ID: 1077651353

View in Genome Browser
Species Human (GRCh38)
Location 11:3975624-3975646
Sequence AAGAAGAAGAAGAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7563
Summary {0: 12, 1: 84, 2: 343, 3: 1478, 4: 5646}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077651350_1077651353 15 Left 1077651350 11:3975586-3975608 CCAGATTGGGCAACAAAGTGAGA 0: 6
1: 197
2: 5418
3: 48777
4: 112821
Right 1077651353 11:3975624-3975646 AAGAAGAAGAAGAAGGAAGAAGG 0: 12
1: 84
2: 343
3: 1478
4: 5646
1077651349_1077651353 25 Left 1077651349 11:3975576-3975598 CCACTGCATTCCAGATTGGGCAA 0: 2
1: 247
2: 7660
3: 89537
4: 199407
Right 1077651353 11:3975624-3975646 AAGAAGAAGAAGAAGGAAGAAGG 0: 12
1: 84
2: 343
3: 1478
4: 5646

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077651353 Original CRISPR AAGAAGAAGAAGAAGGAAGA AGG Intronic
Too many off-targets to display for this crispr