ID: 1077661205

View in Genome Browser
Species Human (GRCh38)
Location 11:4070139-4070161
Sequence AAGATGATGAAGGACTTGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 357}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077661200_1077661205 2 Left 1077661200 11:4070114-4070136 CCGTTACTCCAAGGAGCACATGA 0: 1
1: 0
2: 2
3: 22
4: 186
Right 1077661205 11:4070139-4070161 AAGATGATGAAGGACTTGGAGGG 0: 1
1: 0
2: 1
3: 24
4: 357
1077661199_1077661205 8 Left 1077661199 11:4070108-4070130 CCAGAACCGTTACTCCAAGGAGC 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1077661205 11:4070139-4070161 AAGATGATGAAGGACTTGGAGGG 0: 1
1: 0
2: 1
3: 24
4: 357
1077661201_1077661205 -6 Left 1077661201 11:4070122-4070144 CCAAGGAGCACATGAAGAAGATG 0: 1
1: 0
2: 5
3: 48
4: 391
Right 1077661205 11:4070139-4070161 AAGATGATGAAGGACTTGGAGGG 0: 1
1: 0
2: 1
3: 24
4: 357
1077661197_1077661205 15 Left 1077661197 11:4070101-4070123 CCTATATCCAGAACCGTTACTCC 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1077661205 11:4070139-4070161 AAGATGATGAAGGACTTGGAGGG 0: 1
1: 0
2: 1
3: 24
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077661205 Original CRISPR AAGATGATGAAGGACTTGGA GGG Exonic
900078350 1:835866-835888 AAGATGATTCAGTACTTGCAAGG - Intergenic
900670949 1:3854450-3854472 AAGCTGATGAAAGGATTGGAGGG - Intronic
900958348 1:5902392-5902414 AAGAGGGTGTAGGACTTGGTTGG - Intronic
903879167 1:26497108-26497130 AGGATGAGGAAGGATGTGGAAGG - Intergenic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
906495911 1:46303687-46303709 AGGATCAAGAAGGACTTGTAAGG - Exonic
906511142 1:46411069-46411091 AAGAGGATGGGGGAGTTGGAGGG + Intronic
906541660 1:46591500-46591522 AACAAGAGGAAGGACATGGAAGG + Intronic
907481803 1:54750106-54750128 AAGTTGAAGAAGGAATTGGGGGG + Intergenic
908046466 1:60175243-60175265 GAGATGATGAAAAACTTTGAGGG - Intergenic
908920962 1:69191596-69191618 GAGAAGAGGAAGGGCTTGGAAGG + Intergenic
910700065 1:90063805-90063827 AAGAAAATGGAGAACTTGGAGGG + Intergenic
911181212 1:94862471-94862493 AAGGTGTTAGAGGACTTGGATGG + Intronic
911314691 1:96341674-96341696 AAGATGATAAGGTATTTGGAAGG - Intergenic
911707190 1:101027002-101027024 TATCTGATGAAGGACTTGTATGG + Intergenic
912383740 1:109261200-109261222 AAGGTGATGAAGGAGTGGGCGGG - Exonic
912585091 1:110755474-110755496 AAAAAGATGAGGGAGTTGGAAGG - Intergenic
912850680 1:113121386-113121408 AAGCTGATGAAAAGCTTGGATGG - Intronic
915003248 1:152613069-152613091 AAGATGCTGGAGGCCTGGGATGG + Intergenic
915127516 1:153676382-153676404 AAGCTGAAGAAGGTTTTGGAAGG - Intergenic
915596413 1:156898900-156898922 AAGCTGATGAAGGAAGGGGATGG + Intronic
917498892 1:175567772-175567794 AGAATGATCAAGGAGTTGGAGGG - Intronic
917670522 1:177269434-177269456 AGGCTGAGGAAGGACTTGGTGGG + Intronic
918162684 1:181915891-181915913 AAGATCATGACGGATTAGGATGG - Intergenic
918194096 1:182205960-182205982 AAGGAGAGGAAGGACTGGGAGGG - Intergenic
918744134 1:188177807-188177829 AAGATGATTAAAGACTTAAAGGG + Intergenic
919941067 1:202286640-202286662 AAGATGATTAAGAACTGGCAAGG - Intronic
921521521 1:216161276-216161298 AAGCTGATAAAGGAGTTTGAGGG - Intronic
922094712 1:222433463-222433485 AAAATTATGGAGGACTTGAATGG - Intergenic
922505941 1:226125679-226125701 CAGAAGATGCAGGATTTGGACGG + Intergenic
923889024 1:238190529-238190551 AAGAGGAAGAAACACTTGGAAGG + Intergenic
1063810125 10:9695569-9695591 CAGATGATGAGGGACTGGTATGG - Intergenic
1065203652 10:23338018-23338040 AAGATGGTCAGGAACTTGGAAGG + Intronic
1066364573 10:34764413-34764435 AAGATGAGGAAGGACTCTTAAGG - Intronic
1067014544 10:42747412-42747434 AAGATGGTAAAGAACTTGGCCGG - Intergenic
1067201693 10:44177778-44177800 AAGCTGATGAAGGGCGTTGAAGG + Intergenic
1067305090 10:45056377-45056399 AAAATGGTAAAGGACTTGGCCGG + Intergenic
1068742175 10:60485933-60485955 AAGATGATGAATGAATGAGATGG + Intronic
1070418369 10:76211132-76211154 AAGATGAGCAAAGACATGGAAGG - Intronic
1070457063 10:76627745-76627767 AATATGATGAAGGAATTCAAAGG + Intergenic
1070980722 10:80644565-80644587 AAGATTATGAAGGATTTCTATGG + Exonic
1072272497 10:93790425-93790447 GCGATGATAAAGGACTTTGACGG + Intronic
1073337904 10:102724343-102724365 AAGATGAAGAAAGTCTTGGATGG - Intronic
1075969244 10:126638632-126638654 AAAATGATGAGGGCCTTGGATGG + Intronic
1076468106 10:130699526-130699548 AAGATGAAGAGGTTCTTGGATGG - Intergenic
1076726149 10:132414297-132414319 TTGATGGAGAAGGACTTGGATGG + Intronic
1077661205 11:4070139-4070161 AAGATGATGAAGGACTTGGAGGG + Exonic
1078391971 11:10942899-10942921 AAAATGGTGAAAGATTTGGAAGG - Intergenic
1079578453 11:22031716-22031738 AATATTTTTAAGGACTTGGAAGG - Intergenic
1080754703 11:35185614-35185636 AAGAGGAAGAAGGAGATGGATGG - Intronic
1080999407 11:37649982-37650004 AAGATGATGATGGAAGTGAAAGG - Intergenic
1081291503 11:41331241-41331263 ACAATGCTGAAGGACTAGGAAGG - Intronic
1083147374 11:60769396-60769418 AGGATGGTGGATGACTTGGAAGG + Intronic
1083223579 11:61269302-61269324 AAGCTGAGAAAGGATTTGGATGG - Intronic
1083615632 11:64024729-64024751 AAGATGAGGGAGGAGTTGGGGGG + Intronic
1083630128 11:64091064-64091086 AAGATGAGGAGGGACATGGGAGG + Intronic
1084929827 11:72546132-72546154 AAGATGAGGAAGGAGGTGGCTGG - Intergenic
1087055845 11:93935535-93935557 AAGATAAAGAAGGAGTTGGCTGG - Intergenic
1087641895 11:100763963-100763985 AAGAGGAAGAAGAACTGGGAAGG - Intronic
1088547055 11:110969650-110969672 AAGAGAATGAAGGAATTGGCAGG - Intergenic
1088595397 11:111437065-111437087 CAGATGATGAGGGAGTTGAAAGG - Intronic
1088794074 11:113252446-113252468 AAGATGATGAGGTTCTTGGACGG - Intronic
1089048623 11:115526352-115526374 AAGATGATGAAGAGGCTGGAGGG - Intergenic
1090560700 11:127929006-127929028 TAGAGGCTGAATGACTTGGAAGG + Intergenic
1091239936 11:134045662-134045684 TAGATTATGTAGGACTTGGGGGG - Intergenic
1092218099 12:6696284-6696306 AAGATAATTAAGGATTTGGCTGG - Intronic
1092272482 12:7034276-7034298 TGGATGATCAGGGACTTGGAAGG + Intronic
1093451413 12:19319994-19320016 AAGATAATGAAGGAAAAGGATGG - Intronic
1094783743 12:33821871-33821893 AGGCTGATGGAGGTCTTGGAGGG - Intergenic
1095738595 12:45584740-45584762 AAGATGGTCAGGAACTTGGAAGG + Intergenic
1096745685 12:53725452-53725474 AGGATGGGGACGGACTTGGAAGG - Intronic
1096850673 12:54433843-54433865 AAGCTTATGCAGGGCTTGGATGG - Intergenic
1097045009 12:56181088-56181110 AAGGTGTTGAGGGACTGGGAAGG + Exonic
1097167565 12:57093849-57093871 AAGAGGATGAAGGAGCAGGAAGG + Intronic
1097181808 12:57175911-57175933 AAAATGATGAACGGCTTGAAGGG - Exonic
1101414978 12:104501057-104501079 AAGATCCTGAAGGACTCCGAAGG - Intronic
1101747297 12:107552669-107552691 AGAGTGATGAGGGACTTGGATGG + Intronic
1102662499 12:114541927-114541949 AAGATGCTGAAGGGCCTGGCCGG - Intergenic
1102921694 12:116796395-116796417 AAGATGATTCAGGATATGGAAGG - Intronic
1103059783 12:117849093-117849115 AAGATGATTGAGGACTAAGAAGG + Intronic
1103149392 12:118623791-118623813 AAGATCTTGAAGGAATAGGATGG + Intergenic
1104367034 12:128187392-128187414 AAGCTGAGGGTGGACTTGGAGGG - Intergenic
1104704116 12:130930229-130930251 AAGATGGTGAAGGAAGGGGATGG + Intergenic
1107053548 13:36078425-36078447 CAGATCATCAAGGGCTTGGAGGG - Intronic
1110027354 13:70557665-70557687 GAGATGATGAAGGACAATGAAGG - Intergenic
1110512701 13:76370089-76370111 AAGAATATGATGGAGTTGGAAGG - Intergenic
1111118352 13:83812729-83812751 AAGATCATGGAGGATTTGCATGG - Intergenic
1111205970 13:85011821-85011843 AAAATGATGAAGAACTGAGATGG + Intergenic
1112479148 13:99757961-99757983 CTGATGAAGAAGGACTGGGATGG + Intronic
1114070818 14:19104831-19104853 AAGATGGTAAAGAACTTGGCCGG + Intergenic
1114091443 14:19295175-19295197 AAGATGGTAAAGAACTTGGCCGG - Intergenic
1115223315 14:31078772-31078794 GTGATTATGCAGGACTTGGACGG + Intronic
1116762365 14:49030361-49030383 AAGATCATGAAGGAATTTTATGG + Intergenic
1118337307 14:64864821-64864843 AAGATGAAGAAGGAGAGGGAAGG + Intronic
1118358179 14:65032769-65032791 AAAATGCAGAGGGACTTGGAAGG + Intronic
1118739548 14:68729745-68729767 AAGATGAGGAAACACCTGGATGG - Intronic
1118843298 14:69528255-69528277 GAGGTCATGAAGGACTGGGACGG - Exonic
1120948060 14:90016408-90016430 AAGCTGAAGGAGGACTTGGGAGG - Intronic
1121461228 14:94080321-94080343 AATATGATGAAGAAACTGGATGG - Intronic
1122965802 14:105124997-105125019 CAGATGATGGAGGATTTGCAGGG - Intergenic
1123627270 15:22236432-22236454 AAGGTGATGGAGGTTTTGGAAGG - Intergenic
1123710599 15:22984296-22984318 AAGATGCTAAAGGACTTCCATGG + Intronic
1125250058 15:37691015-37691037 AATATGTTGACTGACTTGGATGG - Intergenic
1125300425 15:38249065-38249087 TAGATGATGAAGGACTAAAAAGG + Intergenic
1125555926 15:40584762-40584784 AGGATGACAGAGGACTTGGAGGG - Intergenic
1126719558 15:51562956-51562978 AAGTTATTGAAGGACATGGAAGG + Intronic
1126882176 15:53110893-53110915 AAGAAGATGAGGGACATGAAGGG + Intergenic
1127614138 15:60666678-60666700 AAGATGATGAAGGACATTCCAGG + Intronic
1127888393 15:63224791-63224813 CAGATTATGGAGGACTTGGGAGG - Intronic
1128968333 15:72084248-72084270 AAGATGAAGAAGGACAAAGAAGG - Intronic
1129623204 15:77168699-77168721 AAGATCCAAAAGGACTTGGAAGG + Intronic
1130217721 15:81987901-81987923 AAGATGATGAAGGTGTTGGCAGG - Intergenic
1130417226 15:83705243-83705265 AAGATGATGTAGGGCCTGGGTGG + Intronic
1131359301 15:91775454-91775476 AAGATGCTGAATGATTTTGATGG - Intergenic
1131671113 15:94620344-94620366 AAGATGAAGAAGGCTGTGGAGGG - Intergenic
1133460890 16:5985286-5985308 AAGATTATGATGGAGTTGGCCGG - Intergenic
1133695311 16:8257509-8257531 AAATTGATGTAGCACTTGGAAGG - Intergenic
1133722334 16:8506716-8506738 CAGATGATGAAGGGCCTGGCAGG + Intergenic
1135247602 16:20870388-20870410 AAGATGATTAAGGAGAGGGAAGG - Intronic
1138091940 16:54181987-54182009 AAGAAGAAGAAGAAGTTGGAGGG - Intergenic
1138338866 16:56274983-56275005 AAAGTAATGAAGGAATTGGAAGG + Intronic
1138880584 16:61009383-61009405 AAGCTGAAGGAAGACTTGGAGGG - Intergenic
1139202951 16:64997597-64997619 AAGAGGCTGAAGGACTGGGCAGG + Intronic
1140859624 16:79007497-79007519 AAGATGATGAAGGCCTTGTAGGG + Intronic
1142354678 16:89596867-89596889 GAGATCATGAGGGACTTGGAGGG + Exonic
1142390491 16:89796495-89796517 AAGATGAGGAAGGAATGGAAGGG + Intronic
1142619166 17:1154159-1154181 AGGATCATGAAGGACCTGGGAGG - Intronic
1143335931 17:6171480-6171502 AGGTTGAGGAAGGAGTTGGAAGG - Intergenic
1143799083 17:9363123-9363145 AAGAGGATGACAGAGTTGGATGG + Intronic
1143812972 17:9487468-9487490 AAGCTGATGATGGTCTTGGCAGG + Intronic
1143833245 17:9669640-9669662 AAGATAAGGAAGCACTTGGGAGG + Intronic
1144095912 17:11900570-11900592 AAGATGAGGGAGGCCTTGGTAGG - Intronic
1144890700 17:18492496-18492518 GACAGGATGATGGACTTGGATGG - Exonic
1145141518 17:20451822-20451844 GACAGGATGATGGACTTGGATGG + Exonic
1145809184 17:27754635-27754657 AACAGGATGATGGACTTGGATGG - Intergenic
1146222018 17:31032262-31032284 AAGAGAATTAAGGATTTGGATGG + Intergenic
1146227052 17:31076154-31076176 AAGAGTATGAAGGACTCTGATGG + Intergenic
1146338776 17:32000908-32000930 AAGATGATAAAGCATTTGAATGG + Exonic
1146529557 17:33596687-33596709 AAGAGGATGAAGGAAAAGGAAGG - Intronic
1147768214 17:42850986-42851008 AAGATAATGCAGCACTGGGAAGG - Intergenic
1148589404 17:48804710-48804732 AATAACAGGAAGGACTTGGAGGG - Intronic
1149384530 17:56128528-56128550 AAGATCCTGAAGGCCTTGCAGGG - Intronic
1149416297 17:56463350-56463372 AAGATGATGAAGTACTGGAAAGG - Intronic
1150327409 17:64268200-64268222 GGGATGATGAAGGGCTTTGAGGG + Intergenic
1150932386 17:69599275-69599297 AAGATTAAGAAGATCTTGGAAGG - Intergenic
1151176259 17:72290748-72290770 AAGAAGATGAAGGGCAGGGAGGG - Intergenic
1152171514 17:78752926-78752948 AAGATTATGAATGTCTTGGCAGG - Intronic
1153743996 18:8158307-8158329 AAGATCATGAAGCACTTGGGTGG - Intronic
1154252590 18:12756699-12756721 CAGATGGTCAGGGACTTGGAAGG - Intergenic
1154325315 18:13387001-13387023 AAGAAAATGCAGGACTTGCATGG - Intronic
1155801304 18:30107482-30107504 AAGTATATGAAGGACTAGGATGG - Intergenic
1157303704 18:46500516-46500538 AAGATGATTAAGAAATTGGTGGG - Intronic
1157440612 18:47708824-47708846 ATGATGATGAAAAACTTGGCAGG + Intergenic
1158023907 18:52873207-52873229 ATGTTGAAGAAAGACTTGGAGGG - Intronic
1158508535 18:58068813-58068835 AGGAGCATGAAGGACCTGGAGGG - Intronic
1159249558 18:65856604-65856626 AAGAAGATGAAGAACATGAAAGG + Intronic
1163059534 19:14748898-14748920 AATATGTTGCAGGACTTGGTCGG - Intronic
1164769915 19:30800520-30800542 ACGCTGATGAAAGAATTGGAAGG - Intergenic
1165816944 19:38648158-38648180 AGGCTGATGAAGGATTTGGAGGG + Intronic
1166241874 19:41499993-41500015 AAGATTTTGGAGTACTTGGAAGG + Intergenic
1168484128 19:56746592-56746614 AGGATGAGGAATGACATGGAGGG + Intergenic
925988698 2:9236109-9236131 CAGGTGATGGTGGACTTGGAGGG + Intronic
926662952 2:15488554-15488576 AATATTATCAAGGATTTGGAGGG - Intronic
927024259 2:19049343-19049365 AGGATGCTGTAGCACTTGGAAGG - Intergenic
927591853 2:24363448-24363470 AGGATGATGAAGGTCCTGGGCGG - Intergenic
928655486 2:33446845-33446867 AAAATGAGGAAGGACTGGGCCGG + Intronic
928764122 2:34621550-34621572 TAGATGTTACAGGACTTGGAGGG + Intergenic
928858376 2:35827539-35827561 AAGATGATGATGTGCCTGGAGGG + Intergenic
929497880 2:42462358-42462380 CAGGTGATGAAGGACTGGGATGG + Intronic
929718304 2:44336787-44336809 AAAATGGTGACTGACTTGGAGGG - Intronic
931904753 2:66830550-66830572 ATGATGAAGAAAGACTTGAAGGG + Intergenic
932066112 2:68562778-68562800 GAGATTATGAAGGACCTTGAAGG + Intronic
933697222 2:85228691-85228713 ATGATAAAGAAGGACTTTGAGGG - Intronic
934972971 2:98778113-98778135 ATGATTATTAAGGCCTTGGAAGG - Intergenic
935018026 2:99202457-99202479 AAGATGAGGAAGCACATGGTAGG - Intronic
935972000 2:108538809-108538831 AAGATGAAAAAGTTCTTGGAAGG - Intronic
937054509 2:118921873-118921895 AAGCTGTTGGAGAACTTGGAAGG + Intergenic
937171258 2:119871986-119872008 AAAATGATGAAAGACTTGAGAGG + Intronic
939975739 2:148715363-148715385 AAGATGATTAAAGACTTAAATGG - Intronic
942987960 2:182164354-182164376 TGGATGGTCAAGGACTTGGAAGG + Intronic
943794546 2:191975872-191975894 GAGATGATAAAGGGCTTGTATGG - Intronic
943799953 2:192045349-192045371 TAGATGGTCAAGGACTTGAAAGG + Intronic
946179106 2:217939543-217939565 GAGAAGATGAAGGTCTAGGAAGG + Intronic
946756329 2:222951522-222951544 AAAAGCAGGAAGGACTTGGAGGG - Intergenic
948458732 2:238119118-238119140 AAGTGGATGAAGGCCTTGGATGG + Intronic
948458781 2:238119301-238119323 AAATGGATGAAGGAGTTGGATGG + Intronic
1169968105 20:11239364-11239386 AAGATGATGTGGGTCTTAGAAGG - Intergenic
1170259154 20:14383074-14383096 AAGAGGATGTAAGAATTGGAGGG + Intronic
1170605757 20:17874154-17874176 AAGCAGATGAAGGAGTGGGATGG - Intergenic
1170910922 20:20567403-20567425 AGGATGATGAAGAACTGAGAAGG + Intronic
1171022172 20:21595655-21595677 AAGATGATGCAGGGCAGGGAAGG + Intergenic
1173213824 20:41060505-41060527 AAGATGGGGAATGACTGGGAAGG + Intronic
1173377176 20:42496489-42496511 AAGATGAGGAAAGACATAGAAGG - Intronic
1173474827 20:43351661-43351683 AAGAGGCTGAAGGATGTGGAAGG + Intergenic
1173747281 20:45447627-45447649 ATGTTGAAGAAGGACCTGGAAGG - Intergenic
1173749401 20:45465037-45465059 AAGATCATGAAGGACCCTGAAGG - Intergenic
1175625333 20:60484562-60484584 GAGATGATGCAGGGCTTGGAGGG - Intergenic
1175804648 20:61820749-61820771 AAGCTGATGAGGGTCTTGGGAGG - Intronic
1180489282 22:15827296-15827318 AAGATGGTAAAGAACTTGGCCGG + Intergenic
1182054877 22:27344656-27344678 AAGAGGAAGAAGCACTTGAAAGG - Intergenic
1183176431 22:36227819-36227841 AAGGTGATGAAGGAGTTTGTGGG - Exonic
1183354931 22:37353151-37353173 AAGAGGAGGAAGGACTTTGGTGG - Intergenic
1184201106 22:42970346-42970368 AAAATCATCAAGGACCTGGATGG + Intronic
1184306806 22:43608707-43608729 AAGGTGATTAAGGAGGTGGATGG - Intronic
1184742865 22:46439231-46439253 AAGGTGACGAAGGACTGGGGCGG + Exonic
949096651 3:94378-94400 GAGAAGATGATTGACTTGGAAGG - Intergenic
949126227 3:448064-448086 AAGTTGATTATGAACTTGGAAGG + Intergenic
951105646 3:18738934-18738956 ATGATGAGGAAGTACCTGGATGG + Intergenic
951666216 3:25127041-25127063 AAGATGATGATGGACCTGACTGG - Intergenic
953607846 3:44423643-44423665 AAGAAGGTGAAGGAATTTGATGG - Intergenic
954090352 3:48279217-48279239 AAGGGGATGAAGGATTTGGAGGG - Intronic
955833831 3:63031931-63031953 CAGATGCTGAAGGACCTGGTAGG + Intergenic
956865679 3:73366588-73366610 AAGATGAACAAGCAATTGGATGG - Intergenic
956874275 3:73446677-73446699 AAGCTGAGGAAGAACGTGGATGG + Intronic
957163558 3:76641490-76641512 TAGATCATGAAGGACAAGGAAGG + Intronic
958005080 3:87800240-87800262 CAGAGGAAGAAGGACTTGGAAGG - Intergenic
958025130 3:88040557-88040579 TAAATGGTGAGGGACTTGGAAGG - Intergenic
958667607 3:97160667-97160689 TAGATGATTAGGAACTTGGAAGG - Intronic
958745484 3:98128808-98128830 TGGATGATCAGGGACTTGGAAGG - Intergenic
958879920 3:99658187-99658209 CAGATGATGAAGGCCTGAGATGG - Intronic
959190922 3:103109947-103109969 AAGATGATTCAGGACTAGGCCGG + Intergenic
959248350 3:103904703-103904725 AAGTTGAGGAATGAATTGGAAGG + Intergenic
959360501 3:105384455-105384477 AAAATTCTGAAGGACTGGGAAGG - Intronic
963284538 3:143420432-143420454 AAGATGAGGCAGAACTAGGATGG - Intronic
964505794 3:157397759-157397781 TGGATGATCAGGGACTTGGAAGG - Intronic
965133345 3:164729551-164729573 AAGATGATTAAGGGTTTTGATGG - Intergenic
965166531 3:165200433-165200455 AAGACTAAGAGGGACTTGGAAGG + Intergenic
965708509 3:171533702-171533724 TGGATGATCAGGGACTTGGAAGG - Intergenic
965751128 3:171976011-171976033 AAGATGGTGAAAGACATGGCAGG + Intergenic
967464970 3:189794436-189794458 AAGATGAAGCTGCACTTGGAAGG + Intronic
969687397 4:8683338-8683360 AAGTTGGTGAAGGAATAGGAGGG + Intergenic
970199659 4:13590744-13590766 AAAATCATGCAGGATTTGGATGG - Intronic
970976078 4:22044671-22044693 AAGAGGAGGAAGAACTTGTAGGG - Intergenic
971214609 4:24651520-24651542 AATATAATCATGGACTTGGAGGG + Intergenic
971541584 4:27823923-27823945 AAGTTGGTGATAGACTTGGAAGG - Intergenic
971984527 4:33804890-33804912 AAGATGATAAAGGATTGAGAAGG + Intergenic
971997002 4:33977733-33977755 AGGATAATGAATGACTTGTAGGG - Intergenic
973128266 4:46616243-46616265 ATGATCATGGATGACTTGGAGGG + Intergenic
973582429 4:52357597-52357619 AACATGATGCAGAAGTTGGAGGG + Intergenic
974209826 4:58757074-58757096 AAGAAGATGTGGGACTTTGATGG - Intergenic
975188480 4:71431484-71431506 AAGACCATGGAGGACATGGAGGG + Intronic
976973041 4:91132312-91132334 AAGATGAATAAGGACTGTGAAGG + Intronic
977618649 4:99111781-99111803 CAGATGATCAGGGACTTTGAAGG + Intergenic
978121640 4:105086545-105086567 AAAATGATGAAGGACTACAAAGG - Intergenic
978349761 4:107809269-107809291 AAGATGATCACGGACTCAGATGG + Intergenic
979061532 4:116067632-116067654 AAAATGATGGAGGATATGGATGG + Intergenic
979081670 4:116351619-116351641 GAGGTGATGAAGGAAATGGAAGG - Intergenic
979982109 4:127269728-127269750 AAGGGGATGAAGGATTTGGGGGG + Intergenic
980178593 4:129376569-129376591 AAGATTATGAAGAACCTTGAAGG - Intergenic
980245178 4:130229618-130229640 AAGATGACCAGGGACTTGGAAGG - Intergenic
980620170 4:135291102-135291124 AAGAAGATGAAGCAGTTGTAGGG - Intergenic
983137944 4:164107937-164107959 AAGAGGATGGAGGAGGTGGAGGG - Intronic
983578382 4:169283573-169283595 AAGGAGATGAAGAACTTTGATGG - Intergenic
984160130 4:176242140-176242162 AAGATAATGTAAGAGTTGGATGG - Intronic
986766141 5:10929698-10929720 AAGAGGATTAATGATTTGGAAGG - Intergenic
987947576 5:24631579-24631601 AAGCTGAAGAGGGACTTGAAAGG - Intronic
988732810 5:33990220-33990242 ACTAGGATGAAGGACTTGTAAGG + Intronic
989632361 5:43498575-43498597 AGGATGAGGAAGGAGTTGAAAGG - Intronic
989676838 5:43982632-43982654 TGGATGATGAGGGACTTGGAAGG - Intergenic
989979939 5:50631422-50631444 AAGATAATTAGGGACTTGGAAGG + Intergenic
990035869 5:51318991-51319013 AAGATGAAGAATGCCTTTGATGG - Intergenic
990486183 5:56261292-56261314 AAGATGGTGATGGACCTCGATGG - Intergenic
991172877 5:63648807-63648829 ATGATGATCAAGGGCTAGGACGG - Intergenic
991234941 5:64383099-64383121 AAGATGATGATGAAGTTGTAAGG - Intergenic
992180751 5:74196007-74196029 AAGATCATGAAGGTTTTGAAGGG + Intergenic
993440227 5:87947728-87947750 GAAATGATGAAAGACTTGAAAGG - Intergenic
994095304 5:95842410-95842432 AACATGATGAAGCAATTGGTTGG + Intergenic
995654917 5:114414934-114414956 GAGATGATGAAAGTTTTGGAGGG - Intronic
996180176 5:120409146-120409168 ATGATAATCATGGACTTGGAAGG - Intergenic
996484362 5:124013973-124013995 AAGATGCTTAAGGTCTAGGATGG - Intergenic
997564590 5:134877168-134877190 AGGAGGATGAAGGATTTGGCAGG + Intronic
997799088 5:136841928-136841950 TACATGATAAGGGACTTGGATGG + Intergenic
998733616 5:145109388-145109410 AAAATGATGAGAGACTTGTATGG + Intergenic
999025575 5:148227749-148227771 AAGGTGTTGAAGCACTTGAAGGG - Intergenic
1001093865 5:168761300-168761322 AAGGAGCTGAAGGGCTTGGAGGG - Intronic
1001413845 5:171529249-171529271 GAGATAATGAAGTTCTTGGAGGG - Intergenic
1001584833 5:172826807-172826829 TGGATGGTGAAGGACTTTGAGGG - Intergenic
1001667285 5:173443772-173443794 AAGCAAATGAATGACTTGGAAGG + Intergenic
1001779583 5:174356366-174356388 AAAATGATGAAGAGGTTGGAAGG - Intergenic
1002214175 5:177618050-177618072 GAGATGATGAAGGCATTTGATGG - Intergenic
1002318288 5:178359826-178359848 AAGATGGAGCAGGACTGGGATGG + Intronic
1003334497 6:5157959-5157981 AAGAGGATGCAGGACTTGACAGG + Intronic
1003652188 6:7971178-7971200 AAGATGATGACAGACTTTGGGGG + Intronic
1004118403 6:12794353-12794375 AAGCAGAGGAAGTACTTGGATGG + Intronic
1004372764 6:15066794-15066816 AGGAGGAAGAAGGCCTTGGAGGG + Intergenic
1004401703 6:15294645-15294667 AGGTTGATGCAGGACATGGAAGG + Intronic
1006219718 6:32478318-32478340 AAGTTGTTGAAGGAATTGAAAGG - Intergenic
1006875018 6:37287926-37287948 AAGTTAATGAAGTACATGGAAGG + Intronic
1006933799 6:37703621-37703643 AAGAGGATGGAGAACTAGGAAGG + Intergenic
1007108809 6:39301280-39301302 AGGATGACGAAGGAATAGGAGGG - Intronic
1007316134 6:40990634-40990656 GAGTTGATGATGGACCTGGAGGG - Intergenic
1008843144 6:55928683-55928705 AGGATACTGAAGGACTTGAAGGG + Intergenic
1010777779 6:79906714-79906736 TAGATGCTCAAGGATTTGGAAGG - Intergenic
1010966693 6:82218000-82218022 AAGATGGAGAAGGATTTAGAGGG - Exonic
1011749778 6:90443434-90443456 AAGAAGTAGAAAGACTTGGAGGG + Intergenic
1011772870 6:90694392-90694414 AAGATCATGCAGGACTCTGAAGG + Intergenic
1012292135 6:97469741-97469763 AAGATGGTGAAGGGCAGGGAGGG + Intergenic
1012678605 6:102150399-102150421 GAAATGATGAAGGAATGGGATGG + Intergenic
1012817978 6:104048594-104048616 TTGATTATGAAGGAGTTGGAGGG - Intergenic
1013025976 6:106272064-106272086 AAGATGAGAAAGGACTTTGTTGG - Intronic
1014380667 6:120736964-120736986 AAGATAATGAAGGAAATGCATGG + Intergenic
1015862206 6:137692727-137692749 AGGATGATGAAGGATATGGTAGG - Intergenic
1017076031 6:150619593-150619615 CAGATGATGAAGGGCATAGAAGG + Intronic
1017249370 6:152262958-152262980 AAGGTGATACAGGACATGGAGGG + Intronic
1017941698 6:159058775-159058797 AAGATTCTGAAGCAATTGGACGG - Intergenic
1018282724 6:162205155-162205177 AAGAAGAAGATGGACTTGGCCGG - Intronic
1018339622 6:162837837-162837859 AACAGGATTAATGACTTGGAAGG + Intronic
1018436755 6:163766703-163766725 AAGTCGATGAAGAACTTGGTTGG + Intergenic
1018912512 6:168110722-168110744 AATTTGATGTAGGATTTGGATGG - Intergenic
1020022401 7:4876957-4876979 CAGGTGCTAAAGGACTTGGAGGG + Intronic
1020127540 7:5541419-5541441 TAGAGGCTGAAGGACTTGGTGGG - Intronic
1020594647 7:10190609-10190631 ATGATGAATAAGAACTTGGAAGG + Intergenic
1022793892 7:33716667-33716689 ATGATGATGAAGGAGAAGGAGGG - Intergenic
1023002512 7:35825270-35825292 CAGATGAGGAAGGACTTTGTTGG - Intronic
1023127201 7:36966157-36966179 AAGATAATGTAAGACTTGAATGG - Intronic
1023393398 7:39731568-39731590 CAGATCATGAAGGACTTGAATGG + Intergenic
1024807046 7:53154060-53154082 TAGATGAAGATGGACTTGGATGG + Intergenic
1025070009 7:55889628-55889650 AAGATCATAAAGGGCTTTGAGGG - Intronic
1026081066 7:67221021-67221043 AAGAAAATAAAGCACTTGGACGG - Intronic
1026130894 7:67620095-67620117 AAGATAATGAAGAATTTGGAAGG - Intergenic
1026696018 7:72593004-72593026 AAGAAAATAAAGCACTTGGATGG + Intronic
1027696485 7:81417474-81417496 GAGATGATGAAGTATTTGAAAGG + Intergenic
1027800324 7:82742493-82742515 AAGAAAAGGAAGGACTGGGAAGG - Intergenic
1027895592 7:84039591-84039613 TAGATGATAAAGGACTTGACAGG + Intronic
1028554195 7:92104763-92104785 AAGGTGATGAAGGAAATGAAAGG - Intronic
1031670983 7:124545025-124545047 AAAATGATGAAAAACTTGGCCGG - Intergenic
1032686089 7:134235208-134235230 AAGATCATGGAGGACTTTGCAGG - Intronic
1033858405 7:145594396-145594418 TGGATGGTGAAGGACTTAGAAGG + Intergenic
1035376202 7:158407945-158407967 AAGATGAGGAGGGACTTTAAGGG - Intronic
1035376209 7:158408014-158408036 AAGATGAAGAGGGACTTTAAGGG - Intronic
1035527289 8:323877-323899 AAGATGATTCAGTACTTGCAAGG + Intergenic
1036217824 8:6895598-6895620 CAGAAGATGTAGGACTTGGAGGG - Intergenic
1037046787 8:14315443-14315465 AAGATTATGAAGCAAATGGAAGG + Intronic
1038271776 8:26081432-26081454 AAGAGGATGTGGGAATTGGAGGG - Intergenic
1039419508 8:37424275-37424297 GAGATGATGAGGGATTGGGATGG - Intergenic
1040873447 8:52124827-52124849 CAGCAGATGAAGGCCTTGGAAGG + Intronic
1041101243 8:54398205-54398227 AAGTTGAGGAAGGTCTTGGCTGG - Intergenic
1042831223 8:73031029-73031051 ATGATGAAGAAGTGCTTGGAAGG + Intronic
1042864228 8:73343629-73343651 AAGATGTTACATGACTTGGAGGG + Intergenic
1043002552 8:74777461-74777483 AATATGATGAAGATGTTGGATGG + Intronic
1044319363 8:90785299-90785321 AATATGATAAAGGACGTGAAAGG + Intronic
1046315249 8:112492514-112492536 GAGATGATGGAAGACCTGGATGG - Exonic
1048910002 8:139126146-139126168 TAGATGATTAGGAACTTGGAAGG - Intergenic
1050663844 9:7913063-7913085 GAGTTGAAGAAGCACTTGGATGG + Intergenic
1051083794 9:13323491-13323513 AAAATCCTGAAGGAGTTGGATGG - Intergenic
1052494545 9:29211603-29211625 AAGCTGCTGAAATACTTGGAGGG - Intergenic
1052679087 9:31665555-31665577 GAGATGATGCAGGAATTGGGTGG - Intergenic
1052980560 9:34445548-34445570 AAGAAGGTGAAGGACATGGCTGG + Intronic
1053062473 9:35043116-35043138 AAGATGGGGAAGGATCTGGAAGG - Exonic
1053548093 9:39044567-39044589 AAAATGATTAATGACTTTGAGGG - Intergenic
1053604263 9:39640897-39640919 AAAATGTTGAAGGAATTGCACGG - Intergenic
1053812213 9:41864607-41864629 AAAATGATTAATGACTTTGAGGG - Intergenic
1053862084 9:42396948-42396970 AAAATGTTGAAGGAATTGCACGG - Intergenic
1054148484 9:61581749-61581771 AAGATGAAGAAAGAGATGGAAGG - Intergenic
1054249277 9:62701517-62701539 AAAATGTTGAAGGAATTGCACGG + Intergenic
1054329836 9:63740671-63740693 AAGATGAAGAAGGAGTAGGCAGG + Intergenic
1054563389 9:66736049-66736071 AAAATGTTGAAGGAATTGCACGG + Intergenic
1054618382 9:67322832-67322854 AAAATGATTAATGACTTTGAGGG + Intergenic
1055248254 9:74273205-74273227 AAGAAGTTGAAGGAGTTGCAGGG - Intergenic
1055764385 9:79645902-79645924 AAGATAATAAAGGCCTAGGAAGG + Intronic
1056073154 9:83009954-83009976 AAAATGAAGAATGACTTTGAGGG - Intronic
1056684909 9:88751719-88751741 ATGATGATGAAGGCCTTTGAAGG + Intergenic
1057038350 9:91828975-91828997 GAGATGATGAGACACTTGGAAGG - Intronic
1058452821 9:105113040-105113062 AAGAAGATGAAGGAGAAGGAGGG + Intergenic
1058481655 9:105401989-105402011 CAGATGATGAAGGGGTGGGAGGG + Intronic
1061837692 9:133340397-133340419 GAGAAGATGAAGCACATGGATGG + Exonic
1187230777 X:17420621-17420643 CAGATGCTGAAGGCCTTTGATGG + Intronic
1187790100 X:22941418-22941440 AAATTGAGGAAGGACTTGGTTGG - Intergenic
1189460840 X:41241758-41241780 AAGCTGCTAAAGGATTTGGATGG - Intergenic
1190527809 X:51345740-51345762 CAGATGGTCAGGGACTTGGAGGG - Intergenic
1193664024 X:84293865-84293887 AAGAGGGTGAATGACATGGAGGG - Intergenic
1193882315 X:86937766-86937788 AAGAAGAGGAAAGACTTGGAAGG - Intergenic
1194411279 X:93561736-93561758 AAGAGGAAGAAGGACAGGGAAGG - Intergenic
1195262740 X:103149555-103149577 TGGATGGTCAAGGACTTGGAAGG + Intergenic
1195678797 X:107528081-107528103 ACAATGAAGAAGGAGTTGGAGGG + Intronic
1197952829 X:131916628-131916650 ATGATCATGAAAGACTTGGAAGG - Intergenic
1198042946 X:132872386-132872408 AAGCTGGTGAGGGACTTAGAAGG + Intronic
1198805514 X:140490494-140490516 CAAATGAGGTAGGACTTGGAGGG - Intergenic
1198885770 X:141334427-141334449 TAGAAGATGAGGGACTTGGGAGG + Intergenic
1199299690 X:146198433-146198455 AGGAAGATGAAGGACACGGAAGG + Intergenic
1199412702 X:147543159-147543181 AATATAATGAAGGAATTGGTAGG + Intergenic
1200087871 X:153618613-153618635 AAGAGGATGAAGAACTTCCAGGG - Intergenic
1201336232 Y:12883143-12883165 AAGAAGATGAAGGACTTATTCGG - Intergenic