ID: 1077660718

View in Genome Browser
Species Human (GRCh38)
Location 11:4066172-4066194
Sequence CAGAGCTAACCCAGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 239}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077660718_1077660724 19 Left 1077660718 11:4066172-4066194 CCAGCTTCCCTGGGTTAGCTCTG 0: 1
1: 0
2: 1
3: 29
4: 239
Right 1077660724 11:4066214-4066236 CTGTTCTCCTGAAACCTCCATGG 0: 1
1: 0
2: 1
3: 24
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077660718 Original CRISPR CAGAGCTAACCCAGGGAAGC TGG (reversed) Intronic
901136000 1:6995981-6996003 GAGAGCTCACCAAGGGAGGCGGG + Intronic
903974673 1:27141699-27141721 CAGTGCTCAGTCAGGGAAGCGGG + Intronic
904126811 1:28246415-28246437 CAGAGCTAACCAATGGTAACAGG + Intronic
904212980 1:28897918-28897940 CAGAGTGAGCCCAGGGGAGCAGG + Intronic
904262503 1:29297781-29297803 CAGGACTGACCCAGGGAAGTCGG + Intronic
904344112 1:29856930-29856952 CAGAGCTCCCCCAGAGAGGCAGG - Intergenic
905338851 1:37264554-37264576 CAGGCCTAACCCAGAGCAGCAGG + Intergenic
905657618 1:39695218-39695240 CAGAGAAAACCCAGGGAATCAGG - Intronic
906544610 1:46612281-46612303 CAGAGGGAACCCCGGGAGGCTGG + Intronic
907113161 1:51945669-51945691 CAGGGCAGACCCTGGGAAGCTGG - Intronic
907462755 1:54615040-54615062 CAGAGCTAACTCAGAGAAGAAGG + Intronic
911002580 1:93180912-93180934 CAGAACTCCCCCAGGTAAGCCGG - Intronic
913690311 1:121273538-121273560 AAGAGTCATCCCAGGGAAGCAGG + Intronic
914147231 1:145006421-145006443 AAGAGTCATCCCAGGGAAGCAGG - Intronic
916199255 1:162254502-162254524 CAGAGCTAAAGCTGGCAAGCTGG + Intronic
920103202 1:203531247-203531269 CAGAGCTAGCCCAGGGAGACAGG + Intergenic
920477631 1:206292026-206292048 AAGAGTCATCCCAGGGAAGCAGG + Intronic
921068893 1:211642837-211642859 GAAAACTAACCCAGGGAAGCAGG + Intergenic
921328728 1:214014360-214014382 CAGAGCTAAACCATGGTAGAGGG + Intronic
921749053 1:218771460-218771482 CAGAGGAAAGCCAGGAAAGCCGG + Intergenic
922421751 1:225465213-225465235 AAGTGCTTACCCAGAGAAGCAGG + Intergenic
922619218 1:226980158-226980180 CAGAGCTCAGCCAGGGTGGCCGG - Intronic
923945371 1:238880759-238880781 CAGAGCTACCCCTGGGAAGAAGG + Intergenic
1062897605 10:1116235-1116257 CAGAGATGACCCAGGGCAGGGGG - Intronic
1063923881 10:10958435-10958457 CAGAGCTAGCACAGGGAATGTGG + Intergenic
1064846642 10:19662825-19662847 CAGAGATCACCCAGGTAAGTGGG + Intronic
1065736441 10:28756931-28756953 CAGAGCCAACTCAGGGACACAGG - Intergenic
1065845801 10:29742220-29742242 CAGAGAGAAACCAAGGAAGCTGG - Intergenic
1066299864 10:34087091-34087113 GAGAGCTGCCCCAGTGAAGCAGG - Intergenic
1067052774 10:43032334-43032356 CAGAGCACACCCAGCAAAGCAGG + Intergenic
1067295430 10:44972881-44972903 CAGAGCTAGCCCAGGCATCCAGG + Intronic
1067847037 10:49732819-49732841 AAGAACTAACCCTGGGATGCCGG - Intergenic
1069832429 10:71289468-71289490 CAGAGCTGACGCAGGGCAGCGGG - Intronic
1070127196 10:73631995-73632017 CAGAGCTCAGCCAGGGAATAGGG + Exonic
1070935952 10:80295386-80295408 CAGACCAAACCTAGGGAAGAAGG + Intergenic
1071338930 10:84624740-84624762 CACAACAAACCCAGTGAAGCTGG + Intergenic
1072005969 10:91247887-91247909 CCCAGCTAACTCAGGGAACCAGG - Intronic
1072801449 10:98395074-98395096 CAGAGCTCACCCAGTGAGCCAGG - Intronic
1075073702 10:119336264-119336286 CACAGTTTGCCCAGGGAAGCTGG + Intronic
1075516030 10:123109014-123109036 GAGAGCTGCCCCAGGGAAGCTGG - Intergenic
1077171432 11:1168003-1168025 CAGGGCAAACCCCGGGAAGAGGG + Intronic
1077497685 11:2894322-2894344 CTGGGGTAACCCAGGGAAGGGGG - Intronic
1077660718 11:4066172-4066194 CAGAGCTAACCCAGGGAAGCTGG - Intronic
1077798191 11:5512969-5512991 TAGAGGAAAACCAGGGAAGCAGG - Intronic
1077868143 11:6239919-6239941 CAGTGCTCACCCCGGAAAGCCGG + Intronic
1078397026 11:10990259-10990281 CAGTGCTACCCCAGGAAGGCAGG - Intergenic
1078454310 11:11463142-11463164 CAGTGATAACTGAGGGAAGCAGG - Intronic
1081734306 11:45392511-45392533 CAGAGGTAACCCCAGAAAGCTGG - Intergenic
1083292658 11:61698577-61698599 GTGAGCTTCCCCAGGGAAGCAGG - Intronic
1083776371 11:64896075-64896097 CAGAAGGACCCCAGGGAAGCTGG - Intronic
1084117418 11:67050294-67050316 CTGAGCTCACCCAGGCCAGCAGG + Exonic
1084694946 11:70747299-70747321 CAGAACTAGCCCTGGGCAGCAGG + Intronic
1084757136 11:71246721-71246743 CATAGCTATCCCCCGGAAGCTGG + Intronic
1085742577 11:79089572-79089594 CCCAGCTAACCCAAAGAAGCAGG + Intronic
1086143480 11:83524675-83524697 CAGAGATAACGCAGAGAAGTTGG - Intronic
1088119590 11:106352311-106352333 TGGAGCTAATACAGGGAAGCAGG + Intergenic
1088533033 11:110831056-110831078 AAGAGCTAACCCAAGAAGGCAGG - Intergenic
1088756654 11:112890592-112890614 CTTAGCCAACCCATGGAAGCAGG - Intergenic
1089008024 11:115108777-115108799 CAGAGCAGACACAGGGTAGCGGG - Intergenic
1089526634 11:119101373-119101395 CAGAACTAACCCAGGCAGCCTGG - Intronic
1089557400 11:119321809-119321831 CAGGGCTACCCCTGGGATGCTGG - Intergenic
1091568624 12:1665129-1665151 CAGGGCTGGCACAGGGAAGCTGG - Intergenic
1091603786 12:1933923-1933945 CAGAGCCAAACCAGGGCTGCAGG + Intergenic
1091930077 12:4388953-4388975 TAGAGCTAAGCCAGGGAAGAGGG + Intergenic
1092241566 12:6839236-6839258 CTGAGCTGACCCAGGGAAGGTGG + Intronic
1094409387 12:30152720-30152742 CAGTGCTAACTCAGTGAAGCAGG + Intergenic
1096076847 12:48811242-48811264 CAGAGGTTAGTCAGGGAAGCTGG - Intergenic
1097960971 12:65531704-65531726 CTGAGCTAACCCAGGGTAAGGGG - Intergenic
1099719384 12:86341692-86341714 CTGAGCCAACCCAGGGCAGATGG + Intronic
1100005497 12:89890602-89890624 CAGAGTTAACCTTGGGAGGCAGG + Intergenic
1100778372 12:97997122-97997144 CAAAGCTAACACAGGGATCCAGG - Intergenic
1101287394 12:103329102-103329124 CAGAGCTATGGCAGGGACGCAGG + Intronic
1101287398 12:103329133-103329155 CAGAGCTATGGCAGGGACGCAGG + Intronic
1101436344 12:104668018-104668040 TAGAGCCAACCCACAGAAGCTGG + Intronic
1101731224 12:107428216-107428238 CAGGGCTTAGCCAGGTAAGCTGG - Intronic
1103325100 12:120115264-120115286 CAGAGCTAGGTCAGGGAAGTGGG - Intronic
1103507987 12:121454282-121454304 CAGAGCCACCCCAGGGAGGATGG + Intronic
1104373411 12:128243748-128243770 CAGTACAAACCCAGGGAGGCAGG - Intergenic
1104871024 12:131996157-131996179 CACAGCAAACACAGGGAACCAGG - Intronic
1105473811 13:20714428-20714450 CTGGGCTAACCCAGGAGAGCTGG + Intronic
1107455516 13:40551004-40551026 CAGAGCTAACCAAGGGACTTGGG - Intergenic
1107640700 13:42440358-42440380 CAGAGCAAAACCAGTGAAACTGG - Intergenic
1108590065 13:51905448-51905470 CAGAGCAACCCAAGGGAAGCCGG + Intergenic
1111170805 13:84523914-84523936 TAGAGATTACCCAGGGAAGTAGG - Intergenic
1112952019 13:105010612-105010634 CACAGAGAAGCCAGGGAAGCTGG - Intergenic
1113743758 13:112728472-112728494 TACAGGTAACACAGGGAAGCGGG - Intronic
1115441689 14:33443088-33443110 CAGTGTTAACTGAGGGAAGCTGG - Intronic
1115640512 14:35332810-35332832 AAGAGGGAACCCAGGGAAGAAGG + Intergenic
1119176290 14:72569756-72569778 CTGAGCTAAGCAAGGGAAGATGG - Intergenic
1121122104 14:91382584-91382606 CAGAGATGACCCAGAGAAGACGG + Intronic
1121218175 14:92264524-92264546 CACGGTTAACCCAGGGAGGCTGG - Intergenic
1122153719 14:99738128-99738150 CAGAGCTGACCCAGGACAGAGGG + Intronic
1122468510 14:101950294-101950316 CAGAGATAACCCAGAGATGAGGG + Intergenic
1122870068 14:104634417-104634439 CAGAGCTGACCCAGGTCAGTCGG - Intergenic
1123196022 14:106617460-106617482 CTGAGCACACACAGGGAAGCAGG + Intergenic
1126141463 15:45442865-45442887 CAGAGCTAACCCAGAGAGCAGGG + Intronic
1126929839 15:53635213-53635235 CAGAGCTACACCAGGGAGGATGG - Intronic
1127682015 15:61306634-61306656 CTGAGCTGAACCAGGGAAGTGGG + Intergenic
1127880946 15:63157812-63157834 CAGAGCTAACCGAGAGCGGCCGG - Intronic
1127920077 15:63487511-63487533 CAGAGCTCTCCCAGGGACTCCGG - Intergenic
1128787289 15:70407139-70407161 CAGAGCTGTCCCAGGGCAGCGGG - Intergenic
1129517685 15:76166514-76166536 CAGAGCAGTGCCAGGGAAGCAGG - Intronic
1130839391 15:87683534-87683556 CAGTGCTATCCCAGGCTAGCAGG + Intergenic
1132306790 15:100820802-100820824 CCCACCTAACCCAGGGAACCTGG + Intergenic
1133110097 16:3542933-3542955 CAGAGCTGGCTCTGGGAAGCAGG + Intronic
1133310260 16:4841213-4841235 CAGAGCTTAACCAGGCAAACAGG - Intronic
1133890382 16:9873786-9873808 CAGATCTAACATAGGAAAGCAGG - Intronic
1134006606 16:10822339-10822361 CAGAACAACCCCAGGGAAGGAGG + Intergenic
1134298441 16:12967900-12967922 CAGAGCTAAGCCAGGCATGGTGG + Intronic
1140435415 16:74942883-74942905 CAGAGCACAGCCAGGGGAGCTGG + Intronic
1143381370 17:6498338-6498360 CAGAGCTAGCCTGGGGAAACGGG + Intronic
1145975077 17:28979168-28979190 ATGAGATAACCCAGGGAGGCTGG + Intronic
1146573533 17:33972972-33972994 CAGAACTAACCCAGGTCAGGTGG + Intronic
1146589624 17:34117543-34117565 GAGAGGTAACCTAGGGAACCTGG + Intronic
1146718069 17:35103118-35103140 TGTAGCTGACCCAGGGAAGCTGG + Intronic
1148393450 17:47290139-47290161 CAGAGCTTACCAAAGGAAGCTGG - Intronic
1149413417 17:56432649-56432671 AAGAGCTAATGCAGGGAACCTGG + Intronic
1149664218 17:58354483-58354505 CAGAGCTCACCCAAGGAGGGAGG + Exonic
1150505898 17:65698880-65698902 CAGTGCAAGCCCAGGGAAGAGGG + Intronic
1151162276 17:72175669-72175691 CAGAGCAAAGGCAGAGAAGCAGG - Intergenic
1151565344 17:74894306-74894328 CAGAGGTGACCCAGGGGAGCTGG + Intergenic
1151977020 17:77488895-77488917 CAGAGGGAACCCAGGGCACCCGG - Intronic
1152856725 17:82668768-82668790 TAGAGCTGCCCCAGGGCAGCGGG + Intronic
1153671261 18:7414709-7414731 CAGAGAGAAGCCAGAGAAGCGGG + Intergenic
1153690018 18:7582863-7582885 CAGAACTCACCCAGGGACACAGG - Intronic
1153887084 18:9476099-9476121 CAGGGCTTACCCAGGGGACCAGG + Intronic
1156909072 18:42389361-42389383 CAGAGGTGACCCAGGGAGGATGG - Intergenic
1157794363 18:50560444-50560466 AGGAGCTCACCCAGGGCAGCCGG - Intronic
1157925010 18:51754544-51754566 CAAAGTTAGCCCAGGGAAACTGG + Intergenic
1158314796 18:56199944-56199966 CAGGGATATCCCATGGAAGCTGG + Intergenic
1158340340 18:56459307-56459329 CAGAGCTAGCCCCCTGAAGCGGG - Intergenic
1160914592 19:1490593-1490615 CAAGACTAACCCAGAGAAGCGGG + Intronic
1161073076 19:2271977-2271999 GAGTGCTCACCCAGGGGAGCAGG + Intronic
1161073093 19:2272028-2272050 GAGTGCTCACCCAGGGGAGCAGG + Intronic
1162744041 19:12789424-12789446 CAGAGCTACTCTAGGGAAGGAGG + Intronic
1163680962 19:18682340-18682362 GAGTGGTAAGCCAGGGAAGCAGG - Intergenic
1165176954 19:33937150-33937172 CAAATCTATCCCAGGGAAACAGG + Intergenic
1166762532 19:45234184-45234206 CAGGTCTACCCCAGGTAAGCTGG - Exonic
1167437419 19:49487468-49487490 CAGAGATTCCCCAGGGAAGGCGG - Intergenic
925275609 2:2645818-2645840 CAGAGCCAACTGAGGCAAGCAGG - Intergenic
925300674 2:2809743-2809765 CAGAGATAACCAAGGGAACTAGG + Intergenic
925306237 2:2849645-2849667 CAGAGCTTCCCCAGGCAAGCAGG + Intergenic
926276975 2:11411409-11411431 CAGATCTAACACAGGACAGCAGG + Intergenic
926686023 2:15698279-15698301 CAGAGCTAGCACAGTGATGCTGG - Intronic
928347246 2:30511620-30511642 GAGAGCTCATCCAGGGAAGATGG + Intronic
931231165 2:60376051-60376073 CAGAGCTCCCCAAGGGAAGAAGG - Intergenic
931785916 2:65619402-65619424 CAGGGCTTACACAGGGAAGGAGG - Intergenic
932177919 2:69619603-69619625 CAGAGCCAAAGCAGGGAAGAGGG + Intronic
935632522 2:105223839-105223861 CAGGGCCAATCCGGGGAAGCGGG + Intergenic
935757052 2:106284442-106284464 CAGAGCAGACACAGGGAAGCTGG - Intergenic
936112509 2:109676546-109676568 CAGAGCAGACACAGGGAAGCTGG + Intergenic
936938261 2:117858895-117858917 CAGAGACAACCCGGGGTAGCTGG - Intergenic
941590618 2:167416237-167416259 CTGAGGTAACCCTGGGCAGCAGG - Intergenic
944502749 2:200378760-200378782 TATAGCTAACTCTGGGAAGCTGG - Intronic
945683517 2:212940977-212940999 CAGAACTAACCCATGGAAGAAGG + Intergenic
948467645 2:238159861-238159883 CAGGGCTGCCCCAGGGAAGCCGG + Intronic
948815405 2:240507774-240507796 CAGAACTAACCCCTGAAAGCAGG + Intronic
1169124806 20:3119938-3119960 CAGAGGTCACCCAGTGAACCAGG + Intronic
1170847493 20:19974734-19974756 CAGAGCTGACGCAGGGAGGCAGG - Exonic
1171059526 20:21942977-21942999 CAGTGCTAGCCAGGGGAAGCAGG + Intergenic
1171147488 20:22798132-22798154 CTGGGTTAACCCTGGGAAGCAGG - Intergenic
1171258800 20:23712658-23712680 TAGACCTAAACCAGAGAAGCAGG - Intergenic
1172130714 20:32652956-32652978 CAGAGCTCAGCCAGAGGAGCGGG + Intergenic
1174537222 20:51260594-51260616 CATAGGTAATCCAGGGAAGCGGG - Intergenic
1175883568 20:62274613-62274635 CAGAGCTCACTCTGGGAAGAAGG + Intronic
1176222700 20:63977636-63977658 CAGCCCTCACCCAGGGGAGCAGG + Intronic
1178692478 21:34761185-34761207 CAGTGCTAACCCTAGGAGGCGGG + Intergenic
1178822610 21:35989554-35989576 CAGAGCTGAGCCAGGGTTGCAGG + Intronic
1180027784 21:45178211-45178233 CACAGCCAAGCCAGGGAGGCAGG - Intronic
1180970339 22:19811805-19811827 GAGGGCTGACCCAGGGCAGCAGG - Intronic
1181447133 22:22986077-22986099 CACAGCTAAGCCAGGCAAGATGG - Intergenic
1183219885 22:36505860-36505882 CAGAGCTCACCTGCGGAAGCTGG - Intronic
1184461375 22:44640046-44640068 CAGAGCCAACCCAGGGTCCCAGG + Intergenic
1184461401 22:44640120-44640142 CAGAGCCAACCCAGGGTCCCAGG + Intergenic
1184572150 22:45332171-45332193 CCCAGCTAAGCCAGGGTAGCTGG - Intronic
1184741658 22:46432072-46432094 CAGTGCCAACCCAGGGCAGGTGG - Intronic
1185043537 22:48517758-48517780 CAGAGGTGGCCCCGGGAAGCAGG - Intronic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
950636691 3:14320465-14320487 CAGAGCCTACCCAGGAGAGCTGG + Intergenic
951632526 3:24737315-24737337 CAGAGCTGATCCAGGGGAGCTGG + Intergenic
953463389 3:43099302-43099324 AAGAGATCATCCAGGGAAGCTGG + Intronic
953518276 3:43618175-43618197 CACAGATAACTTAGGGAAGCTGG + Intronic
953550282 3:43896976-43896998 CAGAGAGAAACCAGGGATGCAGG + Intergenic
955933105 3:64077463-64077485 CAGAGCTGACCCAGGACAGGAGG + Intergenic
956460101 3:69463006-69463028 GAGTGCAATCCCAGGGAAGCAGG - Intronic
960465637 3:117993915-117993937 CAGATCTAAGCCAATGAAGCAGG + Intergenic
962380816 3:134897094-134897116 CAGAGTTAAGTCAGGGAACCTGG + Intronic
964230743 3:154464159-154464181 TAGAGCTGACCCTGGGAGGCTGG + Intergenic
965883182 3:173411792-173411814 CAGATGTAACCCAGAGAAGCAGG - Intronic
966250804 3:177863393-177863415 CAGAGCCTACACAGGGAAGGAGG - Intergenic
967189755 3:186975155-186975177 CAGGGTGAATCCAGGGAAGCGGG + Intronic
969252279 4:5976008-5976030 CAGAGCTTCCCCAGGCAAGCTGG + Intronic
970027575 4:11639809-11639831 CACAGATACCCCAGTGAAGCTGG + Intergenic
970311147 4:14783811-14783833 CAGAGGTAATCCAGGCAGGCAGG + Intergenic
970732554 4:19123910-19123932 CAGAGCTAGCCGAAGGAAGGAGG + Intergenic
974089062 4:57291663-57291685 CAGAGCTAACCCAGAGGAATGGG + Intergenic
974196971 4:58587687-58587709 CAGAGTTCAACCAGAGAAGCAGG + Intergenic
978479390 4:109171946-109171968 CAGAGATATCCCAGGGAATAAGG + Intronic
982169322 4:152645776-152645798 CATTGCTAATCCAGGAAAGCTGG + Intronic
982434415 4:155367269-155367291 CAGAGAAAACACAGGGAAGAAGG + Intronic
985140085 4:186831102-186831124 AAGAGCTAACACAGGGATGCAGG - Intergenic
986445408 5:7816555-7816577 CAGAAATCACCAAGGGAAGCTGG - Intronic
987245359 5:16042859-16042881 AAGAGCTCCCCAAGGGAAGCAGG + Intergenic
988690447 5:33566766-33566788 CAAACCAAACTCAGGGAAGCTGG - Intronic
992937049 5:81718605-81718627 CAGAGCTTTCCCAGTGAAGCTGG - Intronic
993707594 5:91188875-91188897 TACAGCTAACCCAGAGAAGTGGG + Intergenic
996201358 5:120678353-120678375 CAGACCTAACCATGGAAAGCTGG + Intronic
996798358 5:127375632-127375654 CAGAGCTAGAGCAGGGAAGAGGG - Intronic
997627091 5:135338480-135338502 CACAGCTATCCCAGGGACGAGGG - Intronic
998675565 5:144403972-144403994 GAGAGCTAGGCCTGGGAAGCAGG + Intronic
1002299223 5:178248078-178248100 CTGAGCAAACCCAGGGCAGTAGG - Intronic
1002843104 6:922845-922867 CAGGGTGAACCCAGAGAAGCAGG - Intergenic
1002858253 6:1056803-1056825 CAGAGCTAACACAGGGTCTCTGG - Intergenic
1003786500 6:9492878-9492900 GAGTGCTAAGCCAGGGAAGGAGG - Intergenic
1005390845 6:25331585-25331607 CAGAGCTAATCCATGGGAGTGGG + Intronic
1006512680 6:34530148-34530170 CAGAGTCCACTCAGGGAAGCAGG - Intronic
1007250337 6:40490859-40490881 CAGATCGAAGCCAGGGAAGCCGG - Intronic
1007295373 6:40816981-40817003 TAGTGCTGACCCAGTGAAGCAGG + Intergenic
1007735846 6:43981753-43981775 CAAAGGTAACCCAGGGAGCCTGG + Intergenic
1011553854 6:88554645-88554667 CAGAGCTAACCCAGAGAAAGTGG - Intergenic
1011741434 6:90364481-90364503 CAGAGCACCCCCAGAGAAGCCGG - Intergenic
1011943937 6:92877540-92877562 AAGATTTATCCCAGGGAAGCAGG - Intergenic
1020074192 7:5246979-5247001 CTTAGCTAACACAGTGAAGCTGG - Intergenic
1021141352 7:17029367-17029389 CAGAGCTAACCCAGGGAGACAGG + Intergenic
1021908892 7:25364517-25364539 CAGAGCTGTCCCAGGAAGGCTGG + Intergenic
1022015512 7:26345564-26345586 CATAGGGAACACAGGGAAGCAGG - Intronic
1022329487 7:29363874-29363896 GAGATATAAACCAGGGAAGCAGG + Intronic
1025204900 7:56986831-56986853 CTTAGCTAACACAGTGAAGCTGG + Intergenic
1025667038 7:63590104-63590126 CTTAGCTAACACAGTGAAGCTGG - Intergenic
1027358276 7:77381623-77381645 CTGAGGGAACCCAGGGAAGCAGG - Intronic
1031086554 7:117307408-117307430 GTGAGATAACCCAGGGAGGCAGG + Intronic
1031182145 7:118432774-118432796 CTGAGCTCATGCAGGGAAGCAGG - Intergenic
1034913557 7:155018190-155018212 CAGAGTTATCACAGTGAAGCAGG - Intergenic
1035225238 7:157428919-157428941 CAGAGAGCACCCAGGGAAACTGG - Intergenic
1036545766 8:9768215-9768237 CAGTGCAGCCCCAGGGAAGCAGG + Intronic
1038347711 8:26747553-26747575 CAGGGCTTGCCCAGGGAAGGTGG + Intergenic
1039228577 8:35418241-35418263 GTGAGCAAACCCAGGGAGGCAGG - Intronic
1040307611 8:46220351-46220373 CAAAGCGAACCCAGGGCCGCAGG + Intergenic
1041435232 8:57831870-57831892 CAGAGCCACCCCAGGGAGACTGG + Intergenic
1045840888 8:106579357-106579379 CAGAGCTAATCCAGGGCCTCAGG - Intronic
1045847740 8:106657876-106657898 CAGACCTGACCCAGGGGAGGCGG - Intronic
1047204916 8:122795354-122795376 CAGGGCTAGGCCAGGGAGGCAGG - Intronic
1047208797 8:122824134-122824156 CAAAGCTGACCCTGGGAGGCCGG + Intronic
1048271041 8:133028230-133028252 CTCAGGTAACCCAGGAAAGCAGG - Intronic
1049287829 8:141786104-141786126 CAGATCGAACCCAGGCAGGCTGG - Intergenic
1049410189 8:142470556-142470578 CAGACCACACACAGGGAAGCAGG - Intronic
1049813451 8:144586701-144586723 CAGAGCCTGCCCAGGGAAGGGGG + Intronic
1051739803 9:20240337-20240359 CAAAGGGAACCCAAGGAAGCTGG + Intergenic
1052223602 9:26057179-26057201 AAGAGCTCAGCCTGGGAAGCTGG - Intergenic
1053527885 9:38847935-38847957 CAGTGCTAAAACAGGGAAGAGGG - Intergenic
1054200106 9:62072371-62072393 CAGTGCTAAAACAGGGAAGAGGG - Intergenic
1054638249 9:67515989-67516011 CAGTGCTAAAACAGGGAAGAGGG + Intergenic
1055001392 9:71453512-71453534 CAGAGGAATCCGAGGGAAGCTGG - Intergenic
1055053011 9:71998578-71998600 CAGTGCTTATCCAGGGAAGGAGG + Intergenic
1057528719 9:95825321-95825343 CTGTGCTTCCCCAGGGAAGCAGG - Intergenic
1058187676 9:101874580-101874602 CAGAGAAGACCCAGGGAAGAAGG - Intergenic
1058355025 9:104074244-104074266 CAGAGCAACCTCAGGGTAGCTGG - Intergenic
1058914385 9:109551619-109551641 CAGAGCCAGCCTAGGAAAGCTGG - Intergenic
1061118571 9:128629461-128629483 CAGAGCTAACCCTGGCTCGCCGG + Intronic
1186626264 X:11296955-11296977 CAGAGCTTAAACTGGGAAGCTGG - Intronic
1190464206 X:50709411-50709433 CAGAGCTGTCCCAGGAAATCTGG + Intronic
1191712994 X:64172417-64172439 AACAGCAAACCCTGGGAAGCAGG + Intergenic
1193858863 X:86639784-86639806 CTGAGCTGACCCAGGGCAGAAGG + Intronic
1194746911 X:97638096-97638118 CAGAGTTATCCCAGGGACCCAGG - Intergenic
1196239942 X:113331665-113331687 CATAGTTAACCCAGGGAATGGGG - Intergenic
1196251514 X:113465776-113465798 CAGAGCTAGGCCAGGAAAGATGG - Intergenic
1197035127 X:121864251-121864273 CAGAGCTAATGCAGAGCAGCTGG + Intergenic
1198679779 X:139169417-139169439 CAGAGATAAGCAAGGGGAGCTGG - Intronic
1200121294 X:153792137-153792159 CAGTGATAACCTAGGGAAGGGGG - Intronic
1201329404 Y:12801848-12801870 CATAGCTAACACTTGGAAGCAGG - Intronic