ID: 1077633756

View in Genome Browser
Species Human (GRCh38)
Location 11:3827857-3827879
Sequence CGCCGTCCTATGAGAACGTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 21}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077633756_1077633762 21 Left 1077633756 11:3827857-3827879 CCGCACGTTCTCATAGGACGGCG 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1077633762 11:3827901-3827923 TGACGAAAACGTTGGTCTGAGGG 0: 1
1: 0
2: 0
3: 2
4: 46
1077633756_1077633763 25 Left 1077633756 11:3827857-3827879 CCGCACGTTCTCATAGGACGGCG 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1077633763 11:3827905-3827927 GAAAACGTTGGTCTGAGGGTAGG 0: 1
1: 0
2: 0
3: 5
4: 94
1077633756_1077633761 20 Left 1077633756 11:3827857-3827879 CCGCACGTTCTCATAGGACGGCG 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1077633761 11:3827900-3827922 ATGACGAAAACGTTGGTCTGAGG 0: 1
1: 0
2: 0
3: 4
4: 58
1077633756_1077633760 13 Left 1077633756 11:3827857-3827879 CCGCACGTTCTCATAGGACGGCG 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1077633760 11:3827893-3827915 GAAACAGATGACGAAAACGTTGG 0: 1
1: 0
2: 1
3: 11
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077633756 Original CRISPR CGCCGTCCTATGAGAACGTG CGG (reversed) Exonic