ID: 1077649803

View in Genome Browser
Species Human (GRCh38)
Location 11:3960085-3960107
Sequence TGCTGCATGTAGAAGTTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077649802_1077649803 25 Left 1077649802 11:3960037-3960059 CCTTTTAGTATTCTGTGTGATGA 0: 1
1: 0
2: 2
3: 16
4: 237
Right 1077649803 11:3960085-3960107 TGCTGCATGTAGAAGTTTGATGG 0: 1
1: 0
2: 0
3: 22
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077649803 Original CRISPR TGCTGCATGTAGAAGTTTGA TGG Intronic
906028635 1:42698421-42698443 TGCTGGATGTTGAAGATAGATGG + Intronic
906915600 1:50005596-50005618 TGATGCTTGTAGATGTTTGTTGG - Intronic
908353275 1:63307215-63307237 TTCTGCTGGTAGAAGTTTCAAGG - Intergenic
913965401 1:143373091-143373113 TGCTGCATGTTAAAGCTGGAAGG - Intergenic
914059776 1:144198693-144198715 TGCTGCATGTTAAAGCTGGAAGG - Intergenic
914119374 1:144767678-144767700 TGCTGCATGTTAAAGCTGGAAGG + Intergenic
917453540 1:175166841-175166863 TCCTGCCTGGAGAAGGTTGAGGG + Intronic
917955273 1:180090147-180090169 ACTTGCATGTAAAAGTTTGAAGG + Intronic
919019206 1:192082234-192082256 TTCTGCATGTTGAAGTTTCAGGG - Intergenic
919494077 1:198242238-198242260 TGCTGCATGGAGAACTGGGAAGG - Intronic
919942658 1:202298894-202298916 TGCCTCATCCAGAAGTTTGAAGG + Intronic
919955878 1:202415103-202415125 TGCTGCATTTTGAGGTATGATGG - Intronic
1064236087 10:13577039-13577061 TGCTGCATACAGAAGTATGATGG + Intergenic
1064384872 10:14880665-14880687 TGCTGCTTACAGAAATTTGAGGG + Intronic
1065371458 10:24991274-24991296 TGAAGCATGTAGAAGGTAGAAGG - Intronic
1066505727 10:36040361-36040383 TGCTGCATGTAGAGTTTTATAGG + Intergenic
1068338228 10:55666247-55666269 TGCTGCATGTATTATTTGGAAGG - Intergenic
1070401086 10:76054242-76054264 TGCTGCTTGGAGAGGTGTGAGGG - Intronic
1070570263 10:77636014-77636036 TGTGCCCTGTAGAAGTTTGAGGG + Intronic
1072056708 10:91765490-91765512 TGCTGCAAGTAGCTGGTTGATGG + Intergenic
1077649803 11:3960085-3960107 TGCTGCATGTAGAAGTTTGATGG + Intronic
1078524904 11:12092812-12092834 TGCTGCAAGTGGAATTTGGAGGG + Intergenic
1079026387 11:16951245-16951267 TGCTGCATGGAGGAGGCTGAAGG - Intronic
1080481608 11:32657179-32657201 TGTAACATGTAGAACTTTGAAGG - Intronic
1081520088 11:43873206-43873228 TGCTGGATGGCGAAGTTTGCTGG + Intergenic
1084027734 11:66463058-66463080 TCCTGTCTATAGAAGTTTGAGGG - Intronic
1085866144 11:80295872-80295894 TGCTGCATATTGAAATATGATGG - Intergenic
1085928463 11:81052177-81052199 TGCTGCATGGTGTAGTGTGAGGG - Intergenic
1088162109 11:106884677-106884699 TACTGAATGGAGAAGTTTGATGG + Intronic
1088482242 11:110305648-110305670 TGCAGTAGATAGAAGTTTGATGG + Intergenic
1089031309 11:115332278-115332300 TGGGGCAGGTAGAAGTTAGAAGG + Intronic
1095608148 12:44095437-44095459 TTCTGCAAATAGAAATTTGATGG + Intronic
1096451170 12:51743260-51743282 TGATGCTTGTAGATGTTTGTTGG + Intronic
1098324899 12:69291003-69291025 CTCTGCAGATAGAAGTTTGAAGG - Intergenic
1099260678 12:80377716-80377738 TGCAACATGCAGAAGCTTGAGGG + Intronic
1100805991 12:98284094-98284116 GGCTGAATGTAGAGGTTTGAGGG - Intergenic
1104271000 12:127282194-127282216 AGCTGAAGGTACAAGTTTGAAGG - Intergenic
1105966714 13:25391264-25391286 TACTGCAGGTTGAAGTATGAAGG - Intronic
1106898492 13:34330701-34330723 TGCTGCAAGCTGAAGTTTAAGGG + Intergenic
1107100075 13:36580808-36580830 TTTGGCCTGTAGAAGTTTGAAGG - Intergenic
1108004616 13:45934376-45934398 GGCTGCATGTAGATGGCTGAAGG + Intergenic
1108310526 13:49184961-49184983 GGCAGCATGGAGAGGTTTGAGGG + Intronic
1108334513 13:49425937-49425959 TCCTACTTGTAGAAGTTTGGGGG + Intronic
1110428739 13:75399184-75399206 TCCTGCCTATAGAAGTTTGGGGG - Intronic
1110527816 13:76559735-76559757 TGCTGCATTTAGAAGTGTCCTGG - Intergenic
1111521393 13:89409526-89409548 TCCTGCAAGTAGTAGTTTGGGGG + Intergenic
1113172296 13:107518369-107518391 TGGGGCATCTAGGAGTTTGAGGG + Intronic
1114036079 14:18628898-18628920 TGCTATATGCCGAAGTTTGACGG + Intergenic
1114122559 14:19686133-19686155 TGCTATATGCCGAAGTTTGACGG - Intergenic
1114443455 14:22769728-22769750 TTCTGCAGCTAGAAGGTTGAAGG - Intronic
1116085725 14:40235876-40235898 TGATGCTTGTAGATGTTTGTTGG + Intergenic
1117124644 14:52609456-52609478 TGATGCTTGTGGAAGTATGACGG + Intronic
1117750704 14:58920441-58920463 TGTTTCATGTAGAAGGTTTATGG - Intergenic
1118118098 14:62804210-62804232 TGCTGCCTATAGAAATTTGAGGG - Intronic
1118231455 14:63954292-63954314 CCCTGTATGTAGAAGTTTAAAGG + Intronic
1120060060 14:79971723-79971745 TATTGCATCTAGAAGTATGAGGG + Intergenic
1125276841 15:38002902-38002924 TGATGCTTGTAGATGTTTGTGGG + Intergenic
1130032188 15:80326333-80326355 TGCTGTTTGTGGAAGTGTGAGGG + Intergenic
1130666597 15:85874571-85874593 GGCTCCATATAGAAGTCTGAGGG - Intergenic
1133550887 16:6853598-6853620 TACTGTATGAAGCAGTTTGATGG + Intronic
1137625936 16:49908614-49908636 TGCTTCTTGGAGGAGTTTGAGGG + Intergenic
1139062977 16:63277849-63277871 TGCTGGAAGTGGAAGTTAGAAGG + Intergenic
1139576576 16:67846285-67846307 CCCTGACTGTAGAAGTTTGAGGG + Intronic
1140142242 16:72269488-72269510 GGCTTCATGTTGAAGTTTGAAGG - Intergenic
1141198555 16:81879787-81879809 TGGTGCAAGTAGAAGCTGGAGGG + Intronic
1149335298 17:55629515-55629537 TGCTGCTTATAGAAGTTTTGGGG - Intergenic
1149854528 17:60068919-60068941 GGCTGCTTTTAGGAGTTTGAGGG - Intronic
1151687149 17:75654580-75654602 TGCTGTATGTGGAAACTTGAAGG - Intronic
1152976130 18:220511-220533 TGCTGCTGGTAGGAGTCTGATGG - Intronic
1153417579 18:4865590-4865612 TACTGCATGGAGCAGTTTGAGGG + Intergenic
1157098639 18:44710225-44710247 TGCTGCATTTTGTAGCTTGAAGG - Intronic
1161688456 19:5716308-5716330 TGGTGCCTGCAAAAGTTTGAGGG - Intronic
1161785736 19:6324441-6324463 TGGTGCAGGTGGAAGTTTCAAGG - Intronic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1166228707 19:41413143-41413165 TGCTGCATGTCCAAGCTTCATGG + Intronic
1202699180 1_KI270712v1_random:150579-150601 TGCTGCATGTTAAAGCTGGAAGG - Intergenic
926160342 2:10483514-10483536 TGCTGTATGTGGAAGTGGGAAGG - Intergenic
926310627 2:11672737-11672759 TGCTGCATATGGAAGTACGATGG + Intergenic
928834527 2:35528146-35528168 TGCTGCTTTTAGGATTTTGAGGG + Intergenic
933385191 2:81601738-81601760 TGCTGCGTGTAGAAATTTATTGG - Intergenic
933984675 2:87580737-87580759 GGCTGCAGGTAGGAGTTTGATGG + Intergenic
934170129 2:89534064-89534086 TGCTGCATGTTAAAGCTGGAAGG - Intergenic
934280431 2:91608372-91608394 TGCTGCATGTTAAAGCTGGAAGG - Intergenic
934583139 2:95463436-95463458 TGCTGCATGCCTAAGCTTGAAGG + Intergenic
934596311 2:95613278-95613300 TGCTGCATGCCTAAGCTTGAAGG - Intergenic
936143943 2:109966573-109966595 TGATGCAAGCAGAGGTTTGATGG - Intergenic
936180625 2:110264534-110264556 TGATGCAAGCAGAGGTTTGATGG - Intergenic
936200744 2:110404896-110404918 TGATGCAAGCAGAGGTTTGATGG + Intronic
936309176 2:111370063-111370085 GGCTGCAGGTAGGAGTTTGATGG - Intergenic
938274311 2:130004052-130004074 TGCTATATGCCGAAGTTTGACGG - Intergenic
938441073 2:131333210-131333232 TGCTATATGATGAAGTTTGACGG + Intronic
941621330 2:167782559-167782581 TGTTGCATTTAAAAGTCTGAAGG - Intergenic
943404271 2:187460694-187460716 AGTTGAATGTAGAAGTCTGAGGG - Intergenic
947703226 2:232253112-232253134 TGCTGCATGTAGAGGTACGCTGG - Intronic
1172102796 20:32495660-32495682 TGCAGCATGAAGAAGTTAGATGG + Intronic
1173106146 20:40136313-40136335 TGCTGCATGGAGAACCCTGAAGG + Intergenic
1173594762 20:44251543-44251565 TGCAGCATGGACAAGTTGGAGGG - Intronic
1174594438 20:51672427-51672449 TGTTACATGTAGAACTTTGAAGG + Intronic
1174706644 20:52663131-52663153 TTCTGAATGTTGATGTTTGAAGG - Intergenic
1174758823 20:53186466-53186488 TACTGCAAGTAATAGTTTGAGGG + Intronic
1177403610 21:20638040-20638062 TGCTGAATGTTGAAGTTTTGAGG - Intergenic
1177578689 21:22992076-22992098 TTTTGCTTGTAGAAGGTTGAAGG + Intergenic
1180112866 21:45672422-45672444 TTCTGCTTGTGGAAGTTTGGAGG + Intronic
1180460205 22:15555960-15555982 TGCTATATGCCGAAGTTTGACGG + Intergenic
1182758176 22:32698089-32698111 TGTTGTATGTAGAGGTTTGGGGG + Intronic
1182775106 22:32825219-32825241 TGCTGCATGTAGAGGTCTGCAGG + Intronic
951025064 3:17819028-17819050 TGCTGCATATCAAAGTATGATGG + Intronic
951603526 3:24403776-24403798 TGTTGCAGATAGAAGTTTGAGGG + Intronic
952071971 3:29648136-29648158 TTCTGGATGTAGATGTTGGATGG + Intronic
955638872 3:61060207-61060229 TGGTCTATTTAGAAGTTTGATGG + Intronic
957761578 3:84565207-84565229 TGAAGAAAGTAGAAGTTTGAAGG - Intergenic
957906237 3:86559956-86559978 TGCTGTAGGTATAAGTGTGAAGG + Intergenic
959080328 3:101794171-101794193 TGCTGGAAGTGGAAGTTTGAGGG + Intronic
960309224 3:116099918-116099940 TGCTCCATGTAGATATTTGAGGG + Intronic
960610051 3:119547442-119547464 TAATGCATGTAGAAGCTAGAGGG - Intronic
961214948 3:125152193-125152215 TGCTTCAAGTAGAAATTTGAGGG + Intronic
962626790 3:137233604-137233626 TCCTTCCAGTAGAAGTTTGAGGG - Intergenic
965189829 3:165514055-165514077 TCCTGCTTGTAAAGGTTTGAGGG - Intergenic
965769041 3:172161581-172161603 TGCTGAATGTAGAAGTTCACTGG + Intronic
965919027 3:173890141-173890163 TAATGCATGTAGAATTTTAAAGG - Intronic
967153022 3:186667049-186667071 TGCAGAATGCAGAAGTGTGATGG + Intronic
970551833 4:17189378-17189400 AGGTGCATGTAGAAATTTGTTGG + Intergenic
970804284 4:20012331-20012353 TGATGCACATTGAAGTTTGAAGG - Intergenic
970855072 4:20641744-20641766 AGCTACATGTAGAAGAATGAGGG - Intergenic
971448911 4:26781206-26781228 TGGTGCAAGTCCAAGTTTGAGGG + Intergenic
974699534 4:65422502-65422524 TTATGCTTGTAGAATTTTGATGG + Intronic
975354962 4:73391433-73391455 TTCTACATTTAGAAGTCTGAGGG - Intergenic
976385363 4:84451246-84451268 TGGACCATGTAGAAGATTGAAGG + Intergenic
976401928 4:84616801-84616823 TGCTGAATGCAGCAGTTTGAAGG + Intronic
977772101 4:100871504-100871526 TTCTGCCAGTAGAAGTCTGAGGG - Intronic
986937859 5:12913568-12913590 TGCTACTTCTAGAAGTTTAATGG - Intergenic
987626077 5:20402745-20402767 TGCTGCTTGTTGAAGTTTGGGGG + Intronic
987811826 5:22846603-22846625 TGCTGGATTTTGAATTTTGATGG + Intronic
988206695 5:28145566-28145588 AGCAGCATGTAGGAGTTTGTGGG - Intergenic
991109608 5:62883646-62883668 TGCAACATCTAAAAGTTTGAAGG - Intergenic
991622376 5:68558274-68558296 TGCTGCAGACAGAAGTGTGAAGG - Intergenic
997186394 5:131885718-131885740 TGATGCTTGTAGATGTTTGTTGG - Intronic
998292792 5:140931407-140931429 TGATGAATCTAGAAGTTAGAAGG + Intronic
998681464 5:144472439-144472461 TGCTGCATTTAGCAATTTGAAGG - Intronic
998780366 5:145649768-145649790 GACAGGATGTAGAAGTTTGATGG - Intronic
1000171736 5:158708779-158708801 TGCTGCATGTGGCAGTCTGGTGG - Intronic
1000857453 5:166417101-166417123 TGGGGCCTGTTGAAGTTTGAAGG - Intergenic
1000909022 5:166998462-166998484 TACTGCAGTTGGAAGTTTGATGG - Intergenic
1001431672 5:171667451-171667473 TGCTGCATGGAGTGGGTTGAAGG + Intergenic
1001434104 5:171686029-171686051 TGCTGTAAGTAGAAGTCTGGAGG - Intergenic
1002040127 5:176507341-176507363 TGCTGCAAGTAGCTGGTTGATGG - Exonic
1003243644 6:4366274-4366296 TGCTGCATGAAGAATCTTCATGG + Intergenic
1004851241 6:19701959-19701981 TGCTACATTTAGATGTTGGAGGG - Intergenic
1007730604 6:43943240-43943262 TCCTGCATGCAGCAGTTTGGGGG - Intergenic
1007973797 6:46079809-46079831 TGCTGAATGGTGAAGCTTGAAGG + Exonic
1009947383 6:70355715-70355737 TTCTGCAGGTAGAATTTTTATGG - Intergenic
1010999832 6:82575520-82575542 CTCTGCATGTGGAAGATTGAAGG - Intergenic
1012357249 6:98330231-98330253 TGATGCATGCTGAAGTTTGAAGG - Intergenic
1014092257 6:117417097-117417119 AGCTGCAGTTAGAAGTTTGGGGG - Intronic
1017293862 6:152772151-152772173 GTTTGCATGTAGAAGTTTTATGG + Intergenic
1018466132 6:164047432-164047454 TTCTACATGTATAAGTTTGCTGG + Intergenic
1019230975 6:170562649-170562671 TGCTGCATATAAATCTTTGAAGG + Intronic
1027702483 7:81485878-81485900 TGTTCCATGTACAAGATTGATGG + Intergenic
1028759655 7:94481727-94481749 TGTAGCAGGTAGAAGTTTAAGGG + Intergenic
1029875056 7:103741784-103741806 TGCTGCAAGAAGATATTTGAGGG + Intronic
1029962796 7:104706476-104706498 TCTTGCATGTAGGACTTTGATGG - Intronic
1031120014 7:117711740-117711762 TGCTGCATTCAGTAGTTTGATGG + Exonic
1032470563 7:132175436-132175458 TGCCCCATTTGGAAGTTTGATGG - Intronic
1037910112 8:22739242-22739264 TGCTGCATGTAGGAGGCTGCAGG + Intronic
1038351238 8:26777992-26778014 TGCCACTTGCAGAAGTTTGAGGG - Intronic
1039427898 8:37501898-37501920 TTGTGCCTTTAGAAGTTTGATGG - Intergenic
1040447433 8:47509464-47509486 TGCAGAAGGTAGAAGTTTTAAGG + Intronic
1041828864 8:62129632-62129654 TGCTCTGTTTAGAAGTTTGATGG - Intergenic
1042240175 8:66655951-66655973 TGTTTCAGGTAGAAGATTGAAGG - Intronic
1045182033 8:99794631-99794653 TTCTGCTGGTAGAATTTTGAAGG + Intronic
1045592298 8:103612336-103612358 TGATGCTTGTAGATGTTTGTTGG + Intronic
1048059425 8:130902600-130902622 TTCTGCATTTGAAAGTTTGATGG - Intronic
1050051061 9:1602105-1602127 GGCTGCATTTGGAAGTTGGAAGG - Intergenic
1055371916 9:75608901-75608923 TGCTGCATATTGAAGTATGGTGG + Intergenic
1057326091 9:94065470-94065492 TACTGTATGGAGAACTTTGAAGG + Intronic
1057623597 9:96657590-96657612 AGCTATGTGTAGAAGTTTGATGG - Intergenic
1186120569 X:6356736-6356758 TGCTGCATACTGAAGTGTGATGG + Intergenic
1187334130 X:18366983-18367005 TGATGCAGGTTAAAGTTTGAGGG + Intergenic
1187932532 X:24306525-24306547 TGCTGTATGTTGGCGTTTGAGGG - Intergenic
1188218382 X:27508231-27508253 TGCTAAATGTACAAGTTTAAGGG + Intergenic
1188485144 X:30674316-30674338 TGCTTCATGGAGAAAGTTGAGGG + Intronic
1189013284 X:37069718-37069740 TGATGCTTGTAGATGTTTGCTGG + Intergenic
1189893417 X:45629103-45629125 TGATGAATGTAGAAGTTTTGAGG + Intergenic
1191930031 X:66361830-66361852 TGCTGCATGTCTGAGTGTGACGG - Intergenic
1192402075 X:70845899-70845921 TGTTGCATATCGAAGTGTGATGG - Intronic
1193968684 X:88022786-88022808 TGCTGCTGGTAAAAATTTGAAGG - Intergenic
1195165577 X:102216140-102216162 TCCTGCATGTAAAAATTAGAGGG - Intronic
1195193281 X:102470951-102470973 TCCTGCATGTAAAAATTAGAGGG + Intronic
1195622678 X:106973003-106973025 TCCTGACTGTAGAATTTTGAGGG - Intronic
1195942104 X:110175234-110175256 TCCTACATGTAGCAGTTTGACGG - Exonic
1197532738 X:127650215-127650237 GGATACATGTACAAGTTTGAGGG - Intergenic
1199362676 X:146941682-146941704 TGATGCTTGTAGATGTTTGTTGG + Intergenic
1199485238 X:148339364-148339386 TGATGCTTGTAGATGTTTGTCGG - Intergenic
1199657165 X:150007537-150007559 TAATGCATGAGGAAGTTTGAAGG + Intergenic
1200886658 Y:8278584-8278606 TACTGTATGTAGAAGTCTGGGGG - Intergenic
1201477474 Y:14398377-14398399 TGCTGCATACTGAAGTGTGATGG - Intergenic
1202578726 Y:26356075-26356097 TGCTGCATTTTGAGGTATGATGG + Intergenic