ID: 1077637955

View in Genome Browser
Species Human (GRCh38)
Location 11:3856042-3856064
Sequence GGTCCAACAGTGGGTCCGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 42}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077637955_1077637970 28 Left 1077637955 11:3856042-3856064 CCCGGCGGACCCACTGTTGGACC 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1077637970 11:3856093-3856115 AACTTGGAGCACTTGACCTTTGG 0: 1
1: 0
2: 0
3: 7
4: 116
1077637955_1077637964 12 Left 1077637955 11:3856042-3856064 CCCGGCGGACCCACTGTTGGACC 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1077637964 11:3856077-3856099 CCTCCTCCCGCACCCAAACTTGG 0: 1
1: 0
2: 0
3: 8
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077637955 Original CRISPR GGTCCAACAGTGGGTCCGCC GGG (reversed) Exonic