ID: 1077634758

View in Genome Browser
Species Human (GRCh38)
Location 11:3834809-3834831
Sequence TAGGCGAGTATGGAGGTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 75}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077634749_1077634758 20 Left 1077634749 11:3834766-3834788 CCCAACTGGGAGTGGGGGAGGGG 0: 1
1: 1
2: 7
3: 64
4: 505
Right 1077634758 11:3834809-3834831 TAGGCGAGTATGGAGGTGATGGG 0: 1
1: 0
2: 2
3: 6
4: 75
1077634751_1077634758 19 Left 1077634751 11:3834767-3834789 CCAACTGGGAGTGGGGGAGGGGA 0: 1
1: 0
2: 5
3: 78
4: 511
Right 1077634758 11:3834809-3834831 TAGGCGAGTATGGAGGTGATGGG 0: 1
1: 0
2: 2
3: 6
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077634758 Original CRISPR TAGGCGAGTATGGAGGTGAT GGG Intronic
905234415 1:36536082-36536104 AAGGTGAGTAGGGAGGTGACAGG + Intergenic
906150269 1:43583506-43583528 TAGGCGAGGAGGGCGGTGAAAGG - Intronic
907873340 1:58463269-58463291 TAGCTGAGTGTGGAGGTGACAGG + Intronic
919235576 1:194837991-194838013 GGGGCGTGTTTGGAGGTGATTGG + Intergenic
923619360 1:235565353-235565375 TAGCCGGGCATGGTGGTGATGGG + Intronic
1062960689 10:1571635-1571657 CAGGTGAGTATGCAGGTGAGTGG + Intronic
1064049734 10:12049656-12049678 TGGGCGAGGAGGGAGGTGAAGGG + Intergenic
1070180771 10:74011416-74011438 TAGGAGAGTAGGGAGGAGAGGGG - Intronic
1071552195 10:86575134-86575156 AAGGCCAGTAGGGAGGTAATGGG - Intergenic
1071841241 10:89473969-89473991 TAGGTGGGTATGGTAGTGATGGG - Intronic
1073888714 10:108071747-108071769 AAGGCGAGTTTGGAGGTGATAGG - Intergenic
1074112531 10:110432721-110432743 TAGCCGAGTATGGTGGTGGGCGG - Intergenic
1076010563 10:126984942-126984964 TAGGGGAGTGGGGAGATGATGGG - Intronic
1077634758 11:3834809-3834831 TAGGCGAGTATGGAGGTGATGGG + Intronic
1101833183 12:108275137-108275159 TAGGAGAGTATGGAGGAGTGAGG - Intergenic
1104947730 12:132424076-132424098 TAGGCGAGGGTGGAGGTCACTGG - Intergenic
1109821306 13:67659103-67659125 TGGGTGAATATGGAGGTGAAAGG - Intergenic
1112363556 13:98738751-98738773 TAGGGCAGTATGGAGGGGAAAGG + Intronic
1117116283 14:52516735-52516757 TAGGAGAGTATGTGGGGGATGGG - Intronic
1119890857 14:78181101-78181123 TAGGTAAGTGTGGAGGTAATTGG + Intergenic
1120308142 14:82796583-82796605 TAGGCAAGAATGGAGGTGCAAGG + Intergenic
1120474846 14:84974235-84974257 TAGGCAAGTTTGGGGATGATTGG + Intergenic
1121701646 14:95959186-95959208 TACGTGAGAATGGAGGTGAATGG + Intergenic
1125800267 15:42439952-42439974 TAGGAGTGTATGTAGGTGATGGG - Intronic
1129169958 15:73801600-73801622 TTGGGGAGTATGGAAGTGGTGGG + Intergenic
1133441223 16:5822599-5822621 TGGGCAAGAATTGAGGTGATAGG + Intergenic
1134217675 16:12328801-12328823 TAGGCAAAGATGGAGTTGATTGG + Intronic
1144647940 17:16988067-16988089 TAGGTCAGGATGGACGTGATGGG - Intergenic
1152148520 17:78584232-78584254 TAGGCGAGTGTGGTGGAGATTGG - Intergenic
1160379915 18:78446363-78446385 CAGGCAAGTAAAGAGGTGATGGG + Intergenic
1163748885 19:19063883-19063905 TTGGCGAGTATGAAGCAGATGGG - Intergenic
1165476015 19:36031548-36031570 TAGGAGGGTATGGAGCTGAGAGG - Intronic
929809630 2:45178793-45178815 GAGGGGAGGATGAAGGTGATGGG + Intergenic
940554732 2:155209012-155209034 TAGGTGAGTCAGGTGGTGATGGG + Intergenic
941917590 2:170822611-170822633 TAGGCGATGATGTAGGGGATGGG - Intronic
942258372 2:174130345-174130367 TATGCGTGTATGGGGGTGAGGGG + Intronic
948889478 2:240900043-240900065 TGGGGGAGGAAGGAGGTGATGGG + Intergenic
1169351737 20:4873600-4873622 TAGGCAAGTATAGAGCTGCTTGG - Intronic
1172242519 20:33422934-33422956 TAGGGGACTGCGGAGGTGATGGG - Intronic
1174851589 20:54000588-54000610 TAGGCTAGTAGGCAGGTAATTGG - Intronic
1175277799 20:57783665-57783687 TAGGGGGGTAAGGAGGTGACGGG - Intergenic
1180993145 22:19950715-19950737 TAGGGAAGTATGGAGGTGATAGG + Intronic
1184453075 22:44594380-44594402 TAGGTGAGGAGGGAGGTGGTCGG - Intergenic
1184522838 22:45006015-45006037 TGGGAGAGTTTGGTGGTGATTGG - Intronic
953960696 3:47263684-47263706 GAGGCCAGGATGGGGGTGATGGG - Intronic
955905748 3:63805999-63806021 GAGGTGAGTATGGAGGAAATGGG - Intergenic
959002688 3:100982748-100982770 TAGGGGAGTTTGGAGAGGATGGG + Intronic
959443183 3:106404764-106404786 TAGGCCAGTATGTTGTTGATTGG - Intergenic
964898988 3:161634629-161634651 TAAACGAGTAGTGAGGTGATAGG + Intergenic
967311793 3:188113213-188113235 GAGGCAAGTCTGGAGGGGATTGG - Intergenic
972080941 4:35148085-35148107 TAGGAGAATATGGAGGGGATAGG + Intergenic
974149235 4:57984414-57984436 TAGATGAGTTTGGAGGTGGTAGG + Intergenic
975849046 4:78552582-78552604 TAGGAAAGTATGCAGGTGCTGGG + Intronic
976319484 4:83696670-83696692 TAGGCTACTATGTAGGTCATTGG + Intergenic
979126224 4:116975646-116975668 TAGGGGATTATGGAGATTATGGG + Intergenic
983645970 4:169991823-169991845 GAGGAGATTATGGAGGTGGTTGG - Exonic
988035260 5:25819850-25819872 TAGGCTAGTTTGGAGGTAAAAGG + Intergenic
998365773 5:141629840-141629862 GAGGTGAGTGAGGAGGTGATGGG - Exonic
999663377 5:153888668-153888690 GAGGCCAGTAGGGAGGTGAGAGG + Intergenic
1001547516 5:172579732-172579754 CAGGTGAGGATGGAGGTGAGTGG - Intergenic
1006181484 6:32155769-32155791 TGGGACAGTATGGAGGTGAGTGG + Exonic
1011559822 6:88602986-88603008 TAGGAGGAAATGGAGGTGATGGG - Intergenic
1014521918 6:122454706-122454728 TAGGCGCTTATGGAGATCATTGG + Intronic
1015986578 6:138890392-138890414 TAGGTAAGGATGGAGGTGAGGGG - Intronic
1018512506 6:164540578-164540600 TAGGCGATAATGCAAGTGATGGG - Intergenic
1022224102 7:28345691-28345713 TGGGCAAGTCGGGAGGTGATTGG + Intronic
1024752499 7:52484274-52484296 TGGGCGAGTATGGTGGAGAATGG + Intergenic
1026986891 7:74560302-74560324 TAGGCGAGGTTGGAGGTGAGTGG + Intronic
1028862506 7:95669338-95669360 TAGTCGAGTATAGAGATGAAAGG + Intergenic
1032146959 7:129392512-129392534 AAGGTGATTATGGAAGTGATTGG - Intronic
1033285405 7:140037001-140037023 TAGGCGACTTTGGAGTTGATGGG - Intronic
1035142681 7:156778935-156778957 TATGCAAGAATGGAGTTGATAGG - Intronic
1036504077 8:9339411-9339433 TAGGTGAGGGTGGAGGTGGTGGG + Intergenic
1037329605 8:17731344-17731366 TATGTGAGAATGGGGGTGATAGG + Intronic
1037960027 8:23090515-23090537 TAGGCAATTATGGTGGTGAGGGG - Intronic
1038437496 8:27546195-27546217 AAGGCGAGTATGCAGCTGACCGG - Intergenic
1040378293 8:46847730-46847752 TAGGGAAGCATGTAGGTGATAGG + Intergenic
1042864877 8:73348495-73348517 TAAGCGGGTAGGGAGGGGATAGG + Intergenic
1051379872 9:16445618-16445640 GAGGAGAGTAGGGATGTGATTGG - Intronic
1053446966 9:38159967-38159989 TGGGTGAGGATGGAGGTGCTGGG - Intergenic
1054936203 9:70691487-70691509 TGGGAGAGTATGGAGTTGAGTGG - Intronic
1055492079 9:76815547-76815569 TAGGGGACTAGGGAGGTGATTGG - Intronic
1059801165 9:117750819-117750841 CAGGTGGCTATGGAGGTGATTGG - Intergenic
1197799556 X:130335311-130335333 TAGTCGAGTATGGTGGTGCATGG + Intergenic