552159 CAAAAAATAAAAAATTAGTCAGG - Intergenic
1173839299 20:46146783-46146805 CAAAAAATGAAAAATTAGCCAGG - Intergenic
1173879513 20:46401272-46401294 CAGAAAAGGGAGGATTTGACTGG + Intronic
1177188913 21:17827559-17827581 CTGAAATTGAACAATTTGGCAGG + Intergenic
1177624650 21:23644917-23644939 CAGAAACTGAAAAATGTTTCCGG - Intergenic
1178950197 21:36979751-36979773 CAGAAAATTAAAAATTAGCCAGG + Intronic
1179200458 21:39214587-39214609 CAGAAAGTGTAGAATTTATTTGG - Intronic
1179218514 21:39387018-39387040 CAAAAAATTAAAAATTAGTCAGG - Intronic
1180434526 22:15287672-15287694 GAGAAAATGGAGATTATGTCAGG - Intergenic
1180792432 22:18583226-18583248 CAGAAAATAAAAAATTAGCCGGG - Intergenic
1181229305 22:21412092-21412114 CAGAAAATAAAAAATTAGCCGGG + Intergenic
1181249345 22:21522772-21522794 CAGAAAATAAAAAATTAGCCGGG - Intergenic
1181715553 22:24724731-24724753 CAAAAAATGAAAAAATTGGCCGG - Intronic
1182072322 22:27472353-27472375 CAAAAAATGAAGAAATTAGCTGG + Intergenic
1182856267 22:33520233-33520255 CAGAAAATAAAAAATTAGCCAGG - Intronic
1183191192 22:36323003-36323025 CAGAAAGTGAAGCATTTATCAGG - Intronic
1184822514 22:46920238-46920260 CAAAAAATAAAAAATTAGTCAGG - Intronic
1185207138 22:49546389-49546411 CAGAAAAAGAAGTATGTGTGTGG - Intronic
949177178 3:1079001-1079023 CAGAAAATAAACAATTTATCTGG + Intergenic
950074682 3:10178960-10178982 AAAAAAATGAAAAATTAGTCAGG - Intronic
950191667 3:10980911-10980933 CAGAAAATGAATAAGGTCTCAGG + Intergenic
950244021 3:11398689-11398711 CAGAAAATTAAAAAATTGCCAGG + Intronic
950739868 3:15041694-15041716 AAAAAAATGAAAAATTAGTCAGG + Intronic
950803478 3:15575700-15575722 CAAAAAATTAAAAATTAGTCAGG - Intronic
950815070 3:15692286-15692308 AAAAAAATAAAGAATTAGTCGGG + Intronic
950860161 3:16140625-16140647 CAGGAAATGAAGCATTTATGAGG + Intergenic
951186140 3:19715686-19715708 CAAAAAATGAAAAATTAGCCAGG - Intergenic
951473525 3:23081041-23081063 CAAAAAATGAAAAATTAGCCAGG + Intergenic
951884959 3:27515378-27515400 CAAAAAGTGAAAAATTTGGCTGG + Intergenic
952242281 3:31544421-31544443 AAGAAAATAAAGACTTTATCTGG - Intronic
952931232 3:38362397-38362419 CAAAAAATGAAAAATTTAGCTGG - Intronic
953100158 3:39816869-39816891 CAGAAAATGAATATTTTATAAGG - Intronic
953459599 3:43072078-43072100 CAGAGAATGTAGAATTTGGAAGG + Intergenic
953873566 3:46649004-46649026 CTGAAAATACAAAATTTGTCGGG - Intergenic
954006242 3:47593331-47593353 CAGAAAATGCAAAAATTATCCGG - Intronic
954060533 3:48062624-48062646 AAGAAAATGAACAATGTGGCTGG + Intronic
954547107 3:51446294-51446316 AAGAAAATTAAGAACTTGGCCGG - Intronic
954973859 3:54674798-54674820 CAGAAAGTTAAGATTTTGTAGGG + Intronic
955391872 3:58527851-58527873 AAAAAAATGAAAAATTAGTCAGG - Intronic
955662413 3:61315486-61315508 CATAAAATGAAACATTTTTCAGG + Intergenic
955796620 3:62644167-62644189 CAGAACATGAATAATTTGCCAGG - Intronic
955886668 3:63606590-63606612 CAGAAAATTAAAAATTTAGCTGG - Intronic
956168698 3:66415870-66415892 CAGAAAAAGCAGCATTTGTTTGG - Intronic
957362579 3:79178297-79178319 CAGTAAATGAAGAAATTATTAGG + Intronic
957720222 3:83985924-83985946 GAGAGACTGAAGAATTTTTCTGG - Intergenic
958827457 3:99048922-99048944 CAGAGAATGAAGCAAATGTCAGG - Intergenic
959289481 3:104455532-104455554 GATAAAATGAAGAATTTCTTTGG + Intergenic
960839866 3:121946060-121946082 AAGAAAATGATGAATGTGGCTGG - Intergenic
961172244 3:124805610-124805632 CAGAAAATAAAAAATTAGCCGGG - Intronic
962516803 3:136159974-136159996 AAGAAAATGAAAAAATGGTCAGG + Intronic
963621928 3:147620710-147620732 CAGAAAACAAAGAATTTATAAGG + Intergenic
963800758 3:149673913-149673935 GTGAAAATAAAGAATTTGGCTGG + Intronic
964110510 3:153082629-153082651 CAAAAAATAAAAAATTAGTCAGG + Intergenic
964209432 3:154210946-154210968 CAAAAAAAAAAAAATTTGTCTGG + Intronic
965640430 3:170823755-170823777 CTCAAAATGGTGAATTTGTCAGG - Intronic
966550697 3:181201021-181201043 GAGAAAATGAAGAATGATTCAGG - Intergenic
966630318 3:182066573-182066595 CACAAAATAAAGAATTTGGATGG + Intergenic
966953304 3:184845383-184845405 CAGAAAAGGTAGAATTTCTGTGG - Intronic
967465710 3:189803776-189803798 TAGAAAATGAAGCATCTGTTTGG + Intronic
967870866 3:194227857-194227879 CAGAAAAGGAGGAAGTTGGCAGG - Intergenic
968027873 3:195457591-195457613 CAGAAAATCAAAAATTAGCCAGG - Intergenic
971084606 4:23257862-23257884 TAGAAAATAAAGACTTTCTCAGG + Intergenic
971965182 4:33545030-33545052 CAAAAAATGAATAATTTTTGTGG + Intergenic
972040172 4:34584285-34584307 CAAAAAATGAAGAATATTTTTGG - Intergenic
972608085 4:40632168-40632190 CAGGAAATGTTGAATTTGTCTGG - Intergenic
972766482 4:42156256-42156278 CAGAAAATAAAAAATTAGCCAGG + Intergenic
972905425 4:43740717-43740739 CAGAAAATCTTGAAGTTGTCAGG - Intergenic
973768940 4:54189082-54189104 CAGACAGAGAAGAATTTGTTAGG - Intronic
973938884 4:55882299-55882321 CAGAAAATGCAAAATTAGCCGGG - Intronic
974054401 4:56971014-56971036 CTGAAAGGGAAGAATTAGTCTGG + Intronic
974918939 4:68212820-68212842 CAGTAAGTGAAGATCTTGTCAGG + Intergenic
975471689 4:74776316-74776338 CAGGACCTGAAGAATTTCTCAGG + Intronic
975858597 4:78651580-78651602 CAAAAAATTAAAAATTTATCTGG + Intergenic
976803222 4:89016794-89016816 CAGAAAATTAAGAAATTAGCAGG - Intronic
977306469 4:95329128-95329150 CAAAAAATGAAAAATTAGTCAGG + Intronic
977531695 4:98207941-98207963 CAGAAAATAAAAAATTAGCCAGG - Intergenic
978708043 4:111740509-111740531 CAGAAAAAGAAGAATATGACTGG - Intergenic
979168121 4:117562534-117562556 CAGCAAGTGAAGAATCTGTAGGG - Intergenic
979441608 4:120756691-120756713 AAGAAAATGAAAAAATTATCTGG - Intronic
980053218 4:128058238-128058260 CAAAAAAAGAAAAATTAGTCAGG + Intergenic
981063838 4:140460187-140460209 TAGAAACTGAAGTATTTGTGAGG - Intronic
981650836 4:147056536-147056558 CAGAAGATGGAGAGTTTCTCTGG + Intergenic
981660163 4:147157513-147157535 CAGGAAATGAAGAAAGTGGCAGG - Intergenic
981683896 4:147431316-147431338 CAAAAAATAAAAAATTAGTCAGG + Intergenic
982002989 4:151038116-151038138 CAAAAAATGAAAAAATTGCCTGG - Intergenic
982270369 4:153579769-153579791 CAGAAAAAAAAGAATAGGTCAGG - Intronic
982364318 4:154558695-154558717 CAAAAAATGAAAAAATTATCTGG - Intergenic
983183876 4:164679131-164679153 TCCAAAATCAAGAATTTGTCAGG + Intergenic
984313054 4:178088604-178088626 AAGAAGATGATGAATTTGTCTGG - Intergenic
986525682 5:8672432-8672454 CAGACAATGGAGGATTTTTCAGG + Intergenic
986585294 5:9310249-9310271 AAAAAAATGAACAATATGTCTGG + Intronic
988335185 5:29898369-29898391 AAAAAAATAAAGAATATGTCAGG - Intergenic
988664186 5:33307314-33307336 CAGAAATTGAAGAATTTTCCTGG + Intergenic
988693381 5:33595037-33595059 CAGAGAATGAAGACTCTTTCTGG + Intronic
989815804 5:45736489-45736511 CAGAAAATGACTCAGTTGTCAGG - Intergenic
990150613 5:52813473-52813495 CAAGAAATGAAGAAATTTTCTGG + Intronic
990554602 5:56918404-56918426 AAGAGAATGAGGAATATGTCAGG - Intergenic
990602182 5:57370332-57370354 CTGAAAACTAAGAATTTTTCTGG - Intergenic
990700375 5:58468567-58468589 CAGAAAATGAACATTTTGCAAGG - Intergenic
991016059 5:61933898-61933920 AAGAAACAGAAAAATTTGTCAGG - Intergenic
991537472 5:67686993-67687015 AAGAAAATAAAGAATTGGTTTGG + Intergenic
992598113 5:78366511-78366533 CAGAAGGTGAAGACTTTGTGAGG - Intronic
992719873 5:79550369-79550391 CAGAAAAAGAAAAATTTACCAGG + Intergenic
992831386 5:80596676-80596698 CGGAAAATTAAAAAATTGTCTGG - Intergenic
992867319 5:80970701-80970723 CAGAGACTGATGATTTTGTCTGG - Intronic
993105143 5:83592154-83592176 CAGAAAATGTAGGATTAGGCCGG + Intergenic
993756173 5:91733243-91733265 CAGAAATGGATGAATTTCTCAGG + Intergenic
994925153 5:106106717-106106739 CAGAAAAACAAGATTTTGTTTGG + Intergenic
995023214 5:107389880-107389902 CAGAAAATGAGGAAGTAGTGGGG - Intronic
995096809 5:108246037-108246059 CAGAAACTGAAGAAACTGTGTGG - Intronic
995918778 5:117284952-117284974 CAGAAAATGAAAAATTAGAATGG - Intergenic
996157017 5:120114736-120114758 ATGAAGATGAAGAATTTGTAGGG + Intergenic
996389048 5:122940288-122940310 TAGAAAATGAAAAATTAGTCTGG - Intronic
996434725 5:123422216-123422238 CAGATGATTAGGAATTTGTCAGG - Intronic
996457179 5:123698184-123698206 CAAAAAAAGAATAAGTTGTCTGG - Intergenic
997913169 5:137896571-137896593 CAAAAAATGAAAAACTAGTCAGG - Intronic
998151410 5:139759497-139759519 CAGAAAAGGACGATTTCGTCAGG - Intergenic
998323052 5:141250697-141250719 GACAAAATGAAGAAATTGACAGG + Intergenic
998636486 5:143960519-143960541 CAGAAACTGAAGAATTCTACAGG - Intergenic
999114509 5:149150748-149150770 CTGCAAAGGAAGAATTTATCTGG - Intronic
999989362 5:157035316-157035338 CAGAAAATTAAGAGTATGTTTGG - Intronic
1000118865 5:158177964-158177986 CAGTAAAAGACGGATTTGTCCGG + Intergenic
1000495337 5:161975932-161975954 CAGAAAAAAAACAAATTGTCTGG + Intergenic
1000814191 5:165899918-165899940 CTGAAAATAAAGAATGAGTCCGG + Intergenic
1002301207 5:178258085-178258107 CAGAAAATAAAAAATTAGCCGGG + Intronic
1004420508 6:15465289-15465311 CAAAAAATGAAAAAATTATCTGG + Intronic
1004463451 6:15861380-15861402 CAGATAATGAAGAGTTTCTTAGG + Intergenic
1004736267 6:18409405-18409427 CAGAAAAAGAAGAGTTTTCCAGG - Intronic
1004869282 6:19888399-19888421 TTGAAAATGAAAAATTTGTCCGG + Intergenic
1005887917 6:30111328-30111350 TAGAAAATGAAGACATTGGCCGG - Intronic
1006112375 6:31755655-31755677 CAAAAAATAAAAAATTGGTCAGG - Intronic
1006234904 6:32621385-32621407 GGGAAAATGAAGAATTTGACTGG - Intergenic
1006311796 6:33266299-33266321 CAAAAAATGAAAAATTAGCCGGG - Intronic
1006466998 6:34201759-34201781 AAAAAAATGAAAAATTTGCCAGG - Intergenic
1006752306 6:36386475-36386497 GAGAAAATGAAGAAAGTGGCAGG + Intronic
1006901376 6:37504154-37504176 CAGGAAATGAAGAATTTTTTAGG + Intergenic
1006905637 6:37531556-37531578 GAGAAAAAGAAGAATGTGTTTGG + Intergenic
1007038105 6:38696776-38696798 CAGAAATTAAAAAATTTCTCTGG + Intronic
1007051257 6:38832629-38832651 TGGAAAAAGAAGAATTTTTCTGG + Intronic
1007489416 6:42207019-42207041 AAGAAAATGAAGCACTTCTCTGG + Exonic
1008814166 6:55543700-55543722 CAAAAAATCAAAAATTAGTCAGG + Intronic
1009296440 6:61956655-61956677 CAGAGAATGGAGAATTTACCTGG - Intronic
1009554556 6:65146700-65146722 AAGAAAATGTAAAATTTGACAGG - Intronic
1009632639 6:66218392-66218414 TTGAAAATGAAGAATTAGTGAGG + Intergenic
1010050799 6:71501959-71501981 CAAAAAATGGAGAGTTAGTCAGG - Intergenic
1010061688 6:71629758-71629780 AAGAAACTGAGGAATTGGTCAGG + Intergenic
1010547942 6:77181893-77181915 CAGAAAGTGAACAATTGCTCTGG - Intergenic
1010786707 6:80010936-80010958 GAGGAAAAGAAGAATTTATCAGG + Exonic
1011445152 6:87431312-87431334 TCCAAAATGAAGACTTTGTCTGG - Intronic
1011477401 6:87761416-87761438 CAAAAAATGCAAAATTAGTCGGG + Intergenic
1011638315 6:89396206-89396228 ACAAAAATGAAGAATTTGTTGGG + Intronic
1012032076 6:94083917-94083939 CTGAAAATGGAGTACTTGTCTGG + Intergenic
1012196824 6:96353218-96353240 CAGAAAATGTAGAACTTTTACGG + Intergenic
1013649232 6:112177117-112177139 TAGAAAAAGAATATTTTGTCAGG + Intronic
1014541919 6:122686656-122686678 CAGAAATTAAAGAAGTTATCTGG - Intronic
1015745170 6:136502223-136502245 CAGCAAATGAAGAATCTCTTAGG + Intronic
1016822880 6:148362685-148362707 CAAAAAATAAAAAATTAGTCAGG + Intronic
1016961210 6:149674372-149674394 CAAAAAATAAAAAATTTGGCTGG - Intronic
1017061287 6:150487551-150487573 CAAAAAATAAAGAATTAGCCGGG - Intergenic
1017111845 6:150940033-150940055 CAGAAAAGGAAGAATGTTCCAGG - Intronic
1017634955 6:156434823-156434845 CAGAACATAAAGAGTTTGTTTGG - Intergenic
1017783316 6:157733487-157733509 AAAAAAATGAAAAATTTGCCTGG + Intronic
1018170219 6:161138557-161138579 CAGAAAATGGAAAGTGTGTCAGG - Intronic
1018285385 6:162232189-162232211 CAGGAGATGCAGAAATTGTCAGG - Intronic
1019013480 6:168861876-168861898 CAGAATATGAACAATTTCTCAGG + Intergenic
1019291218 7:251355-251377 CAAAAAATGAAAAATTAGCCAGG + Intronic
1019822291 7:3253980-3254002 CAAAAAATGAAAAATTAGCCAGG + Intergenic
1020019215 7:4852607-4852629 CAAAAAATAAAAAATTAGTCAGG - Intronic
1020766004 7:12322026-12322048 CAGAAAATAAAGTCTTTGTAAGG - Intergenic
1021180476 7:17499879-17499901 CAGAAGATGAAGAGTTTGGAGGG + Intergenic
1021314165 7:19125713-19125735 CAGAAAAGGAAGAGTTGCTCTGG - Intergenic
1021728520 7:23573663-23573685 CAAAAAATAAAGAATTTGCCAGG - Intergenic
1022163109 7:27731704-27731726 CAAAAAATGAAAAATTAGTCAGG + Intergenic
1022546742 7:31196674-31196696 CAGAGATTGAGGACTTTGTCCGG + Intergenic
1022686896 7:32605567-32605589 CAGAAAATAAAAAATTAGCCAGG + Intergenic
1023476554 7:40585532-40585554 CAAAAAATAAAGTAATTGTCAGG - Intronic
1023972578 7:45002275-45002297 CAAAAAATGCAGAATTAGGCTGG + Intronic
1024050593 7:45620406-45620428 AAGAAAATGAAGAGAGTGTCAGG + Intronic
1024768324 7:52687391-52687413 AAGAAAATGGACAATTTGTTAGG - Intergenic
1025828468 7:65030180-65030202 AAGAAGATGAAAAATTAGTCTGG + Intergenic
1025915993 7:65866611-65866633 AAGAAGATGAAAAATTAGTCTGG + Intergenic
1026130894 7:67620095-67620117 AAGATAATGAAGAATTTGGAAGG - Intergenic
1026299299 7:69083242-69083264 TAGAAAATTCAGAATTTGGCTGG + Intergenic
1028380551 7:90194540-90194562 CAGAAAAGGACAAATTTGTTTGG + Intronic
1028576217 7:92354479-92354501 CAAAAAATGATGATTTTGTTAGG - Intronic
1029231123 7:99069518-99069540 AAGAAATTGAAAAATTAGTCAGG - Intronic
1029368601 7:100132858-100132880 CAGAGAAGGAAGGGTTTGTCAGG - Intergenic
1030382000 7:108822305-108822327 AAGAAAATGGAGAATTTCCCTGG + Intergenic
1030976529 7:116130771-116130793 CAAAAAATGAAAAATTAGTCTGG - Intronic
1031050184 7:116937029-116937051 AAGAAAATGATGAAGTTGTGTGG + Intergenic
1031120671 7:117718121-117718143 TAGAAAATACAGAATTTGCCCGG + Intronic
1031184231 7:118455528-118455550 CAAAAAATAAAAAATTAGTCTGG + Intergenic
1031185047 7:118467015-118467037 CAGAAAATGAAGGAGTTCTTTGG + Intergenic
1031413463 7:121467683-121467705 CAGACAATGCAGAGTGTGTCAGG + Intergenic
1032613905 7:133445155-133445177 CAGAAAATTTTCAATTTGTCAGG - Intronic
1032681996 7:134194578-134194600 CAAAAAATAAAGAATTAGCCTGG + Intronic
1033138594 7:138805056-138805078 CAGAAACTGAAGAGATTGCCTGG + Exonic
1033302087 7:140195556-140195578 AAGAAAAAGAAAAATTAGTCTGG - Intergenic
1033309502 7:140250584-140250606 CAAAAAATAAAAAATTTGTCAGG - Intergenic
1033564416 7:142564570-142564592 CAGAAAATGCAGCCTTTCTCGGG - Intergenic
1035007498 7:155677504-155677526 CAGAAAATGAAGTTTCTGGCTGG - Intronic
1035613962 8:988800-988822 CAGAAAAAGCAGGATTGGTCAGG - Intergenic
1036420270 8:8588966-8588988 AGGAAAATGTAGAATTTGTGGGG + Intergenic
1036791530 8:11724475-11724497 CAGAAAATGAAGAATTACGTTGG - Intronic
1037005317 8:13771507-13771529 CAGAAAATACAGAATTTCTAAGG + Intergenic
1037019410 8:13950724-13950746 TGGAAAATGAAGAATGTGTAGGG + Intergenic
1038004573 8:23418720-23418742 CAAAAAATGAAGAACTTAGCTGG + Intronic
1038558832 8:28550785-28550807 AAGAAAATGAAGAATAGGCCAGG - Intronic
1039102431 8:33955281-33955303 CAAAAAATCAAGAAGTTCTCTGG - Intergenic
1039493224 8:37963404-37963426 CAAAAAATGAAAAGTCTGTCTGG - Exonic
1039527275 8:38228048-38228070 CAGAACCTAAAGAATTTATCTGG + Intronic
1040479998 8:47816648-47816670 CAGAAAATAAATAATATGTAGGG + Intronic
1041241340 8:55851514-55851536 CAAAAAATTAAAAATTTGCCAGG + Intergenic
1043617353 8:82143389-82143411 AATAAAATGAAAAAATTGTCAGG - Intergenic
1043916930 8:85933747-85933769 CAGCAAATGAAGAAAGTGTGAGG - Intergenic
1044012939 8:87017120-87017142 CAGAAAAGGTAAAATTGGTCTGG + Intronic
1044141137 8:88654788-88654810 CAAAAAATGAATACTTTGTGAGG - Intergenic
1044624644 8:94225310-94225332 CAGAAAATGAAGGAATCGTTTGG - Intergenic
1044977027 8:97674969-97674991 CAAAAAATAAAAAATTAGTCGGG - Intronic
1044994946 8:97830009-97830031 CAGAAAGTGAAGAAGATGTTCGG + Intronic
1045180754 8:99779135-99779157 TAGAGAATGAAGAATTTGATGGG + Intronic
1045280732 8:100747428-100747450 CAGAAAATAAAAAATTAGTCAGG + Intergenic
1045712904 8:105006705-105006727 AAGAAAATGAAGGGTTTTTCAGG + Intronic
1045873239 8:106949559-106949581 CAGAAAAAGAACAAAGTGTCTGG + Intergenic
1045997723 8:108382908-108382930 AAGAAAATTAAAAATTAGTCTGG + Intronic
1046184228 8:110691902-110691924 CACAACAGGAAGAATTTGTCAGG - Intergenic
1046740919 8:117828386-117828408 CAAAAAATGAAAAATTAGCCAGG + Intronic
1046769180 8:118101350-118101372 CAGAAAAGGAGAAATTTGTGAGG - Intronic
1046792704 8:118339166-118339188 CAGAAAATAAAAAATTAGCCAGG + Intronic
1047391540 8:124455999-124456021 CAGTCAATTAAGCATTTGTCAGG + Intronic
1047836689 8:128701452-128701474 TAGAAAATGAACAATTTGAATGG - Intergenic
1048157484 8:131972302-131972324 CAGAAAGTACAGAATTCGTCTGG - Intronic
1048285691 8:133139712-133139734 AACAAAATGAAGAAATTATCTGG + Intergenic
1048573539 8:135673697-135673719 CAGAGAATGAAGACTTTGAAGGG + Intergenic
1048734349 8:137482038-137482060 GAGAACATGTAGAATTTTTCAGG + Intergenic
1049878314 8:145042652-145042674 AAGAAAATAAATAAATTGTCTGG - Intergenic
1050102100 9:2129852-2129874 CTCAAAAAAAAGAATTTGTCTGG - Intronic
1050111773 9:2224410-2224432 CAGAAAATAAAAAATTAGCCGGG - Intergenic
1050731356 9:8713464-8713486 AAGAAAATGAAGAAGTCTTCAGG + Intronic
1050752381 9:8955210-8955232 CAGAATATGAAAAAGTTGGCTGG + Intronic
1050977178 9:11953839-11953861 CAAGAAATGAAAAATTTGTCTGG + Intergenic
1051072263 9:13185387-13185409 CACATAATGAAGAATTTAACAGG + Intronic
1051108959 9:13613280-13613302 GAGAAGATAAAGAATTTGTCAGG + Intergenic
1051344855 9:16142682-16142704 CAGAAAATGACAAATTTGTGAGG + Intergenic
1051505698 9:17825310-17825332 CATAAAATCAAGAATTTGAATGG - Intergenic
1051633240 9:19159196-19159218 CAAAAAATGAAAAATTGGCCAGG - Intergenic
1052092340 9:24344264-24344286 CAAAAAATAAAAAATTAGTCAGG + Intergenic
1052210260 9:25894788-25894810 ATGAAAATGAGGAATTTGTTGGG - Intergenic
1052411457 9:28127124-28127146 CAGAGAAGGAAGAAATTGCCAGG - Intronic
1052418483 9:28208814-28208836 CAGAAGATGAAGCATGTGTGAGG - Intronic
1053402443 9:37837665-37837687 AAGAAAATGAAGCACTTCTCTGG - Intronic
1053475078 9:38376781-38376803 CTGAAAATGAAGAATTTGCTGGG - Intergenic
1055492709 9:76822510-76822532 GAGAAAAAGAAGAATAGGTCGGG + Intronic
1056240824 9:84644953-84644975 AAAAAAAAGAAGAATATGTCTGG - Intergenic
1056531279 9:87489949-87489971 CAGAAAATAAAAAATTAGCCAGG + Intergenic
1057577839 9:96257823-96257845 CAAAAAATAAAGAATTAGCCGGG - Intronic
1058495651 9:105556436-105556458 AAAAAACTGAGGAATTTGTCTGG + Intergenic
1058843385 9:108932935-108932957 AAGAAAATGAAGCAGTTATCAGG - Intronic
1059170740 9:112122319-112122341 CAAAAAATTAAAAATTTGCCAGG - Intronic
1059225841 9:112672236-112672258 CAGAAAATTAAAAATTAATCAGG + Intergenic
1059425674 9:114219599-114219621 CTGAACATAAAGAATTTCTCAGG - Intronic
1060639955 9:125230123-125230145 CAGAAAATAAAAAAATTATCTGG - Intronic
1060650311 9:125320111-125320133 CAAAAAATGAAAAATATGTGAGG - Intronic
1060725020 9:126000833-126000855 CAGGAAATGATGTATTTGGCAGG + Intergenic
1062061541 9:134499102-134499124 CATAAATTGAATGATTTGTCAGG + Intergenic
1185762510 X:2699616-2699638 CAAAAAATGAAAAATTTGGCTGG - Intronic
1185863043 X:3596850-3596872 CAGAAAATGAAAAAATTAGCTGG - Intergenic
1185949995 X:4422236-4422258 CAGAAAATGAGGAAACTGCCAGG - Intergenic
1186303340 X:8226037-8226059 CAGAAAATTAAAAAGTTGTGTGG - Intergenic
1186971981 X:14856395-14856417 AAGAAAATTAATATTTTGTCAGG + Intronic
1187466291 X:19530675-19530697 GAGAAAACCAAGAATTTGGCTGG - Intergenic
1187828302 X:23354976-23354998 CACAAAATGAACGATTTCTCTGG - Intronic
1188299812 X:28494689-28494711 CAGAAAATGAACAAAGTATCAGG - Intergenic
1188460503 X:30421502-30421524 CAGAAGATGAACAACTTGGCTGG - Intergenic
1188681066 X:33005668-33005690 GAGAAAATGAAAACTTTCTCAGG + Intronic
1189595800 X:42564258-42564280 CAGAAAATGAAGAAGTTACTGGG - Intergenic
1190040792 X:47070254-47070276 TAGAAATTTAAGAATTTTTCAGG - Intergenic
1190101649 X:47526775-47526797 CAAAAAATAAAAAATTAGTCAGG - Intergenic
1190736621 X:53259637-53259659 CAGAAAATAAAAAATTAGCCAGG + Intronic
1191665942 X:63702765-63702787 CAGAAAATGCAGAAGTAGCCTGG + Intronic
1192353440 X:70377231-70377253 CAAAAAATAAAAAATTTGCCAGG - Intronic
1192526163 X:71846448-71846470 TGTAAAATAAAGAATTTGTCTGG + Intergenic
1193188375 X:78539739-78539761 ATGAAAATGAAGAACTTGTTGGG - Intergenic
1193739014 X:85195499-85195521 CAAACAATGAAGAATTAATCTGG + Intergenic
1194102378 X:89721914-89721936 CAGAAAATGAACTATTATTCAGG - Intergenic
1194533987 X:95083857-95083879 CAGAAATTGTATAATTTGTGTGG - Intergenic
1194651410 X:96518972-96518994 AAGAAAATAAAGCGTTTGTCTGG - Intergenic
1195118050 X:101719489-101719511 CAGAAAATAGAAAAATTGTCTGG + Intergenic
1195752530 X:108172818-108172840 CAGAAAATGCAGAAGATGACAGG + Intronic
1196003518 X:110811437-110811459 CTGAAAATGAATAATTTTACTGG + Intergenic
1196080427 X:111624563-111624585 AAGAAGATGAAGAAGTTTTCAGG - Intergenic
1196873319 X:120133693-120133715 CAGAAAATAAAAAATTAGCCGGG - Intergenic
1196906135 X:120437362-120437384 TAGAAAATGAGAAAATTGTCTGG - Intronic
1198569936 X:137944222-137944244 CAGAAAATCAACAACTTATCTGG + Intergenic
1198975401 X:142329898-142329920 AAGAAAATGATGGATGTGTCTGG + Intergenic
1199290797 X:146102963-146102985 CAGAAAATGGAGAATTTGAAAGG - Intergenic
1200454965 Y:3379192-3379214 CAGAAAATGAACTATTATTCAGG - Intergenic
1201773036 Y:17636830-17636852 CTAAAAATGAAAAATTAGTCGGG - Intergenic
1201828519 Y:18269156-18269178 CTAAAAATGAAAAATTAGTCGGG + Intergenic