ID: 1077651353 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:3975624-3975646 |
| Sequence | AAGAAGAAGAAGAAGGAAGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 7563 | |||
| Summary | {0: 12, 1: 84, 2: 343, 3: 1478, 4: 5646} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1077651350_1077651353 | 15 | Left | 1077651350 | 11:3975586-3975608 | CCAGATTGGGCAACAAAGTGAGA | 0: 6 1: 197 2: 5418 3: 48777 4: 112821 |
||
| Right | 1077651353 | 11:3975624-3975646 | AAGAAGAAGAAGAAGGAAGAAGG | 0: 12 1: 84 2: 343 3: 1478 4: 5646 |
||||
| 1077651349_1077651353 | 25 | Left | 1077651349 | 11:3975576-3975598 | CCACTGCATTCCAGATTGGGCAA | 0: 2 1: 247 2: 7660 3: 89537 4: 199407 |
||
| Right | 1077651353 | 11:3975624-3975646 | AAGAAGAAGAAGAAGGAAGAAGG | 0: 12 1: 84 2: 343 3: 1478 4: 5646 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1077651353 | Original CRISPR | AAGAAGAAGAAGAAGGAAGA AGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||